CN116262913A - L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof - Google Patents

L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof Download PDF

Info

Publication number
CN116262913A
CN116262913A CN202111532134.4A CN202111532134A CN116262913A CN 116262913 A CN116262913 A CN 116262913A CN 202111532134 A CN202111532134 A CN 202111532134A CN 116262913 A CN116262913 A CN 116262913A
Authority
CN
China
Prior art keywords
gly
ile
val
ala
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111532134.4A
Other languages
Chinese (zh)
Inventor
吴涛
薛婷莉
栾明月
姚佳琪
胡丹
齐丹丹
赵津津
李岩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Langfang Meihua Bio Technology Development Co Ltd
Original Assignee
Langfang Meihua Bio Technology Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Langfang Meihua Bio Technology Development Co Ltd filed Critical Langfang Meihua Bio Technology Development Co Ltd
Priority to CN202111532134.4A priority Critical patent/CN116262913A/en
Publication of CN116262913A publication Critical patent/CN116262913A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/38—Nucleosides
    • C12P19/40—Nucleosides having a condensed ring system containing a six-membered ring having two nitrogen atoms in the same ring, e.g. purine nucleosides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01103—L-Threonine 3-dehydrogenase (1.1.1.103)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides an L-threonine 3-dehydrogenase and uracil-permease mutant and applications thereof. The invention realizes the mutation of the L-threonine 3-dehydrogenase by modifying tdh gene and mutating 282 th amino acid of the L-threonine 3-dehydrogenase from V to other amino acids (such as E, A or G); and/or, through modifying pyrP gene, the 283 rd amino acid of uracil-through enzyme is mutated from V to other amino acids (such as M, A or L), so that the mutation of uracil-through enzyme is realized, and the nucleoside producing capability of microorganism is improved. The L-threonine 3-dehydrogenase mutant strain and/or uracil-penetrating enzyme mutant strain provided by the invention has an obvious promotion effect on the improvement of the yield of the target product adenosine and inosine. The L-threonine 3-dehydrogenase mutant and/or uracil permease mutant and recombinant microorganisms thereof provide references for construction of production strains which produce adenosine, inosine and derivatives thereof as precursors.

Description

L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof
Technical Field
The invention belongs to the technical fields of genetic engineering and microbial fermentation, and particularly relates to an L-threonine 3-dehydrogenase and uracil permease mutant and application thereof.
Background
Nucleosides are a generic term for a class of glycosides. Nucleosides are constituents of nucleic acids and nucleotides. The nucleoside is formed by condensing D-ribose or D-Z-deoxyribose with pyrimidine base or purine base. The nucleoside is generally colorless crystals, insoluble in common organic solvents, soluble in hot water and having a melting point of 160-240 ℃. Nucleosides produced from D-ribose are called ribonucleosides, involved in RNA composition; nucleosides produced from D- α -deoxyribose are called deoxyribonucleosides and participate in DNA composition. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenine ribonucleoside, guanine ribonucleoside, cytosine ribonucleoside, thymine ribonucleoside, and uracil ribonucleoside, which are abbreviated as adenosine (A), guanosine (G), cytidine (C), thymidine (T), and uridine (U), respectively.
Guanosine and inosine have a wide range of uses in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively, and the combination of disodium guanylate and disodium inosinate is used as a food flavor enhancer, and is widely applied to condiments such as chicken essence, soy sauce and the like. In the field of medicine, guanosine and inosine can be used as medicine intermediates of various antiviral medicines, such as acyclovir, ribavirin, guanosine triphosphate sodium and the like, and guanosine is required to be used as a synthetic raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for synthesizing Adenylate (AMP) and Guanylate (GMP), and is suitable for treating leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, liver cirrhosis and the like caused by various reasons, and can also treat central retinitis, optic atrophy and the like.
At present, microbial fermentation is a main method for producing nucleosides, and mainly used microorganisms include bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus and the like. In the breeding and transformation process of the growing strain, the nucleoside high-yield strain is directionally bred by breeding through ultraviolet mutagenesis and chemical mutagenesis (such as diethyl sulfate); or based on the metabolic path and regulation mechanism of nucleotide in bacteria, the genetic background and the characteristics of the strain are deeply known, and the strain is purposefully modified by metabolic engineering means to obtain the production strain with excellent properties and high nucleoside yield. However, the fermentation performance of the current nucleoside strains is still poor, the conversion rate of the nucleosides is still low, and the requirement of large-scale industrial production cannot be met.
Disclosure of Invention
The invention aims to provide an L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof.
The invention also aims to provide a genetically engineered bacterium for producing nucleoside and nucleoside derivatives, and a construction method and application thereof.
The inventors have unexpectedly found that an L-threonine 3-dehydrogenase (encoded by tdh gene) and/or uracil-permease (encoded by pyrP gene) of a modified Bacillus (e.g., bacillus subtilis, bacillus amyloliquefaciens) enables a microorganism to produce adenosine or inosine with high efficiency and succeeded in constructing a novel microorganism capable of producing nucleosides with high efficiency, thereby completing the present invention.
To achieve the object of the present invention, in a first aspect, the present invention provides an L-threonine 3-dehydrogenase mutant comprising a mutation of amino acid 282 of the L-threonine 3-dehydrogenase from V to another amino acid other than V, preferably from V to E, A or G.
In the present invention, the reference sequence number of the L-threonine 3-dehydrogenase at NCBI is WP_003244880.1.
In a second aspect, the present invention provides a uracil-permease mutant comprising a mutation of amino acid 283 of uracil-permease from V to an amino acid other than V, preferably from V to M, A or L.
In the present invention, the uracil-permease has the reference sequence number WP_003221479.1 on NCBI.
In a third aspect, the invention provides nucleic acid molecules encoding said L-threonine 3-dehydrogenase mutants and/or said uracil-permease mutants.
In a fourth aspect, the invention provides biological materials comprising the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, or engineered bacteria.
In a fifth aspect, the invention provides any one of the following uses of the nucleic acid molecule or a biological material comprising the nucleic acid molecule:
(1) The method is used for fermentation production of nucleoside and nucleoside derivatives;
(2) The method is used for constructing the genetic engineering bacteria for producing the nucleoside and the nucleoside derivatives.
Preferably, the nucleoside is adenosine or inosine.
In a sixth aspect, the present invention provides a method for constructing a genetically engineered bacterium producing a nucleoside or a nucleoside derivative, the method being selected from any one of (1) to (3):
(1) introducing mutation into a bacterial genome having nucleoside-producing ability by genetic engineering means so that the encoded L-threonine 3-dehydrogenase comprises a V282E, V282A or V282G mutation site;
(2) introducing mutation into a bacterial genome with nucleoside producing ability by using genetic engineering means, so that uracil-permease encoded by the mutant comprises a V283M, V A or V283L mutation site;
(3) by genetic engineering means, mutation is introduced into the genome of a bacterium having nucleoside-producing ability so that the encoded L-threonine 3-dehydrogenase contains the V282E, V A or V282G mutation site, and the encoded uracil-permease contains the V283M, V A or V283L mutation site.
In the present invention, the bacteria are Bacillus species such as Bacillus subtilis (Bacillus subtilis), bacillus amyloliquefaciens (Bacillus amyloliquefaciens) or Bacillus pumilus (Bacillus pumilus), etc., preferably Bacillus subtilis A1 (Bacillus subtilis A1, abbreviated as strain A1, see CN 110257315B).
In a seventh aspect, the present invention provides a genetically engineered bacterium constructed according to the method.
In an eighth aspect, the invention provides any one of the following applications of the genetically engineered bacterium:
1) The method is used for fermentation production of nucleoside and nucleoside derivatives;
2) For improving the fermentation yield of nucleosides and nucleoside derivatives.
Preferably, the nucleoside is adenosine or inosine.
By means of the technical scheme, the invention has at least the following advantages and beneficial effects:
after the 282 th amino acid of the L-threonine 3-dehydrogenase is mutated from valine (V) to other amino acids such as glutamic acid (E), alanine (A) or glycine (G), the yield of adenosine and inosine is improved, and particularly, the effect is best after the valine (V) is mutated to glutamic acid (E). L-threonine 3-dehydrogenase mutant strain tdh V282E Compared with the original strain A1, the yield of the adenosine is increased from 1.3g/L to 1.8g/L, and the yield of the inosine is increased from 0.5g/L to 0.9g/L.
After the 283 rd amino acid of uracil permease is mutated from valine (V) to other amino acids such as methionine (M), alanine (A) or leucine (L), the yield of adenosine and inosine is greatly improved, which shows that the mutation site is favorable for the production of adenosine and inosine, and particularly the mutation of valine (V) to methionine (M) has the best effect. Uracil-permease mutant strain pyrP V283M Compared with the original strain A1, the yield of the adenosine is increased from 1.3g/L to 2.9g/L, and the yield of the inosine is increased from 0.5g/L to 1.1g/L.
L-threonine 3-dehydrogenase mutant tdh V282E Enzyme mutants permeable to uracil (pyrP) V283M 、pyrP V283A Or pyrP V283L ) After superposition, the effect is more outstanding, and the best production effect is: the adenosine yield was increased from 1.3g/L to 3.6g/L and the inosine yield was increased from 0.5g/L to 1.9g/L.
The mutation sites described above can be applied to Bacillus subtilis, but are not limited to Bacillus subtilis such as Bacillus amyloliquefaciens, bacillus pumilus, etc., for producing nucleosides such as adenosine, inosine, guanosine, etc., or corresponding nucleoside derivatives such as inosine, inosinic acid, guanylic acid, riboflavin, diacetylguanylic acid, etc.
Detailed Description
According to one of the technical schemes of the invention, a bacillus subtilis is provided, wherein 282 th amino acid of L-threonine 3-dehydrogenase coded by tdh genes in cells is mutated from valine (V) to glutamic acid (E), alanine (A) or glycine (G), and the corresponding base sequence is mutated from GTG to GAG, GCG or GGG respectively.
the tdh gene coded L-threonine 3-dehydrogenase can catalyze the dehydrogenation of L-threonine to produce L-2-amino-3-oxobutyrate, and simultaneously accompanies oxidized Nicotinamide Adenine Dinucleotide (NAD) + ) Is converted into reduced Nicotinamide Adenine Dinucleotide (NADH). The invention realizes mutation of L-threonine 3-dehydrogenase by modifying tdh gene, so that the capability of the microorganism for producing nucleoside is enhanced compared with an unmodified strain, and finally the yield of adenosine and inosine is improved.
In a second aspect of the present invention, there is provided a Bacillus subtilis comprising a bacterium in which the amino acid 283 of uracil-permease encoded by pyrP gene is mutated from valine (V) to methionine (M), alanine (A) or leucine (L), and the corresponding nucleotide sequence is mutated from GTG to ATG, GCG or CTG.
Uracil encoded by the pyrP gene is transported through enzymes during pyrimidine entry into and exit from cells. The invention realizes mutation of uracil through enzyme by modifying pyrP gene, and after 283 amino acids of the microorganism are mutated, the ability of producing nucleoside is enhanced, and finally the yields of adenosine and inosine are improved.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions.
Primer information related to the following examples is shown in Table 1.
TABLE 1 primer information
Primer name Primer sequence (5 '-3')
tdh V282E -UP-1F GAAACACACATTGTCTGTGGT
tdh V282E -UP-1R GGATGGTAAGCCCTTTAAATACCTCTTTATTCGTCAAATCAATTG
tdh V282E -DN-2F CAATTGATTTGACGAATAAAGAGGTATTTAAAGGGCTTACCATCC
tdh V282E -DN-2R AAAGGCTGCCAGCTTTTTCTC
tdh V282A -UP-1R GGATGGTAAGCCCTTTAAATACCGCTTTATTCGTCAAATCAATTG
tdh V282A -DN-2F CAATTGATTTGACGAATAAAGCGGTATTTAAAGGGCTTACCATCC
tdh V282G -UP-1R GGATGGTAAGCCCTTTAAATACCCCTTTATTCGTCAAATCAATTG
tdh V282G -DN-2F CAATTGATTTGACGAATAAAGGGGTATTTAAAGGGCTTACCATCC
pyrP V283M -UP-1F GCTGATTGCCTTATTGATTAG
pyrP V283M -UP-1R CAGGGAAGCGAGGATTGTCGCCATACTGTCACCCATAATAGAGCG
pyrP V283M -DN-2F CGCTCTATTATGGGTGACAGTATGGCGACAATCCTCGCTTCCCTG
pyrP V283M -DN-2R TCACTCATCGTCGTTAAATGC
pyrP V283A -UP-1R CAGGGAAGCGAGGATTGTCGCCGCACTGTCACCCATAATAGAGCG
pyrP V283A -DN-2F CGCTCTATTATGGGTGACAGTGCGGCGACAATCCTCGCTTCCCTG
pyrP V283L -UP-1R CAGGGAAGCGAGGATTGTCGCCAGACTGTCACCCATAATAGAGCG
pyrP V283L -DN-2F CGCTCTATTATGGGTGACAGTCTGGCGACAATCCTCGCTTCCCTG
EXAMPLE 1L-threonine 3-dehydrogenase mutant strain tdh V282E Construction of (3)
The strain B.subtilis A1 genome is used as a template, and a primer tdh V282E -UP-1F/tdh V282E -UP-1R and tdh V282E -DN-2F/tdh V282E DN-2R, 2 fragments were amplified using Phusion super Fidelity polymerase (New England BioLabs). With primer tdh V282E -UP-1F/tdh V282E The DN-2R fuses the 2 fragments to obtain the recombinant fragment ORF region with the nucleotide sequence shown in SEQ ID NO. 1 and the amino acid sequence shown in SEQ ID NO. 2. Tdh is taken V282E Fragment and pKSU plasmid (pKSU plasmid is given by university of south opening Wang Shufang, see A markerless gene replacement method for B. Amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-gamma-glutamic acid production [ J)]The recombinant plasmid pKSU-tdh is obtained after operations such as assembly and transformation of 8963-8973.Zhang W,Gao W,Feng J,et al DOI:10.1007/s00253-014-5824-2 (21), applied Microbiology and Biotechnology,2014,98 (21) V282E . Transforming into B.subtilis A1 strain, screening transformant with LB plate containing 2.5 mug/mL chloramphenicol at 30 ℃, inoculating obtained transformant into 5mL LB liquid medium, culturing at 42 ℃ at 200rpm for 12h and transferring to generation, diluting and coating to LB plate containing 5 mug/mL chloramphenicol to obtain primary recombinant; transferring the primary recombinants into 5ml LB liquid medium, culturing at 42 ℃ for 12h at 200rpm and transferring to the first generation, diluting and coating LB plate containing 0.8 mu M5-FU for screening the secondary recombinants, and screening to obtain tdh V282E Point mutant strain designated B.subtilis A1-tdh V282E Abbreviated as tdh V282E 。
EXAMPLE 2L-threonine 3-dehydrogenase mutant strain tdh V282A And tdh V282G Construction of (3)
Specific construction method As in example 1, L-threonine 3-dehydrogenase mutant strain tdh V282A The primer used was tdh V282E -UP-1F/tdh V282A -UP-1R and tdh V282A -DN-2F/tdh V282E DN-2R, the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO. 3, and the amino acid sequence is shown as SEQ ID NO. 4. The plasmid obtained by construction is pKSU-tdh V282A The strain obtained was designated as B.subtilis A1-tdh V282A Abbreviated as tdh V282A 。
L-threonine 3-dehydrogenase mutant strain tdh V282G The primer used was tdh V282E -UP-1F/tdh VV282G -UP-1R and tdh V282G -DN-2F/tdh V282E DN-2R, the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO. 5, and the amino acid sequence is shown as SEQ ID NO. 6. The plasmid obtained by construction is pKSU-tdh V282G The strain obtained was designated as B.subtilis A1-tdh V282G Abbreviated as tdh V282G 。
EXAMPLE 3 uracil-permease mutant strain pyrP V283M 、pyrP V283A And pyrP V283L Construction of (3)
Specific construction method As in example 1, uracil-permease mutant strain pyrP V283M The primer used was pyrP V283M -UP-1F/pyrP V283M -UP-1R and pyrP V283M -DN-2F/pyrP V283M DN-2R, the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO. 7, and the amino acid sequence is shown as SEQ ID NO. 8. The plasmid obtained by construction is pKSU-pyrP V283M The strain obtained was designated B.subilis A1-pyrP V283M Hereinafter abbreviated as pyrP V283M 。
Uracil-permease mutant strain pyrP V283A The primer used was pyrP V283M -UP-1F/pyrP V283A -UP-1R and pyrP V283A -DN-2F/pyrP V283M DN-2R, the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO. 9, and the amino acid sequence is shown as SEQ ID NO. 10. The plasmid obtained by construction is pKSU-pyrP V283A The strain obtained was designated B.subilis A1-pyrP V283A Abbreviated pyrP V283A 。
Uracil-permease mutant strain pyrP V283L The primer used was pyrP V283M -UP-1F/pyrP V283L -UP-1R and pyrP V283L -DN-2F/pyrP V283M DN-2R, the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO. 11, and the amino acid sequence is shown as SEQ ID NO. 12. The plasmid obtained by construction is pKSU-pyrP V283L The strain obtained was designated B.subilis A1-pyrP V283L Abbreviated pyrP V283L 。
EXAMPLE 4 construction of double mutant strains of L-threonine 3-dehydrogenase and uracil-permease
Mutant strain B.subtilis A1-tdh in L-threonine 3-dehydrogenase V282E Superimposed uracil-permease mutation pyrP V283M 、pyrP V283A 、pyrP V283L 。
With strain B.subtilis A1-tdh V282E The genome was used as a template, and the specific construction method was the same as in example 3, and the strains obtained by the construction were named B.subtilis A1-tdh, respectively V282E pyrP V283M 、B.subtilis A1-tdh V282E pyrP V283A 、B.subtilis A1-tdh V282E pyrP V283L Abbreviated as tdh V282E pyrP V283M 、tdh V282E pyrP V283A 、tdh V282E pyrP V283L 。
Example 5 ability of engineering strains to fermentatively produce nucleosides
1. Culture medium
(1) Seed culture formula (g/L): glucose 20, yeast powder 5, corn steep liquor dry powder 5, monopotassium phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0-7.2 and sterilizing at 121 ℃ for 20min.
(2) Fermentation medium formulation (g/L): glucose 60, yeast powder 3.5, monopotassium phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn steep liquor dry powder 15, calcium carbonate 25, pH 7.0-7.2 and sterilizing at 121 ℃ for 20min.
2. Culture method
(1) Culturing the strain three-area line LB plate at 37 ℃ overnight;
(2) Inoculating the single colony into 30mL seed culture medium, and culturing at 36 ℃ for 7-8 h at 110 rpm;
(3) Transferring into 30ml fermentation medium according to 10% inoculum size, and culturing at 36 deg.C at 120 rpm;
3. detection and results
Detection of cell concentration at 562nm wavelength using a spectrophotometer (OD 562 ) The method comprises the steps of carrying out a first treatment on the surface of the The detection of nucleosides in the fermentation broth was performed using High Performance Liquid Chromatography (HPLC), the results are shown in table 2.
TABLE 2 engineering bacteria shake flask fermentation production ability evaluation results (three repeated mean values)
Strain OD 562 Adenosine yield (g/L) Inosine yield (g/L)
A1 25.3 1.3 0.5
tdh V282E 24.8 1.8* 0.9*
tdh V282A 25.1 1.6* 1.0*
tdh V282G 24.6 1.7* 0.8*
pyrP V283M 24.9 2.9* 1.1*
pyrP V283A 24.5* 2.5* 1.3*
pyrP V283L 24.2* 2.2* 1.5*
tdh V282E pyrP V283M 25.4 3.6* 1.6*
tdh V282E pyrP V283A 25.0 3.0* 1.8*
tdh V282E pyrP V283L 24.7* 2.8* 1.9*
Note that: * Indicating a significant difference compared to the starting strain, P <0.05.
As can be seen from the above experimental results, the L-threonine 3-dehydrogenase mutant (tdh V282E 、tdh V282A And tdh V282G ) Uracil-permease mutant (pyrP) V283M 、pyrP V283A And pyrP V283L ) Has positive effect on the improvement of the yields of the adenosine and the inosine, and the mutation superposition effect of the two enzymes is more prominent, the yield of the adenosine is improved from 1.3g/L to 3.6g/L, and the yield of the inosine is improved from 0.5g/L to 1.9g/L.
The L-threonine 3-dehydrogenase has improved adenosine production after mutation of amino acid 282 from valine (V) to glutamic acid (E), alanine (A) or glycine (G), and particularly has best effect after mutation of valine (V) to glutamic acid (E). L-threonine 3-dehydrogenase mutant strain tdh V282E Compared with the original strain A1, the yield of the adenosine is increased from 1.3g/L to 1.8g/L, and the yield of the inosine is increased from 0.5g/L to 0.9g/L.
After the 283 rd amino acid of uracil is mutated from valine (V) to methionine (M), alanine (A) or leucine (L), the yields of adenosine and inosine are greatly improved, which shows that the mutation site is favorable for the production of adenosine and adenosine, and particularly the mutation of valine (V) to methionine (M) has the best effect. Uracil-permease mutant strain pyrP V283M Compared with the original strain A1, the yield of the adenosine is increased from 1.3g/L to 2.9g/L, and the yield of the inosine is increased from 0.5g/L to 1.1g/L.
L-threonine 3-dehydrogenase mutant tdh V282E Enzyme mutants permeable to uracil (pyrP) V283M 、pyrP V283A Or pyrP V283L ) After superposition, the effect is more outstanding, and the best production effect is: the adenosine yield was increased from 1.3g/L to 3.6g/L and the inosine yield was increased from 0.5g/L to 1.9g/L.
Therefore, the L-threonine 3-dehydrogenase mutant strain and/or uracil provided by the invention have obvious promotion effect on the increase of the yield of the target product adenosine and inosine through the enzyme mutant strain. The L-threonine 3-dehydrogenase mutant and/or uracil permease mutant and recombinant microorganisms thereof provide references for construction of production strains which produce adenosine, inosine and derivatives thereof as precursors.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> gallery plum blossom biotechnology development Co., ltd
<120> L-threonine 3-dehydrogenase and uracil-permease mutant and use thereof
<130> KHP211124097.7
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1044
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atgcagagtg gaaagatgaa agctctaatg aaaaaggacg gggcgttcgg tgctgtgctg 60
actgaagttc ccattcctga gattgataaa catgaagtcc tcataaaagt gaaagccgct 120
tccatatgcg gcacggatgt ccacatttat aattgggatc aatgggcacg tcagagaatc 180
aaaacaccct atgttttcgg ccatgagttc agcggcatcg tagagggcgt gggagagaat 240
gtcagcagtg taaaagtggg agagtatgtg tctgcggaaa cacacattgt ctgtggtgaa 300
tgtgtccctt gcctaacagg aaaatctcat gtgtgtacca atactgctat aatcggagtg 360
gacacggcag gctgttttgc ggagtatgta aaagttccag ctgataacat ttggagaaat 420
cccgctgata tggacccgtc gattgcttcc attcaagagc ctttaggaaa tgcagttcat 480
accgtactcg agagccagcc tgcaggagga acgactgcag tcattggatg cggaccgatt 540
ggtcttatgg ctgttgcggt tgcaaaagca gcaggagctt ctcaggtgat agcgattgat 600
aagaatgaat acaggctgag gcttgcaaaa caaatgggag cgacttgtac tgtttctatt 660
gaaaaagaag acccgctcaa aattgtaagc gctttaacga gtggagaagg agcagatctt 720
gtttgtgaga tgtcgggcca tccctcagcg attgcccaag gtcttgcgat ggctgcgaat 780
ggcggaagat ttcatattct cagcttgccg gaacatccgg tgacaattga tttgacgaat 840
aaagaggtat ttaaagggct taccatccaa ggaatcacag gaagaaaaat gttttcaaca 900
tggcgccagg tgtctcagtt gatcagttca aacatgatcg atcttgcacc tgttattacc 960
catcagtttc cattagagga gtttgaaaaa ggtttcgaac tgatgagaag cgggcagtgc 1020
ggaaaagtaa ttttaattcc ataa 1044
<210> 2
<211> 347
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 2
Met Gln Ser Gly Lys Met Lys Ala Leu Met Lys Lys Asp Gly Ala Phe
1 5 10 15
Gly Ala Val Leu Thr Glu Val Pro Ile Pro Glu Ile Asp Lys His Glu
20 25 30
Val Leu Ile Lys Val Lys Ala Ala Ser Ile Cys Gly Thr Asp Val His
35 40 45
Ile Tyr Asn Trp Asp Gln Trp Ala Arg Gln Arg Ile Lys Thr Pro Tyr
50 55 60
Val Phe Gly His Glu Phe Ser Gly Ile Val Glu Gly Val Gly Glu Asn
65 70 75 80
Val Ser Ser Val Lys Val Gly Glu Tyr Val Ser Ala Glu Thr His Ile
85 90 95
Val Cys Gly Glu Cys Val Pro Cys Leu Thr Gly Lys Ser His Val Cys
100 105 110
Thr Asn Thr Ala Ile Ile Gly Val Asp Thr Ala Gly Cys Phe Ala Glu
115 120 125
Tyr Val Lys Val Pro Ala Asp Asn Ile Trp Arg Asn Pro Ala Asp Met
130 135 140
Asp Pro Ser Ile Ala Ser Ile Gln Glu Pro Leu Gly Asn Ala Val His
145 150 155 160
Thr Val Leu Glu Ser Gln Pro Ala Gly Gly Thr Thr Ala Val Ile Gly
165 170 175
Cys Gly Pro Ile Gly Leu Met Ala Val Ala Val Ala Lys Ala Ala Gly
180 185 190
Ala Ser Gln Val Ile Ala Ile Asp Lys Asn Glu Tyr Arg Leu Arg Leu
195 200 205
Ala Lys Gln Met Gly Ala Thr Cys Thr Val Ser Ile Glu Lys Glu Asp
210 215 220
Pro Leu Lys Ile Val Ser Ala Leu Thr Ser Gly Glu Gly Ala Asp Leu
225 230 235 240
Val Cys Glu Met Ser Gly His Pro Ser Ala Ile Ala Gln Gly Leu Ala
245 250 255
Met Ala Ala Asn Gly Gly Arg Phe His Ile Leu Ser Leu Pro Glu His
260 265 270
Pro Val Thr Ile Asp Leu Thr Asn Lys Glu Val Phe Lys Gly Leu Thr
275 280 285
Ile Gln Gly Ile Thr Gly Arg Lys Met Phe Ser Thr Trp Arg Gln Val
290 295 300
Ser Gln Leu Ile Ser Ser Asn Met Ile Asp Leu Ala Pro Val Ile Thr
305 310 315 320
His Gln Phe Pro Leu Glu Glu Phe Glu Lys Gly Phe Glu Leu Met Arg
325 330 335
Ser Gly Gln Cys Gly Lys Val Ile Leu Ile Pro
340 345
<210> 3
<211> 1044
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atgcagagtg gaaagatgaa agctctaatg aaaaaggacg gggcgttcgg tgctgtgctg 60
actgaagttc ccattcctga gattgataaa catgaagtcc tcataaaagt gaaagccgct 120
tccatatgcg gcacggatgt ccacatttat aattgggatc aatgggcacg tcagagaatc 180
aaaacaccct atgttttcgg ccatgagttc agcggcatcg tagagggcgt gggagagaat 240
gtcagcagtg taaaagtggg agagtatgtg tctgcggaaa cacacattgt ctgtggtgaa 300
tgtgtccctt gcctaacagg aaaatctcat gtgtgtacca atactgctat aatcggagtg 360
gacacggcag gctgttttgc ggagtatgta aaagttccag ctgataacat ttggagaaat 420
cccgctgata tggacccgtc gattgcttcc attcaagagc ctttaggaaa tgcagttcat 480
accgtactcg agagccagcc tgcaggagga acgactgcag tcattggatg cggaccgatt 540
ggtcttatgg ctgttgcggt tgcaaaagca gcaggagctt ctcaggtgat agcgattgat 600
aagaatgaat acaggctgag gcttgcaaaa caaatgggag cgacttgtac tgtttctatt 660
gaaaaagaag acccgctcaa aattgtaagc gctttaacga gtggagaagg agcagatctt 720
gtttgtgaga tgtcgggcca tccctcagcg attgcccaag gtcttgcgat ggctgcgaat 780
ggcggaagat ttcatattct cagcttgccg gaacatccgg tgacaattga tttgacgaat 840
aaagcggtat ttaaagggct taccatccaa ggaatcacag gaagaaaaat gttttcaaca 900
tggcgccagg tgtctcagtt gatcagttca aacatgatcg atcttgcacc tgttattacc 960
catcagtttc cattagagga gtttgaaaaa ggtttcgaac tgatgagaag cgggcagtgc 1020
ggaaaagtaa ttttaattcc ataa 1044
<210> 4
<211> 347
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 4
Met Gln Ser Gly Lys Met Lys Ala Leu Met Lys Lys Asp Gly Ala Phe
1 5 10 15
Gly Ala Val Leu Thr Glu Val Pro Ile Pro Glu Ile Asp Lys His Glu
20 25 30
Val Leu Ile Lys Val Lys Ala Ala Ser Ile Cys Gly Thr Asp Val His
35 40 45
Ile Tyr Asn Trp Asp Gln Trp Ala Arg Gln Arg Ile Lys Thr Pro Tyr
50 55 60
Val Phe Gly His Glu Phe Ser Gly Ile Val Glu Gly Val Gly Glu Asn
65 70 75 80
Val Ser Ser Val Lys Val Gly Glu Tyr Val Ser Ala Glu Thr His Ile
85 90 95
Val Cys Gly Glu Cys Val Pro Cys Leu Thr Gly Lys Ser His Val Cys
100 105 110
Thr Asn Thr Ala Ile Ile Gly Val Asp Thr Ala Gly Cys Phe Ala Glu
115 120 125
Tyr Val Lys Val Pro Ala Asp Asn Ile Trp Arg Asn Pro Ala Asp Met
130 135 140
Asp Pro Ser Ile Ala Ser Ile Gln Glu Pro Leu Gly Asn Ala Val His
145 150 155 160
Thr Val Leu Glu Ser Gln Pro Ala Gly Gly Thr Thr Ala Val Ile Gly
165 170 175
Cys Gly Pro Ile Gly Leu Met Ala Val Ala Val Ala Lys Ala Ala Gly
180 185 190
Ala Ser Gln Val Ile Ala Ile Asp Lys Asn Glu Tyr Arg Leu Arg Leu
195 200 205
Ala Lys Gln Met Gly Ala Thr Cys Thr Val Ser Ile Glu Lys Glu Asp
210 215 220
Pro Leu Lys Ile Val Ser Ala Leu Thr Ser Gly Glu Gly Ala Asp Leu
225 230 235 240
Val Cys Glu Met Ser Gly His Pro Ser Ala Ile Ala Gln Gly Leu Ala
245 250 255
Met Ala Ala Asn Gly Gly Arg Phe His Ile Leu Ser Leu Pro Glu His
260 265 270
Pro Val Thr Ile Asp Leu Thr Asn Lys Ala Val Phe Lys Gly Leu Thr
275 280 285
Ile Gln Gly Ile Thr Gly Arg Lys Met Phe Ser Thr Trp Arg Gln Val
290 295 300
Ser Gln Leu Ile Ser Ser Asn Met Ile Asp Leu Ala Pro Val Ile Thr
305 310 315 320
His Gln Phe Pro Leu Glu Glu Phe Glu Lys Gly Phe Glu Leu Met Arg
325 330 335
Ser Gly Gln Cys Gly Lys Val Ile Leu Ile Pro
340 345
<210> 5
<211> 1044
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atgcagagtg gaaagatgaa agctctaatg aaaaaggacg gggcgttcgg tgctgtgctg 60
actgaagttc ccattcctga gattgataaa catgaagtcc tcataaaagt gaaagccgct 120
tccatatgcg gcacggatgt ccacatttat aattgggatc aatgggcacg tcagagaatc 180
aaaacaccct atgttttcgg ccatgagttc agcggcatcg tagagggcgt gggagagaat 240
gtcagcagtg taaaagtggg agagtatgtg tctgcggaaa cacacattgt ctgtggtgaa 300
tgtgtccctt gcctaacagg aaaatctcat gtgtgtacca atactgctat aatcggagtg 360
gacacggcag gctgttttgc ggagtatgta aaagttccag ctgataacat ttggagaaat 420
cccgctgata tggacccgtc gattgcttcc attcaagagc ctttaggaaa tgcagttcat 480
accgtactcg agagccagcc tgcaggagga acgactgcag tcattggatg cggaccgatt 540
ggtcttatgg ctgttgcggt tgcaaaagca gcaggagctt ctcaggtgat agcgattgat 600
aagaatgaat acaggctgag gcttgcaaaa caaatgggag cgacttgtac tgtttctatt 660
gaaaaagaag acccgctcaa aattgtaagc gctttaacga gtggagaagg agcagatctt 720
gtttgtgaga tgtcgggcca tccctcagcg attgcccaag gtcttgcgat ggctgcgaat 780
ggcggaagat ttcatattct cagcttgccg gaacatccgg tgacaattga tttgacgaat 840
aaaggggtat ttaaagggct taccatccaa ggaatcacag gaagaaaaat gttttcaaca 900
tggcgccagg tgtctcagtt gatcagttca aacatgatcg atcttgcacc tgttattacc 960
catcagtttc cattagagga gtttgaaaaa ggtttcgaac tgatgagaag cgggcagtgc 1020
ggaaaagtaa ttttaattcc ataa 1044
<210> 6
<211> 347
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 6
Met Gln Ser Gly Lys Met Lys Ala Leu Met Lys Lys Asp Gly Ala Phe
1 5 10 15
Gly Ala Val Leu Thr Glu Val Pro Ile Pro Glu Ile Asp Lys His Glu
20 25 30
Val Leu Ile Lys Val Lys Ala Ala Ser Ile Cys Gly Thr Asp Val His
35 40 45
Ile Tyr Asn Trp Asp Gln Trp Ala Arg Gln Arg Ile Lys Thr Pro Tyr
50 55 60
Val Phe Gly His Glu Phe Ser Gly Ile Val Glu Gly Val Gly Glu Asn
65 70 75 80
Val Ser Ser Val Lys Val Gly Glu Tyr Val Ser Ala Glu Thr His Ile
85 90 95
Val Cys Gly Glu Cys Val Pro Cys Leu Thr Gly Lys Ser His Val Cys
100 105 110
Thr Asn Thr Ala Ile Ile Gly Val Asp Thr Ala Gly Cys Phe Ala Glu
115 120 125
Tyr Val Lys Val Pro Ala Asp Asn Ile Trp Arg Asn Pro Ala Asp Met
130 135 140
Asp Pro Ser Ile Ala Ser Ile Gln Glu Pro Leu Gly Asn Ala Val His
145 150 155 160
Thr Val Leu Glu Ser Gln Pro Ala Gly Gly Thr Thr Ala Val Ile Gly
165 170 175
Cys Gly Pro Ile Gly Leu Met Ala Val Ala Val Ala Lys Ala Ala Gly
180 185 190
Ala Ser Gln Val Ile Ala Ile Asp Lys Asn Glu Tyr Arg Leu Arg Leu
195 200 205
Ala Lys Gln Met Gly Ala Thr Cys Thr Val Ser Ile Glu Lys Glu Asp
210 215 220
Pro Leu Lys Ile Val Ser Ala Leu Thr Ser Gly Glu Gly Ala Asp Leu
225 230 235 240
Val Cys Glu Met Ser Gly His Pro Ser Ala Ile Ala Gln Gly Leu Ala
245 250 255
Met Ala Ala Asn Gly Gly Arg Phe His Ile Leu Ser Leu Pro Glu His
260 265 270
Pro Val Thr Ile Asp Leu Thr Asn Lys Gly Val Phe Lys Gly Leu Thr
275 280 285
Ile Gln Gly Ile Thr Gly Arg Lys Met Phe Ser Thr Trp Arg Gln Val
290 295 300
Ser Gln Leu Ile Ser Ser Asn Met Ile Asp Leu Ala Pro Val Ile Thr
305 310 315 320
His Gln Phe Pro Leu Glu Glu Phe Glu Lys Gly Phe Glu Leu Met Arg
325 330 335
Ser Gly Gln Cys Gly Lys Val Ile Leu Ile Pro
340 345
<210> 7
<211> 1308
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atgagtaaga aaaaagtaaa tttaggggtc agggatgtcc cgacaccttt ctcttgggtt 60
tcattcagcc ttcagcattt gtttgccatg tttggctcaa ccattttggt tccgaagctc 120
gtcggaatga gtcctgctgt ggcgttggtg acaagcggca tcggaacact ggcgtacctt 180
cttattacca aaggacaaat tccggcgtat ctcggttcat ccttcgcctt tatttctccg 240
atcattctgg taaaagcgac cggcgggccg ggagcggcaa tggttggagc gtttcttgca 300
gggctggtgt acgggctgat tgccttattg attaggcagc ttggaacagg atggctgatg 360
aagattctcc cgcctgtagt cgtagggcct gttattatcg tcatcgggct gggactggca 420
agcactgcag taaacatggc gatgtatgct gatccgaacg cgagtgagtt ggtctacagc 480
ttaaagcact ttagtgtcgc aggagttacg ctggcaatta cgattatttg tgcgattttc 540
ttacgagggt ttttaagcct gattccggtt ctgatcggaa tcatcggcgg atacctgttt 600
gcccttactc aagggattgt caacttccag ccggtgcttg acgcgaaatg gtttgcagtg 660
cctgaattta tcattccgtt caaagattat tcaccgtcag ttacgctcgg catcgcagcc 720
gcaatggttc ctgtcgcatt tgtcacaatg tcagagcata tcggccacca aatggtgctg 780
agcaaggttg tcggacaaga cttcattaaa aagccaggtc ttcatcgctc tattatgggt 840
gacagtgtgg cgacaatcct cgcttccctg atcggcggcc ctccgacaac gacttacgga 900
gaaaacattg gcgtgctggc catcacaaga gtattcagcg tctttgtcat cgggggcgcg 960
gcagtgattg ccctttgctt cggctttatc ggcaaaattt cagcgctgat cagttcagtg 1020
ccgtcagcgg tcatgggagg cgtctccttc ctgctgttcg gaatcattgc ttcaagcggc 1080
ctgagaatgc tgattgacaa caaaattgat tatgaaaaca acagaaacct cattattaca 1140
tcagttatcc ttgtcatcgg tgtaggaggc gcttttatcc aagtgtctca gggcggattc 1200
caagtgtcag gaatggcgct tgccgcaatt gtcggtgtca tcttaaacct gattcttccg 1260
caggcgaagg aagagcaggc agacacatct gaacaacatc atatttaa 1308
<210> 8
<211> 435
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 8
Met Ser Lys Lys Lys Val Asn Leu Gly Val Arg Asp Val Pro Thr Pro
1 5 10 15
Phe Ser Trp Val Ser Phe Ser Leu Gln His Leu Phe Ala Met Phe Gly
20 25 30
Ser Thr Ile Leu Val Pro Lys Leu Val Gly Met Ser Pro Ala Val Ala
35 40 45
Leu Val Thr Ser Gly Ile Gly Thr Leu Ala Tyr Leu Leu Ile Thr Lys
50 55 60
Gly Gln Ile Pro Ala Tyr Leu Gly Ser Ser Phe Ala Phe Ile Ser Pro
65 70 75 80
Ile Ile Leu Val Lys Ala Thr Gly Gly Pro Gly Ala Ala Met Val Gly
85 90 95
Ala Phe Leu Ala Gly Leu Val Tyr Gly Leu Ile Ala Leu Leu Ile Arg
100 105 110
Gln Leu Gly Thr Gly Trp Leu Met Lys Ile Leu Pro Pro Val Val Val
115 120 125
Gly Pro Val Ile Ile Val Ile Gly Leu Gly Leu Ala Ser Thr Ala Val
130 135 140
Asn Met Ala Met Tyr Ala Asp Pro Asn Ala Ser Glu Leu Val Tyr Ser
145 150 155 160
Leu Lys His Phe Ser Val Ala Gly Val Thr Leu Ala Ile Thr Ile Ile
165 170 175
Cys Ala Ile Phe Leu Arg Gly Phe Leu Ser Leu Ile Pro Val Leu Ile
180 185 190
Gly Ile Ile Gly Gly Tyr Leu Phe Ala Leu Thr Gln Gly Ile Val Asn
195 200 205
Phe Gln Pro Val Leu Asp Ala Lys Trp Phe Ala Val Pro Glu Phe Ile
210 215 220
Ile Pro Phe Lys Asp Tyr Ser Pro Ser Val Thr Leu Gly Ile Ala Ala
225 230 235 240
Ala Met Val Pro Val Ala Phe Val Thr Met Ser Glu His Ile Gly His
245 250 255
Gln Met Val Leu Ser Lys Val Val Gly Gln Asp Phe Ile Lys Lys Pro
260 265 270
Gly Leu His Arg Ser Ile Met Gly Asp Ser Met Ala Thr Ile Leu Ala
275 280 285
Ser Leu Ile Gly Gly Pro Pro Thr Thr Thr Tyr Gly Glu Asn Ile Gly
290 295 300
Val Leu Ala Ile Thr Arg Val Phe Ser Val Phe Val Ile Gly Gly Ala
305 310 315 320
Ala Val Ile Ala Leu Cys Phe Gly Phe Ile Gly Lys Ile Ser Ala Leu
325 330 335
Ile Ser Ser Val Pro Ser Ala Val Met Gly Gly Val Ser Phe Leu Leu
340 345 350
Phe Gly Ile Ile Ala Ser Ser Gly Leu Arg Met Leu Ile Asp Asn Lys
355 360 365
Ile Asp Tyr Glu Asn Asn Arg Asn Leu Ile Ile Thr Ser Val Ile Leu
370 375 380
Val Ile Gly Val Gly Gly Ala Phe Ile Gln Val Ser Gln Gly Gly Phe
385 390 395 400
Gln Val Ser Gly Met Ala Leu Ala Ala Ile Val Gly Val Ile Leu Asn
405 410 415
Leu Ile Leu Pro Gln Ala Lys Glu Glu Gln Ala Asp Thr Ser Glu Gln
420 425 430
His His Ile
435
<210> 9
<211> 1308
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
atgagtaaga aaaaagtaaa tttaggggtc agggatgtcc cgacaccttt ctcttgggtt 60
tcattcagcc ttcagcattt gtttgccatg tttggctcaa ccattttggt tccgaagctc 120
gtcggaatga gtcctgctgt ggcgttggtg acaagcggca tcggaacact ggcgtacctt 180
cttattacca aaggacaaat tccggcgtat ctcggttcat ccttcgcctt tatttctccg 240
atcattctgg taaaagcgac cggcgggccg ggagcggcaa tggttggagc gtttcttgca 300
gggctggtgt acgggctgat tgccttattg attaggcagc ttggaacagg atggctgatg 360
aagattctcc cgcctgtagt cgtagggcct gttattatcg tcatcgggct gggactggca 420
agcactgcag taaacatggc gatgtatgct gatccgaacg cgagtgagtt ggtctacagc 480
ttaaagcact ttagtgtcgc aggagttacg ctggcaatta cgattatttg tgcgattttc 540
ttacgagggt ttttaagcct gattccggtt ctgatcggaa tcatcggcgg atacctgttt 600
gcccttactc aagggattgt caacttccag ccggtgcttg acgcgaaatg gtttgcagtg 660
cctgaattta tcattccgtt caaagattat tcaccgtcag ttacgctcgg catcgcagcc 720
gcaatggttc ctgtcgcatt tgtcacaatg tcagagcata tcggccacca aatggtgctg 780
agcaaggttg tcggacaaga cttcattaaa aagccaggtc ttcatcgctc tattatgggt 840
gacagtgtgg cgacaatcct cgcttccctg atcggcggcc ctccgacaac gacttacgga 900
gaaaacattg gcgtgctggc catcacaaga gtattcagcg tctttgtcat cgggggcgcg 960
gcagtgattg ccctttgctt cggctttatc ggcaaaattt cagcgctgat cagttcagtg 1020
ccgtcagcgg tcatgggagg cgtctccttc ctgctgttcg gaatcattgc ttcaagcggc 1080
ctgagaatgc tgattgacaa caaaattgat tatgaaaaca acagaaacct cattattaca 1140
tcagttatcc ttgtcatcgg tgtaggaggc gcttttatcc aagtgtctca gggcggattc 1200
caagtgtcag gaatggcgct tgccgcaatt gtcggtgtca tcttaaacct gattcttccg 1260
caggcgaagg aagagcaggc agacacatct gaacaacatc atatttaa 1308
<210> 10
<211> 435
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 10
Met Ser Lys Lys Lys Val Asn Leu Gly Val Arg Asp Val Pro Thr Pro
1 5 10 15
Phe Ser Trp Val Ser Phe Ser Leu Gln His Leu Phe Ala Met Phe Gly
20 25 30
Ser Thr Ile Leu Val Pro Lys Leu Val Gly Met Ser Pro Ala Val Ala
35 40 45
Leu Val Thr Ser Gly Ile Gly Thr Leu Ala Tyr Leu Leu Ile Thr Lys
50 55 60
Gly Gln Ile Pro Ala Tyr Leu Gly Ser Ser Phe Ala Phe Ile Ser Pro
65 70 75 80
Ile Ile Leu Val Lys Ala Thr Gly Gly Pro Gly Ala Ala Met Val Gly
85 90 95
Ala Phe Leu Ala Gly Leu Val Tyr Gly Leu Ile Ala Leu Leu Ile Arg
100 105 110
Gln Leu Gly Thr Gly Trp Leu Met Lys Ile Leu Pro Pro Val Val Val
115 120 125
Gly Pro Val Ile Ile Val Ile Gly Leu Gly Leu Ala Ser Thr Ala Val
130 135 140
Asn Met Ala Met Tyr Ala Asp Pro Asn Ala Ser Glu Leu Val Tyr Ser
145 150 155 160
Leu Lys His Phe Ser Val Ala Gly Val Thr Leu Ala Ile Thr Ile Ile
165 170 175
Cys Ala Ile Phe Leu Arg Gly Phe Leu Ser Leu Ile Pro Val Leu Ile
180 185 190
Gly Ile Ile Gly Gly Tyr Leu Phe Ala Leu Thr Gln Gly Ile Val Asn
195 200 205
Phe Gln Pro Val Leu Asp Ala Lys Trp Phe Ala Val Pro Glu Phe Ile
210 215 220
Ile Pro Phe Lys Asp Tyr Ser Pro Ser Val Thr Leu Gly Ile Ala Ala
225 230 235 240
Ala Met Val Pro Val Ala Phe Val Thr Met Ser Glu His Ile Gly His
245 250 255
Gln Met Val Leu Ser Lys Val Val Gly Gln Asp Phe Ile Lys Lys Pro
260 265 270
Gly Leu His Arg Ser Ile Met Gly Asp Ser Ala Ala Thr Ile Leu Ala
275 280 285
Ser Leu Ile Gly Gly Pro Pro Thr Thr Thr Tyr Gly Glu Asn Ile Gly
290 295 300
Val Leu Ala Ile Thr Arg Val Phe Ser Val Phe Val Ile Gly Gly Ala
305 310 315 320
Ala Val Ile Ala Leu Cys Phe Gly Phe Ile Gly Lys Ile Ser Ala Leu
325 330 335
Ile Ser Ser Val Pro Ser Ala Val Met Gly Gly Val Ser Phe Leu Leu
340 345 350
Phe Gly Ile Ile Ala Ser Ser Gly Leu Arg Met Leu Ile Asp Asn Lys
355 360 365
Ile Asp Tyr Glu Asn Asn Arg Asn Leu Ile Ile Thr Ser Val Ile Leu
370 375 380
Val Ile Gly Val Gly Gly Ala Phe Ile Gln Val Ser Gln Gly Gly Phe
385 390 395 400
Gln Val Ser Gly Met Ala Leu Ala Ala Ile Val Gly Val Ile Leu Asn
405 410 415
Leu Ile Leu Pro Gln Ala Lys Glu Glu Gln Ala Asp Thr Ser Glu Gln
420 425 430
His His Ile
435
<210> 11
<211> 1308
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
atgagtaaga aaaaagtaaa tttaggggtc agggatgtcc cgacaccttt ctcttgggtt 60
tcattcagcc ttcagcattt gtttgccatg tttggctcaa ccattttggt tccgaagctc 120
gtcggaatga gtcctgctgt ggcgttggtg acaagcggca tcggaacact ggcgtacctt 180
cttattacca aaggacaaat tccggcgtat ctcggttcat ccttcgcctt tatttctccg 240
atcattctgg taaaagcgac cggcgggccg ggagcggcaa tggttggagc gtttcttgca 300
gggctggtgt acgggctgat tgccttattg attaggcagc ttggaacagg atggctgatg 360
aagattctcc cgcctgtagt cgtagggcct gttattatcg tcatcgggct gggactggca 420
agcactgcag taaacatggc gatgtatgct gatccgaacg cgagtgagtt ggtctacagc 480
ttaaagcact ttagtgtcgc aggagttacg ctggcaatta cgattatttg tgcgattttc 540
ttacgagggt ttttaagcct gattccggtt ctgatcggaa tcatcggcgg atacctgttt 600
gcccttactc aagggattgt caacttccag ccggtgcttg acgcgaaatg gtttgcagtg 660
cctgaattta tcattccgtt caaagattat tcaccgtcag ttacgctcgg catcgcagcc 720
gcaatggttc ctgtcgcatt tgtcacaatg tcagagcata tcggccacca aatggtgctg 780
agcaaggttg tcggacaaga cttcattaaa aagccaggtc ttcatcgctc tattatgggt 840
gacagtgtgg cgacaatcct cgcttccctg atcggcggcc ctccgacaac gacttacgga 900
gaaaacattg gcgtgctggc catcacaaga gtattcagcg tctttgtcat cgggggcgcg 960
gcagtgattg ccctttgctt cggctttatc ggcaaaattt cagcgctgat cagttcagtg 1020
ccgtcagcgg tcatgggagg cgtctccttc ctgctgttcg gaatcattgc ttcaagcggc 1080
ctgagaatgc tgattgacaa caaaattgat tatgaaaaca acagaaacct cattattaca 1140
tcagttatcc ttgtcatcgg tgtaggaggc gcttttatcc aagtgtctca gggcggattc 1200
caagtgtcag gaatggcgct tgccgcaatt gtcggtgtca tcttaaacct gattcttccg 1260
caggcgaagg aagagcaggc agacacatct gaacaacatc atatttaa 1308
<210> 12
<211> 435
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 12
Met Ser Lys Lys Lys Val Asn Leu Gly Val Arg Asp Val Pro Thr Pro
1 5 10 15
Phe Ser Trp Val Ser Phe Ser Leu Gln His Leu Phe Ala Met Phe Gly
20 25 30
Ser Thr Ile Leu Val Pro Lys Leu Val Gly Met Ser Pro Ala Val Ala
35 40 45
Leu Val Thr Ser Gly Ile Gly Thr Leu Ala Tyr Leu Leu Ile Thr Lys
50 55 60
Gly Gln Ile Pro Ala Tyr Leu Gly Ser Ser Phe Ala Phe Ile Ser Pro
65 70 75 80
Ile Ile Leu Val Lys Ala Thr Gly Gly Pro Gly Ala Ala Met Val Gly
85 90 95
Ala Phe Leu Ala Gly Leu Val Tyr Gly Leu Ile Ala Leu Leu Ile Arg
100 105 110
Gln Leu Gly Thr Gly Trp Leu Met Lys Ile Leu Pro Pro Val Val Val
115 120 125
Gly Pro Val Ile Ile Val Ile Gly Leu Gly Leu Ala Ser Thr Ala Val
130 135 140
Asn Met Ala Met Tyr Ala Asp Pro Asn Ala Ser Glu Leu Val Tyr Ser
145 150 155 160
Leu Lys His Phe Ser Val Ala Gly Val Thr Leu Ala Ile Thr Ile Ile
165 170 175
Cys Ala Ile Phe Leu Arg Gly Phe Leu Ser Leu Ile Pro Val Leu Ile
180 185 190
Gly Ile Ile Gly Gly Tyr Leu Phe Ala Leu Thr Gln Gly Ile Val Asn
195 200 205
Phe Gln Pro Val Leu Asp Ala Lys Trp Phe Ala Val Pro Glu Phe Ile
210 215 220
Ile Pro Phe Lys Asp Tyr Ser Pro Ser Val Thr Leu Gly Ile Ala Ala
225 230 235 240
Ala Met Val Pro Val Ala Phe Val Thr Met Ser Glu His Ile Gly His
245 250 255
Gln Met Val Leu Ser Lys Val Val Gly Gln Asp Phe Ile Lys Lys Pro
260 265 270
Gly Leu His Arg Ser Ile Met Gly Asp Ser Leu Ala Thr Ile Leu Ala
275 280 285
Ser Leu Ile Gly Gly Pro Pro Thr Thr Thr Tyr Gly Glu Asn Ile Gly
290 295 300
Val Leu Ala Ile Thr Arg Val Phe Ser Val Phe Val Ile Gly Gly Ala
305 310 315 320
Ala Val Ile Ala Leu Cys Phe Gly Phe Ile Gly Lys Ile Ser Ala Leu
325 330 335
Ile Ser Ser Val Pro Ser Ala Val Met Gly Gly Val Ser Phe Leu Leu
340 345 350
Phe Gly Ile Ile Ala Ser Ser Gly Leu Arg Met Leu Ile Asp Asn Lys
355 360 365
Ile Asp Tyr Glu Asn Asn Arg Asn Leu Ile Ile Thr Ser Val Ile Leu
370 375 380
Val Ile Gly Val Gly Gly Ala Phe Ile Gln Val Ser Gln Gly Gly Phe
385 390 395 400
Gln Val Ser Gly Met Ala Leu Ala Ala Ile Val Gly Val Ile Leu Asn
405 410 415
Leu Ile Leu Pro Gln Ala Lys Glu Glu Gln Ala Asp Thr Ser Glu Gln
420 425 430
His His Ile
435

Claims (10)

  1. An L-threonine 3-dehydrogenase mutant, characterized in that the mutant comprises a mutation of amino acid 282 of the L-threonine 3-dehydrogenase from V to an amino acid other than V, preferably from V to E, A or G;
    wherein the reference sequence number of the L-threonine 3-dehydrogenase on NCBI is WP_003244880.1.
  2. 2. Uracil-permease mutant, characterized in that the mutant comprises a mutation of amino acid 283 of uracil-permease from V to other amino acids than V, preferably from V to M, A or L;
    wherein the uracil-through enzyme has a reference sequence number WP_003221479.1 on NCBI.
  3. 3. Nucleic acid molecules encoding the L-threonine 3-dehydrogenase mutants of claim 1 and/or the uracil-permease mutants of claim 2.
  4. 4. A biological material comprising the nucleic acid molecule of claim 3, which is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineering bacterium.
  5. 5. Use of the nucleic acid molecule of claim 3 or any of the following biological materials of claim 4:
    (1) The method is used for fermentation production of nucleoside and nucleoside derivatives;
    (2) The method is used for constructing genetically engineered bacteria for producing nucleosides and nucleoside derivatives;
    preferably, the nucleoside is adenosine or inosine.
  6. 6. The construction method of the genetically engineered bacteria producing nucleosides and nucleoside derivatives is characterized in that the method is selected from any one of (1) to (3):
    (1) introducing mutation into a bacterial genome having nucleoside-producing ability by genetic engineering means so that the encoded L-threonine 3-dehydrogenase comprises a V282E, V282A or V282G mutation site; wherein the reference sequence number of the L-threonine 3-dehydrogenase on NCBI is WP_003244880.1;
    (2) introducing mutation into a bacterial genome with nucleoside producing ability by using genetic engineering means, so that uracil-permease encoded by the mutant comprises a V283M, V A or V283L mutation site; wherein the uracil-through enzyme has a reference sequence number wp_003221479.1 on NCBI;
    (3) by genetic engineering means, mutation is introduced into the genome of a bacterium having nucleoside-producing ability so that the encoded L-threonine 3-dehydrogenase contains the V282E, V A or V282G mutation site, and the encoded uracil-permease contains the V283M, V A or V283L mutation site.
  7. 7. The method of claim 6, wherein the bacteria is Bacillus subtilis (Bacillus subtilis), bacillus amyloliquefaciens (Bacillus amyloliquefaciens) or Bacillus pumilus (Bacillus pumilus).
  8. 8. The method of claim 7, wherein the bacterium is bacillus subtilis A1.
  9. 9. The genetically engineered bacterium constructed by the method according to any one of claims 6 to 8.
  10. 10. The genetically engineered bacterium of claim 9, wherein the genetically engineered bacterium is any one of the following:
    1) The method is used for fermentation production of nucleoside and nucleoside derivatives;
    2) For improving the fermentation yield of nucleosides and nucleoside derivatives;
    preferably, the nucleoside is adenosine or inosine.
CN202111532134.4A 2021-12-14 2021-12-14 L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof Pending CN116262913A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111532134.4A CN116262913A (en) 2021-12-14 2021-12-14 L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111532134.4A CN116262913A (en) 2021-12-14 2021-12-14 L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof

Publications (1)

Publication Number Publication Date
CN116262913A true CN116262913A (en) 2023-06-16

Family

ID=86722471

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111532134.4A Pending CN116262913A (en) 2021-12-14 2021-12-14 L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof

Country Status (1)

Country Link
CN (1) CN116262913A (en)

Similar Documents

Publication Publication Date Title
TWI764088B (en) Novel promoter and method for producing purine nucleotide using the same
CN106754602A (en) A kind of method of the recombinant microorganism for producing cytidine and production cytidine
CN112143751B (en) Bacillus subtilis engineering bacterium for high nucleoside yield, and construction method and application thereof
CN112574934B (en) Engineering bacterium for high yield of guanosine as well as construction method and application thereof
JPS63233798A (en) Production of 5&#39;-guanylic acid
CN110257315B (en) Bacillus subtilis and construction method and application thereof
JPH11346778A (en) Production of &#39;nucleic acid&#39;-based substance
KR100882418B1 (en) Inosine producing microorganism and a method of producing inosine using the same
CN112126666B (en) Nucleoside high-yield bacterium and construction method and application thereof
CN116463273A (en) Method for enhancing accumulation of 5&#39; -cytidine acid and application thereof
CN116478878A (en) Bacillus subtilis for high-yield riboflavin and application thereof
CN115948307A (en) Plasmid-free genetically engineered bacterium for de novo efficient synthesis of cytidine by taking cheap carbon sources such as glucose and the like as substrates, method and application
KR101669474B1 (en) Method for producing 5&#39;-guanylic acid
CN117511889B (en) Enzyme and application thereof in preparation of unnatural amino acid dipeptide
CN106834176B (en) Nucleoside phosphorylase, coding gene, high-yield strain thereof and application
CN113278596B (en) Mutant capable of improving bacillus nucleoside yield and application thereof
CN116262913A (en) L-threonine 3-dehydrogenase and uracil-permease mutant and application thereof
JP3369236B2 (en) Method for producing choline cytidine diphosphate
CN116790546A (en) Pyruvic acid kinase mutant and application thereof
CN116948994A (en) Glyceraldehyde-3-phosphate dehydrogenase mutant and application thereof
CN116790522A (en) Pyruvate carboxylase mutant and application thereof
CN116949007A (en) Fructose 1, 6-bisphosphatase II mutant and application thereof
CN116790568A (en) Phosphoenolpyruvate carboxykinase mutant and application thereof
CN117305285A (en) Phosphoenolpyruvate carboxykinase mutant and application thereof
CN115678864A (en) Gene engineering bacterium for producing nucleoside and construction method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination