CN116898975A

CN116898975A - Application of YTHDC1 inhibitor in preparation of medicines for preventing and treating premature labor

Info

Publication number: CN116898975A
Application number: CN202311054106.5A
Authority: CN
Inventors: 刘志伟; 李伟; 赵九如; 张茜茜; 黄小艺; 唐征; 陈泽; 李百合
Original assignee: International Peace Maternity & Child Health Hospital Of China Welfare Institute
Current assignee: International Peace Maternity & Child Health Hospital Of China Welfare Institute
Priority date: 2023-08-21
Filing date: 2023-08-21
Publication date: 2023-10-20

Abstract

The invention provides an application of YTDDC 1 inhibitor in preparing a medicine for preventing and treating premature delivery, wherein the medicine takes YTDDC 1 gene as an action target point aiming at placenta trophoblast. The invention is based on that the expression level of human YTHDC1 gene in premature placenta tissue is obviously higher than that of full term placenta, constructs an over-expression stable transgenic cell strain aiming at the human YTHDC1 gene, designs specific siRNA, specifically increases or reduces YTHDC1 expression in human placenta trophoblast, can correspondingly promote or inhibit proliferation, apoptosis, migration and invasion capacity of cells, and simultaneously can reduce YTHDC1 expression at placenta part, prolong delivery time and further achieve the aim of delaying premature birth by injecting an in-vivo biological agent which interferes with YTHDC1 gene expression in an animal model. The invention provides possibility for developing clinical premature delivery therapeutic drugs based on YTHDC1 gene, and has great application value and prospect.

Description

Application of YTHDC1 inhibitor in preparation of medicines for preventing and treating premature labor

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of a YTHDC1 inhibitor in preparation of a medicine for preventing and treating premature labor.

Background

Premature birth refers to delivery of 28 weeks gestation and less than 37 weeks gestation, and is the leading cause of death of newborns, accounting for about 35% of the death causes of newborns worldwide, and seriously threatening the health of children. Premature birth can cause various complications in newborns, including: suffocation, respiratory distress syndrome, brain injury, bronchopulmonary dysplasia, retinopathy, feeding intolerance, etc. In addition, premature birth also causes bad ending of offspring in long term, such as increasing the risks of cognitive, social emotion, learning disorder and the like after adulthood, and the lower the gestational age, the higher the risks of development disorder such as development defect, movement, cognition, social emotion and the like. At present, the prevention and treatment method of premature delivery mainly comprises progestogen treatment, cervical cerclage, cervical support and the like, but still lacks effective specific intervention means. Therefore, finding a specific and effective treatment method for premature delivery is of great clinical significance.

RNAm ⁶ The A modification is to insert a methyl group at the 6 th N atom of adenine, and is the most abundant RNA modification in eukaryotes. m is m ⁶ The A modification is mediated primarily by methyltransferases, demethylases and reading proteins. YTDDC 1 is m ⁶ An important class of A reading proteins belongs to YTH domain families, mainly consisting of m ⁶ A-dependent means to regulate RNA splicing, selective polyadenylation, nuclear export, and degradation of chromatin-associated regulatory RNAs, etc. A large number of researches prove that YTDDC 1 plays a key role in a plurality of biological processes and disease progression and is involved in the occurrence of various diseases such as leukemia, inflammatory bowel disease, lung cancer, liver cancer, bladder cancer, breast cancer and the like. YTHDC1 also participates in Male MingMurine spermatogonial development and female mouse oocyte maturation processes. However, research reports about the participation of YTHDC1 in the premature birth generation and development process are not yet seen. Earlier studies by the inventors found that the expression levels of YTHDC1 in the premature placenta samples were significantly increased compared to term placenta, and that YTHDC1 was localized in placental trophoblasts. Abnormal trophoblast function is closely related to the occurrence of premature birth, and it is therefore presumed that YTHDC1 plays an important role in the occurrence and development of premature birth.

RNA interference (RNAi) refers to a manner of post-transcriptional gene silencing using double-stranded RNA whose nucleotide composition is short. It can block the expression of target gene in body effectively and specifically, and is one common technological means of researching gene function and finding out disease treating method. The siRNA for animals adopts a special chemical modification mode, so that the serum stability of the siRNA is greatly improved, the high-efficiency activity of the siRNA is maintained, and the siRNA has the characteristics of good safety, high economy and more clinical approach. Because siRNA directly acts on specific RNA targets, the siRNA has high disease targeting, and can be widely applied to diseases such as breast cancer, lung cancer, liver cancer, colorectal cancer and the like. However, no application report of siRNA in premature delivery treatment is yet seen.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention provides application of a YTDDC 1 inhibitor in preparing medicines for preventing and treating premature delivery, and the medicines take YTDDC 1 genes as action targets aiming at placenta trophoblasts.

In order to achieve the above purpose, the invention adopts the following technical scheme:

the first aspect of the invention is to provide the use of an inhibitor of YTDDC 1 in the manufacture of a medicament for the prevention and treatment of premature labor.

Further, the above mentioned YTHDC1 inhibitors are selected from one or more of the following:

a small molecule compound that specifically inhibits YTHDC 1;

an interfering molecule that specifically interferes with expression of the YTDDC 1 gene;

a gene editing reagent for specifically knocking out the YTDDC 1 gene;

an antibody or ligand that specifically binds to a protein encoded by the YTDDC 1 gene.

Further, the YTDDC 1 inhibitor is siRNA.

Further, the target gene sequence of the siRNA is SEQ ID No. 3-SEQ ID No.5, preferably SEQ ID No.3 or SEQ ID No.5.

In a second aspect the invention provides a medicament for the prevention and treatment of premature labor comprising an inhibitor of YTDDC 1.

a small molecule compound that specifically inhibits YTHDC 1;

a gene editing reagent for specifically knocking out the YTDDC 1 gene;

Further, the YTDDC 1 inhibitor is siRNA, and the target gene sequence is preferably SEQ ID No. 3-SEQ ID No.5, more preferably SEQ ID No.3 or SEQ ID No.5.

In a third aspect, the invention provides an application of an YTDDC 1 inhibitor in preparing medicines for inhibiting proliferation, migration and invasion of placenta trophoblasts and promoting apoptosis of the placenta trophoblasts.

a small molecule compound that specifically inhibits YTHDC 1;

a gene editing reagent for specifically knocking out the YTDDC 1 gene;

Compared with the prior art, the invention has the following technical effects:

the invention is based on that the expression level of human YTHDC1 gene in premature placenta tissue is obviously higher than that of full term placenta, constructs an over-expression stable transgenic cell strain aiming at the human YTHDC1 gene, designs specific siRNA, specifically increases or reduces YTHDC1 expression in human placenta trophoblast, can correspondingly promote or inhibit proliferation, apoptosis, migration and invasion capacity of cells, and simultaneously can reduce YTHDC1 expression at placenta part, prolong delivery time and further achieve the aim of delaying premature birth by injecting an in-vivo biological agent which interferes with YTHDC1 gene expression in an animal model. The invention provides possibility for developing clinical premature delivery therapeutic drugs based on YTHDC1 gene, and has great application value and prospect.

Drawings

FIG. 1 shows the results of verifying the interference and overexpression efficiency of YTHDC1 in trophoblasts; wherein, figure A, B shows the mRNA expression levels of YTHDC1 in HTR8/Svneo cells and JAR cells, respectively, of different treatment groups; FIG. D, E shows the protein expression levels of YTHDC1 in HTR8/Svneo cells and JAR cells, respectively, of different treatment groups; FIG. C, F shows the mRNA expression level and protein level of YTIDC 1 in control and overexpressed JAR cells, respectively;

FIG. 2 shows the results of cell growth curves after knockdown (panel A, B) or overexpression (panel C) of the YTIDC 1 gene;

FIG. 3 shows the results of cell proliferation experiments following knockdown of YTHDC1 expression; wherein, graph A shows that after YTHDC1 knockdown in HTR-8/SVneo cells, DNA synthesis is significantly reduced compared to control; panel B shows that DNA synthesis is significantly reduced after YTDDC 1 knockdown in JAR cells compared to the control group; panel C shows HTR-8/SVneo and JAR cell quantification results;

FIG. 4 shows the results of flow cytometry detection of apoptosis after knockdown YTIDC 1 expression (panel A) and corresponding statistical plots (panel B);

FIG. 5 shows the results of cell migration (panel A) and invasion (panel B) experiments after knock-down of YTIDC 1;

FIG. 6 shows the results of cell migration and invasion experiments (Panel A) and corresponding statistical graphs (Panels B and C) after overexpression of YTIDC 1;

FIG. 7 is experimental results of the effect of knock down YTHDC1 on onset time of delivery in a model of premature animals; figure A is a schematic diagram of an animal in vivo intervention experiment; panel B shows the protein expression levels of the mouse placental site YTHDC 1; panel C shows the average delivery time of pregnant mice.

Detailed Description

The inventor discovers that the expression level of YTHDC1 genes in premature placenta tissues is obviously higher than that of full term placenta based on early research, and the proliferation, apoptosis, migration and invasion capacity of placenta trophoblasts can be influenced after the expression of human YTHDC1 genes is up-regulated or down-regulated by adopting an over-expression or RNAi method; the inventor further synthesizes an siRNA biological agent which is applied in vivo and specifically reduces YTHDC1 expression through a phosphoramidite solid phase synthesis method, and confirms that the siRNA biological agent can reduce placenta YTHDC1 expression and delay premature birth in an animal model, thereby completing the invention. The research result shows that the YTDDC 1 gene can be used as a therapeutic target of premature delivery.

The present invention will be described in detail and specifically by way of the following specific examples and drawings to provide a better understanding of the present invention, but the following examples do not limit the scope of the present invention.

The methods described in the examples are carried out using conventional methods, if not specified, and the reagents used are, if not specified, conventional commercially available reagents or reagents formulated by conventional methods.

Example 1 establishment of YTDDC 1 overexpressing stably transfected cell lines

1. Firstly, designing a primer according to CDS sequence of YTDDC 1 gene, which is used for amplifying target gene by PCR, wherein the specific sequence is as follows:

forward primer YTDDC 1-OE-F:

AGAAGATTCTAGAGCTAGCGATGGCGGCTGACAGTCGG(SEQ ID No.1)；

reverse primer YTDDC 1-OE-R:

GCAGATCCTTCGCGGCCGCGTTATCTTCTATATCGACCTCTCT(SEQ ID No.2)。

2. acquisition of the Gene fragment of interest

JAR cell total RNA was extracted using TRIzol reagent (Invitrogen) according to the instructions, and 500ng RNA was reverse transcribed into complementary DNA (cDNA) according to the reverse transcription system shown in Table 1 below, wherein the reverse transcription procedure was: 37 ℃, 20min,85 ℃, 30s,4 ℃ and infinity.

TABLE 1 reverse transcription reaction system

System of	Volume (mu L)
		RNA	5
Reverse transcriptase (5 XEvo M-MLV)	2
		ddH ₂ O	3
Total volume of	10

Primers synthesized by biological engineering (Shanghai) Limited were subjected to ddH ₂ O was dissolved to prepare a solution having a concentration of 10. Mu.M, and a 50. Mu.L PCR reaction system was as shown in Table 2 below to obtain PCR amplification products, wherein the PCR reaction conditions were set as follows: 98 ℃ for 5min; cycling at 98deg.C, 10s,60 deg.C, 10s,72 deg.C, 2min and 30s for 30 times; 72 ℃ for 8min;4 ℃ for 10min.

TABLE 2 PCR reaction System

Preparing 1% agarose gel, electrophoretically observing the size (2184 bp) of a target fragment, and cutting the target fragment under an ultraviolet lamp; the fragment of interest was ligated to the pCDH-CMV-MCS-EF1-Puro vector (EcoR I and BamH I cut) using homologous recombinase from Nanjinouzan Biotechnology Co., ltd; transferring the connection product into DH5 alpha competent cells of escherichia coli by heat shock, coating the competent cells on an LB culture medium plate containing ampicillin, and culturing the competent cells in an inverted manner at 37 ℃ for overnight; picking a monoclonal in an ampicillin-containing liquid LB culture medium, carrying out shaking culture at 37 ℃ for 18 hours, extracting plasmids for double enzyme digestion identification (EcoRI and BamHI), and carrying out sequencing verification on positive clones; e.coli amplification positive target plasmid.

The liposome method is utilized to transfect 293T cells with the target plasmid for slow virus preparation, liquid exchange is carried out 8 hours after transfection, slow viruses are harvested 48 hours later, fresh virus liquid is used for infecting JAR trophoblast cell lines, and 4 mug/mL of polybrene is added half an hour in advance to improve the infection efficiency; after 72h of infection, positive cells were screened with puromycin until the cells no longer died.

Example 2 verification of YTHDC1 interference and overexpression efficiency in HTR-8/SVneo and JAR trophoblast lines

1. Cell transfection

The day before transfection 6 well plates were plated and the next day when cells confluent 60% -80% were transfected. The serum-free medium was divided into two parts, 150. Mu.L each, one part was added with 5. Mu.L siRNA (siNC or siRNA, specific target gene sequences of which are shown in Table 3 below) and one part was added with 5. Mu.L transfection reagent Lipofectamine RNA iMAX (Thermo Fisher), and after mixing and incubation for 5min, the two were mixed; after standing for 20min, the old culture medium is discarded, and the mixture is added into cells; RNA was extracted 24h after incubation, protein was extracted 48h after incubation, and RT-qPCR and Western Blot detection were performed to verify transfection efficiency.

TABLE 3 siRNA target gene sequences

Name of the name	Target gene	Gene ID	Target sequence
				siRNA1	YTHDC1	NM_001031732.4	CAAGGAGTGTTATCTTAAT(SEQ ID No.3)
siRNA2	YTHDC1	NM_001031732.4	GGGAAATGATTATGACACT(SEQ ID No.4)
				siRNA3	YTHDC1	NM_001031732.4	GTATCAGGTCATTCATAAA(SEQ ID No.5)

2. Identification of YTHDC1 RNA expression level by RT-qPCR

Total RNA from cells after 24h of transfection was extracted, and 500ng RNA was reverse transcribed into complementary DNA (cDNA) according to the reverse transcription system of Table 1.

Table 4 RT-qPCR reaction system was as follows:

system of	Volume (mu L)
		cDNA	1
SYBR (2X ROX)	10
		Upstream primer	0.5
Downstream primer	0.5
		ddH ₂ O	8
Total volume of	20

Then mixing the components of the reaction system in the table 4 uniformly, and adding the mixture into a 384-well plate; the PCR reaction was performed according to the following conditions, and the thermal cycle parameters were as follows: 50 ℃ for 2min;95 ℃ for 2min;95 ℃ for 10min;95 ℃, 15s,60 ℃ for 1min; for a total of 40 cycles. And simultaneously reading the light absorption value to manufacture a melting curve. By 2- ^ΔΔCt The expression level of YTIDC 1 mRNA was calculated by analytical method.

The RT-qPCR detection shows that the mRNA expression level of the siRNA1 and the siRNA3 transfection group YTHDC1 is obviously reduced compared with that of a control group, the interference efficiency is more than 70%, the successful knocking down of YTHDC1 mRNA in cells is proved (see figures 1A and 1B), the siRNA1 is named as siYTHDC1-1 in the following experiments, and the siRNA3 is named as siYTHDC1-2.

3. Western Blot identification of YTHDC1 protein expression level

Cells transfected for 48h were lysed using RIPA lysate, protein samples were transferred to PVDF membranes after SDS-PAGE separation, PVDF membranes were blocked with TBS containing 5% nonfat milk powder for 1h at room temperature and then incubated overnight with the corresponding primary antibody at 4 ℃. The next day, the membranes were washed with TBST for 30min and then incubated with the corresponding horseradish peroxidase-labeled secondary antibodies for 1h at 37 ℃. TBST was washed for 30min, immunoreactive bands were detected with enhanced chemiluminescent substrate, and the intensity of the bands was quantified using Image-Pro Plus software.

By Western Blot analysis, we found that the grey value of the YTHDC1 protein was significantly reduced in the siRNA transfected group compared to the control group, confirming that the YTHDC1 protein was successfully knocked down (see fig. 1D, 1E).

4. The over-expression effect of YTHDC1 gene in JAR cells infected by the lentivirus is evaluated, and the result of RT-qPCR and Western Blot detection on the expression level of YTHDC1 in JAR cells shows that the mRNA and protein levels of the infected group are obviously increased compared with those of YTHDC1 in a control group, so that the successful construction of the YTHDC1 over-expression stable transgenic cell line is confirmed (see figures 1C and 1F).

Example 3 cell proliferation assay

1. CCK-8 experiment:

the principle of the method for measuring the cell proliferation capacity is that WST-8[ chemical name: 2- (2-methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2, 4-disulfophenyl) -2H-tetrazolium monosodium salt) can be reduced by dehydrogenase in mitochondria to generate a highly water-soluble orange yellow formazan product, the color of the formazan product is in direct proportion to the proliferation of cells, and the number of living cells can be indirectly reflected.

The steps are as follows: taking HTR-8/SVneo and JAR cells grown in corresponding logarithmic phase, preparing single cell suspension from corresponding complete medium containing 10% serum after 0.25% pancreatin digestion, and obtaining the required cell number (HTR-8/SVneo: DMEM/F12 medium, 2×10) ³ Holes; JAR: DMEM medium, 1.5X10 ³ Well) was plated in 96-well plates (100. Mu.L/well), 37℃and 5% CO ₂ Culturing for 5 days. Detection was performed on days 1, 3, 5, respectively: the supernatant was discarded, a 10% CCK-8 solution was prepared in the corresponding complete medium, incubated at 37℃for 2 hours, and the absorbance OD was measured ₄₅₀ And drawing a growth curve.

From the results, it was found that YTHDC1 knockdown inhibited proliferation of trophoblasts (see fig. 2A, 2B), while overexpression promoted proliferation of trophoblasts (see fig. 2C).

2. EdU (5-ethynyl-2' deoxyuridine) incorporation experiment:

EdU is a thymidine analog which can be substituted for thymidine to be incorporated into replicating DNA molecules during cell proliferation, and the ability of cells to proliferate can be reflected by detecting the replication activity of cellular DNA based on the conjugation reaction of EdU with dye.

The steps are as follows: 48h,0.25% pancreatin digestion after transfection of siRNA into HTR-8/SVneo and JAR cells, 1X 10 ⁴ Cells were plated in 12-well plates (500. Mu.L/well), and placed in 5% CO at 37℃respectively ₂ The carbon dioxide incubator was left overnight. After 24h, edU solution (final concentration 50. Mu.M) was added and incubated at 37℃for 2h, the medium was discarded, and PBS was used for 2 washes of 5min each. Adding 300 mu L/hole 4% paraformaldehyde, fixing at room temperature for 30min, discarding the fixing solution, adding 300 mu L/hole 2mg/mL glycine, incubating for 5min in a shaking table, discarding glycine solution, adding PBS for washing 1 time for 5min, adding 300 mu L of 0.5% trionX-100 permeabilizer, incubating for 10min at room temperature, discarding permeabilizer, adding PBS for washing 1 time for 5min. Add 300 μl/wellAfter the dyeing reaction liquid is incubated for 30min at room temperature in a dark place and a shaking table, the dyeing reaction liquid is discarded, 300 mu L/hole penetrating agent is added, the dyeing reaction liquid is washed for 2 times in a dark place and 5min each time in a shaking table, the penetrating agent is discarded, PBS is added, and the washing is carried out for 1 time and 5min each time. Adding 300 μl/well 1×hoechst33342 staining solution, incubating at room temperature for 30min in dark place, discarding the staining solution, adding PBS, washing 3 times in dark place, each time for 5min, preserving at 4deg.C, taking pictures by fluorescence microscope, and counting.

From the results, the incorporation of EdU in YTHDC1 knockdown cells was significantly reduced compared to the control (see fig. 3A, 3B, 3C).

Example 4 apoptosis experiments

After 48h of siRNA transfection of HTR-8/SVneo and JAR cells, the culture medium supernatant was collected, and the cultured cells were washed once with precooled PBS, and 0.25% pancreatin was digested to prepare a single cell suspension. Cells were collected in a centrifuge tube and added to the culture supernatant collected in advance, and centrifuged at 1000g for 3min. Discarding the supernatant, adding 5mL of precooled PBS, washing once, centrifuging for 5min at 1000g, and repeating once; then, 100. Mu.L of 1 Xbinding buffer was added to resuspend the cells, 5. Mu.L of Annexin V-FITC and 10. Mu.L of PI staining solution were added to the sample tube and gently mixed. Control tubes (negative control, FITC single-stain control and PI single-stain control) were simultaneously set up, and the control tube sample treatments were: no dye, only 5 μl FITC and only 10 μl PI were added. All samples were incubated at 37℃for 30min in the dark, 400. Mu.L of 1 Xbinding buffer was added, mixed well and placed on ice, and the apoptosis level was detected by flow cytometry within 1h, and the apoptosis profile and statistical plot were drawn.

From the results, apoptosis in YTHDC1 knockdown cells was significantly elevated compared to control (see fig. 4A, 4B).

Example 5 cell migration and invasion experiments

1. Cell migration experiments:

600. Mu.L of complete medium containing 10% serum was added to the 24-well plate, and a Transwell chamber (filter pore size 8.0 μm) was placed in the well. The desired cells (HTR-8/SVneo: 8X 10) ⁴ Holes; JAR 5X 10 ⁴ Per well) was resuspended in the corresponding serum-free medium and plated in a Transwell chamber. After 24 hours, the Transwell chamber was removed, and the non-migrated cells on the inside of the chamber were wiped off with a cotton swab moistened with PBS, and then placed in a well in which 600. Mu.L of 4% formaldehyde fixative solution was previously added, and fixed for 20 minutes. After the fixation, the Transwell chamber is placed in ethanol solution with 600 mu L of 1% crystal violet added in advance, incubated for 20min at room temperature, taken out and ddH is carried out ₂ O is cleaned for 3 times and naturally dried; according to the directions of upper left, lower left, upper right, lower right and middle, 5 visual field microscopes are randomly taken for photographing and counting, and an average value of 5 visual fields is taken for statistical analysis.

The migration experiment result shows that: compared to the control group, YTHDC1 knockdown significantly inhibited trophoblast migration (see fig. 5A), whereas overexpression promoted trophoblast migration (see fig. 6A, 6B).

2. Cell invasion assay:

the Transwell chamber was placed in a 24-well plate, and Matrigel gel was added at 1:4 dilution to the Transwell chamber, and incubated at 37℃for 2 hours at 60. Mu.L per well. The subsequent procedure was the same as the cell migration experiment described above.

The results of the invasion experiments show that: compared to the control group, YTHDC1 knockdown significantly inhibited trophoblast invasion (see fig. 5B), whereas overexpression promoted trophoblast invasion (see fig. 6A, 6C).

Example 6 animal intervention experiments

1. Preparing experimental animals:

SPF-class 6-8 week old C57BL/6J mice were purchased from Shanghai Ling Biotechnology Co., ltd and kept in SPF-class animal houses. The food is ingested and drunk freely, the constant temperature of the environment is 22-26 ℃, and the constant humidity is 55-65%.

2. Establishment of a premature labor model:

c57BL/6J mice weighing about 20g were selected after 2 weeks of adaptive feeding, and the mice were maleed: female = 1: 2-fold cage, see pessary for day marked as pregnant 0.5 days (E0.5 days). At day E15.5, both groups of pregnant mice were subcutaneously injected with mifepristone RU486 (Sigma, M8046) at a dose of 10 mg/kg/mouse.

3. In vivo intervention experiments:

according to fig. 7A, two groups of pregnant mice were randomly divided into an experimental group and a control group, and the experimental group and the control group were respectively given 10nmol of siYTDDC1 (target gene sequence AGCAGAAAGAAACCAAGGA, SEQ ID No. 6) or siNC (both dissolved in 200 μl of physiological saline) by tail vein injection on day E13.5 (1 st time), and 10nmol of siYTDDC1 or siNC was again given to the tail vein after RU486 injection on day E15.5 (2 nd time, 1h post injection), and the time of delivery of the mice after RU486 treatment was recorded. The gestation time was defined as the time taken for RU486 injection to first fetal mouse, the gestation mice were sacrificed and placenta harvested, histoproteins were extracted and YTHDC1 protein expression levels were detected using Western Blot.

Fig. 7B shows that the expression level of YTHDC1 in the placenta region of mice in the experimental group (siYTHDC 1) is significantly reduced compared with that in the control group (siNC), confirming that the in vivo interference is effective; fig. 7C shows that the average delivery time of control pregnant mice is 15.86±1.75 hours, the experimental group is 19.67±4.80 hours, and p=0.024, indicating that the delivery time of the experimental group is significantly prolonged compared to the control pregnant mice.

The above description of the specific embodiments of the present invention has been given by way of example only, and the present invention is not limited to the above described specific embodiments. It will be apparent to those skilled in the art that any equivalent modifications and substitutions of the present invention are intended to be within the scope of the present invention. Accordingly, equivalent changes and modifications are intended to be included within the scope of the present invention without departing from the spirit and scope thereof.

Claims

Use of an inhibitor of ythdc1 in the manufacture of a medicament for the prevention and treatment of premature labor.
The application of YTDDC1 inhibitor in preparing medicine for inhibiting proliferation, migration and invasion of placenta trophoblast and promoting apoptosis of placenta trophoblast.
3. The use according to claim 1 or 2, wherein the YTHDC1 inhibitor is selected from one or more of the following:

a small molecule compound that specifically inhibits YTHDC 1;

an interfering molecule that specifically interferes with expression of the YTDDC 1 gene;

a gene editing reagent for specifically knocking out the YTDDC 1 gene;

an antibody or ligand that specifically binds to a protein encoded by the YTDDC 1 gene.
4. The use according to claim 1 or 2, wherein the YTHDC1 inhibitor is an siRNA.
5. Use according to claim 1 or 2, characterized in that the target gene sequence of the siRNA is SEQ ID No.3 to SEQ ID No.5, preferably SEQ ID No.3 or SEQ ID No.5.
6. A medicament for preventing and treating premature labor, comprising an inhibitor of YTHDC 1.
7. The medicament of claim 6, wherein the YTHDC1 inhibitor is selected from one or more of the following:

a small molecule compound that specifically inhibits YTHDC 1;

an interfering molecule that specifically interferes with expression of the YTDDC 1 gene;

a gene editing reagent for specifically knocking out the YTDDC 1 gene;

an antibody or ligand that specifically binds to a protein encoded by the YTDDC 1 gene.
8. The medicament of claim 6, wherein the YTHDC1 inhibitor is an siRNA.
9. The drug according to claim 6, wherein the target gene sequence of the siRNA is SEQ ID No.3 to SEQ ID No.5, preferably SEQ ID No.3 or SEQ ID No.5.