CN116875718B - Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library - Google Patents

Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library Download PDF

Info

Publication number
CN116875718B
CN116875718B CN202311151810.2A CN202311151810A CN116875718B CN 116875718 B CN116875718 B CN 116875718B CN 202311151810 A CN202311151810 A CN 202311151810A CN 116875718 B CN116875718 B CN 116875718B
Authority
CN
China
Prior art keywords
primer
amplification
pcr
drug
mycobacterium tuberculosis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202311151810.2A
Other languages
Chinese (zh)
Other versions
CN116875718A (en
Inventor
易康
樊晓梅
顾立江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Nuoyin Biotechnology Co ltd
Original Assignee
Nanjing Nuoyin Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Nuoyin Biotechnology Co ltd filed Critical Nanjing Nuoyin Biotechnology Co ltd
Priority to CN202311151810.2A priority Critical patent/CN116875718B/en
Publication of CN116875718A publication Critical patent/CN116875718A/en
Application granted granted Critical
Publication of CN116875718B publication Critical patent/CN116875718B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/32—Mycobacterium
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of biological detection and analysis, and discloses a construction method and a kit of a mycobacterium tuberculosis drug-resistant mutation site sequencing library, wherein the construction method comprises the following steps: extracting DNA of a positive sample of mycobacterium tuberculosis; amplifying target fragments of drug-resistant genes rpoB, katG and inhA by using an outer primer, performing nested PCR first round amplification, and performing second round amplification by using the amplification product as a template and using an inner primer and an internal control nucleic acid fragment; and purifying the amplified product, and using the purified product as a template to construct a complete library by adding barcode through PCR amplification. According to the invention, the key mutation areas of the mycobacterium tuberculosis drug-resistant genes rpoB, katG and inhA promoter regions are specifically amplified by nested PCR, so that an NGS sequencing library is constructed, the target area is enriched, the human interference is removed, and the sequencing efficiency is improved.

Description

Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library
Technical Field
The invention relates to a construction method of an amplicon sequencing library of a core drug-resistant gene mutation site for a positive sample of mycobacterium tuberculosis and a kit, belonging to the technical field of biological detection and analysis.
Background
In the field of pathogen nucleic acid detection, mNGS (meta NGS) is widely applied, and is used for detecting all nucleic acids in a sample, and is the first detection scheme used in pathogen NGS detection and the most basic detection scheme, and the sequencing data size is often increased correspondingly in order to improve the detection rate due to the influence of host and other microbial background nucleic acids, so that the sequencing cost is increased. tNGS (targetted NGS, tNGS) was developed to reduce mNGS high human background, and the core technology of tNGS is targeted acquisition of target fragments and high throughput sequencing. there are two targeted capture technologies for tNGS, multiplex PCR and hybridization probe capture, respectively. the tNGS detection target only contains preset pathogens, specifically obtains target genes to be detected and is enriched in a large amount, so that interference of human nucleic acid and background flora can be reduced, and meanwhile, the detection sensitivity is improved.
Constructing a library in a hybridization capturing mode, namely obtaining a library containing target sequences by combining probes with the target sequences, and then enriching the target sequences and sequencing; amplicon sequencing is the construction of a sequencing library by PCR amplification and sequencing.
The second generation sequencing platform is generally 50-75 bp in sequencing read length. Pathogen detection is focused on effectiveness, and the sequencing mode generally selects a single-ended 50 bp read length. For qualitative detection, a read length of 50 bp may suffice. However, for detection of drug-resistant gene mutation, because mutation points are randomly positioned on the library, hybridization capture library construction is difficult to meet the requirements. Amplicon pooling although the mutation point could be fixed at a certain position in the library, the 50 bp read length failed to meet the requirements in the mutation hot spot region of 81bp of the rifampicin resistance gene rpoB.
Rifampicin and isonicotina are critical first-line drugs in tuberculosis treatment regimens, as well as antitubercular drugs that are most prone to developing resistance. 97% of rifampicin resistant strains are caused by the mutation of mycobacterium tuberculosis rpoB genes, and the mutation is mainly concentrated in a 81bp drug resistant core region. Isonicotina fibula resistance is mainly associated with mutation of the promoter region of the katG gene, inhA gene.
The patent publication No. CN114150076A discloses the detection of multiple mutation sites of Mycobacterium tuberculosis rifampicin and isoniazid resistance genes by using thermostable DNA polymerase (which may have 5' nuclease activity) and asymmetric PCR method. The invention sets the mutation on the probe, introduces partial base mutation into the base sequence on the probe to more easily distinguish drug-resistant mutation, but the method has poor consistency of amplification efficiency, high probability of false positive occurrence and easy influence on detection accuracy.
The patent with publication number CN115948583A proposes that the resistant mutation site of isonicotina fibula is located in katG gene and inhA gene, the resistant mutation site of ethambutol is located in embB gene, the resistant mutation site of rifampicin is concentrated in rpoB gene, the resistant mutation site of fluoroquinolone is mainly located in gyrA gene, the nucleotide sequences of the above 5 resistant related genes are respectively subjected to homology analysis, and primers and probes are designed, and a detection kit containing the primers and probes and a detection method of the related resistant genes are obtained. The PCR amplified product with biotin mark modification is hybridized with microsphere coupled with oligonucleotide probe to obtain the product of combining fluorescent marked target gene and probe, but the method has poor environmental stability and high cost.
Disclosure of Invention
The invention aims to construct a second generation sequencing library of a mycobacterium tuberculosis core drug-resistant mutation site by an amplicon library building method, wherein drug-resistant genes comprise key drug-resistant mutation regions of rpoB, katG and inhA promoter regions. Particularly, aiming at the 81bp hot spot mutation region of rpoB, the invention divides the 81bp into 4 sections, and respectively constructs sequencing libraries to adapt to 50 bp sequencing read length, thereby meeting the time-efficiency requirement of pathogen detection.
In order to achieve the above object, the present invention provides a method for constructing a sequencing library of drug-resistant mutation sites of mycobacterium tuberculosis, comprising:
extracting DNA of a positive sample of the mycobacterium tuberculosis;
amplifying target fragments of drug-resistant genes rpoB, katG and inhA by using an outer primer, performing first round amplification of nested PCR, and performing second round amplification of nested PCR by using an inner primer and an inner control nucleic acid fragment by using an amplification product as a template;
and purifying a product obtained by nested PCR amplification, and constructing a complete library by taking the purified product as a template and adding barcode through PCR amplification.
Preferably, the outer primers (5 '-3') used for the first round of amplification of the nested PCR are specifically:
primer DNA sequence for amplifying target fragment of drug-resistant gene rpoB:
Frpob-out：5'-GAGGGTCAGACCACGATGA-3'，
Rrpob-out：5'-GCGTTTCGATGAACCCGA-3'；
primer DNA sequence for amplifying target fragment of drug-resistant gene KatG:
FkatG-out：5'-GCCATGAACGACGTCGAA-3'，
RkatG-out：5'-GTCAGTGGCCAGCATCGT-3'；
primer DNA sequence for amplifying target fragment of drug-resistant gene inhA:
Finha-out：5'-CACATTCGACGCCAAACA-3'，
Rinha-out：5'-GCAATTCGTAGGGCGTCA-3'。
preferably, the first round of amplification of the nested PCR reaction system is: the total volume was 25. Mu.L, wherein 2 XBuffer 12.5. Mu.L, 10U/. Mu.L Taq DNA polymerase 1. Mu.L, 10. Mu.M primer Frpob-out 0.5. Mu.L, 10. Mu.M primer Rrpob-out 0.5. Mu.L, 10. Mu.M primer FkatG-out 0.5. Mu.L, 10. Mu.M primer RkatG-out 0.5. Mu.L, 10. Mu.M primer Finha-out 0.5. Mu.L, 10. Mu.M primer Rinha-out 0.5. Mu.L, template 8.5. Mu.L.
Preferably, the first round of amplification of the nested PCR is performed by the PCR reaction procedure: 95. at the temperature of 5 min; 95. at a temperature of 30 s,70 ℃ for 1min (1 ℃ for each cycle later), 72 ℃ for 1min, 10 cycles; 95. the temperature is 30 s,60 ℃, 1min, 72 ℃, 1min, 10 cycles; 72. at the temperature of 5 min.
Preferably, the inner primers (5 '-3') used for the second round of amplification of nested PCR are specifically:
Frpob-L1：5'-GAACGACATGGCTACGATCCGACTTCCGCGATCAAGGAGTTCTT-3'，
Frpob-L2：5'-GAACGACATGGCTACGATCCGACTTACCAGCCAGCTGAGCCA-3'，
Frpob-L3：5'-GAACGACATGGCTACGATCCGACTTCAATTCATGGACCAGAACAACC-3'，
Frpob-L4：5'-GAACGACATGGCTACGATCCGACTTGCTGTCGGGGTTGACCC-3'，
Rrpob-L：5'-CTAAGACCGCTTGGCCTCCGACTTAGCCGATCAGACCGATGTT-3'，
FkatG-L：5'-GAACGACATGGCTACGATCCGACTTGAACCGGTAAGGACGCGA-3'，
RkatG-L：5'-CTAAGACCGCTTGGCCTCCGACTTTTGGCGGTGTATTGCCAA-3'，
Finha-L：5'-GAACGACATGGCTACGATCCGACTTTGTGGCAGTCACCCCGA-3'，
Rinha-L：5'-CTAAGACCGCTTGGCCTCCGACTTGTCGAAGTGTGCTGAGTCACA-3'，
IC-F：5'-GAACGACATGGCTACGATCCGACTTGTCCTACCGTCTCCCTCGTA-3'，
IC-R：5'-TAAGACCGCTTGGCCTCCGACTTGCCCAGCTCTTTATCTACCCG-3'，
F0：5'-GAACGACATGGCTACGATC-3'，
R0：5'-CTAAGACCGCTTGGCCT-3'。
preferably, the gene sequence of the internal control nucleic acid fragment is: 5'-GTCCTACCGTCTCCCTCGTAACCTGGTGATACATTAGATGGCGTGGGCTAGGCGGAGACACTTGTGTGCGTCCCAGAACGTTCCGGACGGCATATTGCTGTGGATTTGCTACTCAGGCGAACTCAGCTGTAAGATTGCAACGTCTGCTTCGTTCCACGGGTAGATAAAGAGCTGGGC-3'.
Preferably, the PCR reaction system of the second round of amplification of the nested PCR is: the total volume was 50. Mu.L, wherein 2 XBuffer 25. Mu.L, 10U/. Mu.L Taq DNA polymerase 2. Mu.L, 10. Mu.M primer Frpob-L1.6. Mu.L, 10. Mu.M primer Frpob-L2.6. Mu.L, 10. Mu.M primer Frpob-L3.6. Mu.L, 10. Mu.M primer Frpob-L4.6. Mu.L, 10. Mu.M primer Rrpob-L0.6. Mu.L, 10. Mu.M primer Finha-L0.6. Mu.L, 10. Mu.M primer Rinha-L0.6. Mu.L, 10. Mu.M primer FkatG-L0.6. Mu.L, 10. Mu.M primer RkatG-L0.6. Mu.L, 10. Mu.M primer IC-F0.6. Mu.L, 10. Mu.M primer IC-R0.6. Mu.L, 10. Mu.M primer F25. Mu.L, 10. Mu.M primer 35. Mu.L, 10. Mu.M 4 ~10 5 copy/. Mu.L of internal control nucleic acid fragment 2. Mu.L, first round amplification product of nested PCR 5. Mu. L, ddH 2 O 3.4 μL。
Preferably, the PCR reaction procedure for the second round of amplification of the nested PCR is: 95. at the temperature of 5 min; 95. 30 s,60 ℃, 1min, 72 ℃, 1min, 15 cycles; 95. the temperature is 30 s,57 ℃, 1min, 72 ℃, 1min, 10 cycles; 72. at the temperature of 5 min.
Preferably, the primers (5 '-3') added with barcode by PCR amplification are:
F1: 5'-GAACGACATGGCTACGA-3'，
R1: 5'-TGTGAGCCAAGGAGTTG-3'，
R-IDn：5'-TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT-3'。
preferably, NNNNNNNNNN in the primer R-IDn is index, and R-ID containing different index is used for different samples.
Preferably, the PCR reaction system added with the barcode is as follows: the total volume was 50. Mu.L, wherein 2 XBuffer was 25. Mu.L, 10U/. Mu.L Taq DNA polymerase was 2. Mu.L, 100. Mu.M primer F1.5. Mu.L, 100. Mu.M primer R1.5. Mu.L, 10. Mu.M primer R-IDn 2. Mu.L, and nested PCR purified product was 20. Mu.L.
Preferably, the PCR reaction program of adding the barcode is as follows: 95. at the temperature of 5 min; 95. 30 s,54 ℃, 30 s,72 ℃, 30 s,25 cycles; 72. at the temperature of 5 min.
A kit for construction of a mycobacterium tuberculosis drug-resistant mutation site sequencing library, comprising: 2. XBuffer, taq DNA polymerase, a mixture of outer primers, a mixture of inner primers and inner primers consisting of an inner control nucleic acid fragment, and a mixture of primers to which barcode is added by PCR amplification.
Preferably, the outer primer mixture is: 1.67 mu.M primer Frpob-out, 1.67. Mu.M primer Rrpob-out, 1.67. Mu.M primer FkatG-out, 1.67. Mu.M primer RkatG-out, 1.67. Mu.M primer Finha-out, 1.67. Mu.M primer Rinha-out.
Preferably, the outer primer mixture is: 1.67 mu.M primer Frpob-out, 1.67. Mu.M primer Rrpob-out, 1.67. Mu.M primer FkatG-out, 1.67. Mu.M primer RkatG-out, 1.67. Mu.M primer Finha-out, 1.67. Mu.M primer Rinha-out.
Preferably, the inner primer mixture is: 0.41 mu.M primer Frpob-L1, 0.41. Mu.M primer Frpob-L2, 0.41. Mu.M primer Frpob-L3, 0.41. Mu.M primer Frpob-L4, 0.41. Mu.M primer Rrpob-L, 0.41. Mu.M primer FkatG-L, 0.41. Mu.M primer RkatG-L, 0.41. Mu.M primer Finha-L, 0.41. Mu.M primer Rinha-L, 0.04. Mu.M primer IC-F, 0.04. Mu.M primer IC-R, 0.41. Mu.M primer Rinha-L, 2. Mu.M primer F0.2 mu M primer R0, 10 3 ~10 4 copy/. Mu.L of the internal control nucleic acid fragment.
Preferably, the barcode primer mixture is: 16.7 mu.M primer F1, 16.7. Mu.M primer R1, 6.7. Mu.M primer R-IDn.
The invention has the beneficial effects that:
1. according to the invention, the key drug-resistant mutation areas of the mycobacterium tuberculosis drug-resistant genes rpoB, katG and inhA promoter regions are specifically amplified through nested PCR, an NGS sequencing library is constructed through PCR, and human interference is removed while the target area is enriched, so that the sequencing data volume is greatly reduced.
2. Compared with the existing library construction technical scheme, the method is more suitable for sequencing read length of 50 bp, and especially for 81bp core area of rpoB, the method can be used for overlapping tile type sectional coverage, and the requirement of short read length is met.
3. In the invention, a small amount of synthetic fragments and corresponding amplification primers are added to serve as internal control of the whole experimental flow in consideration of the condition that the concentration of drug-resistant genes is too low after library establishment even if the drug-resistant genes are enriched.
Drawings
FIG. 1 shows the results of first round amplification product identification of S1 sample nested PCR of example 1.
FIG. 2 shows the results of the second round of amplification product purification by nested PCR for the S1 sample of example 1.
FIG. 3 shows the identification results of the PCR amplification products of S1 samples of example 1 with different additions of barcode.
Detailed Description
The invention is further described below with reference to the accompanying drawings. The following examples are only for more clearly illustrating the technical aspects of the present invention, and are not intended to limit the scope of the present invention.
Example 1
A construction method of a mycobacterium tuberculosis drug-resistant mutation site sequencing library comprises the following steps:
(1) Sample nucleic acid extraction
DNA of a positive sample of Mycobacterium tuberculosis, the sample type of which includes alveolar lavage fluid and sputum, was extracted using a commercial nucleic acid DNA extraction kit (Tiangen, DP 316) as follows:
10 mL of 10 different tuberculosis drug-resistant positive samples are respectively added into a sterile tube, the centrifugation is carried out at 800 rpm for 5 min, and the supernatant is discarded;
adding 200 mu L of buffer GA to the sediment for resuspension, and transferring all the suspension to a 1.5 mL centrifuge tube;
adding 20 mu L of proteinase K solution, and uniformly mixing by vortex 10 and s, standing at 56 ℃ for 60 min, and uniformly mixing for a plurality of times every 15 min;
adding 200 mu L of buffer solution GB and 1 mu L of Carrier RNA storage solution, fully reversing and uniformly mixing, standing at 70 ℃ for 10 min, swirling for 10 s every 3 min during the period, clearing the solution at the moment, and centrifuging briefly to remove liquid drops on the inner wall of the tube cover;
adding 200 mu L of absolute ethyl alcohol, fully reversing and uniformly mixing, and centrifuging briefly to remove liquid drops on the inner wall of the pipe cover;
adding the solution obtained in the last step and flocculent precipitate into an adsorption column CR2, centrifuging at 12000 rpm for 30 s, and discarding the waste liquid;
adding 500 micro L buffer GD into an adsorption column CR2, centrifuging at 12000 rpm for 30 s, and discarding the waste liquid;
adding 600 mu L of rinsing liquid GD into the adsorption column CR2, centrifuging at 12000 rpm for 30 s, discarding the waste liquid, and repeating the step once again;
12000 Centrifuging at rpm for 2 min, discarding the waste liquid, standing the adsorption column CR2 at room temperature for 2-5 min, and airing the rinse liquid in the adsorption material;
transferring the adsorption column CR2 into a new centrifuge tube, suspending and dropwise adding 25 mu L of elution buffer solution TB to the middle position of the adsorption film, standing for 2-5 min at room temperature, centrifuging for 2 min at 12000 rpm, and collecting the solution into the centrifuge tube, wherein the obtained solution is the DNA of the sample.
(2) Nested PCR first round amplification
Using 10 different sample DNA extracted in step (1) as template, using outside primer (see table 1) to amplify target fragment of drug-resistant genes rpoB, katG and inhA, configuring PCR reaction system in PCR tube according to table 2, mixing uniformly, centrifuging, putting into PCR instrument, and operating procedure as shown in table 3. After the PCR is finished, qsep100 is used for identifying the size of the fragment, the size of the amplified fragment is within 500 bp, and the identification result of the S1 sample amplified product is shown in FIG. 1.
Table 1 outer primers
TABLE 2 nested PCR first round amplification System
TABLE 3 nested PCR first round amplification procedure
(3) Second round amplification of nested PCR
The amplification product obtained in the step (2) was diluted 100 times with water and used as a template for the second round of amplification by nested PCR, and a part of the adaptor sequence was added, and the specific use of the primers is shown in Table 4. The PCR reaction system is configured in a PCR tube according to the table 5, and after the configuration, the mixture is evenly mixed and centrifuged, and the mixture is put into a PCR instrument, and the operation procedure is shown in the table 6.
Table 4 inner primers
TABLE 5 nested PCR second round amplification System
TABLE 6 nested PCR second round amplification procedure
(4) Nested PCR product purification
Purifying the amplification product obtained in the step (3) by using a purification magnetic bead (Norvezan, N411), and removing the primer dimer and the redundant primer;
balancing the purified magnetic beads at room temperature for at least 30 min;
vortex oscillating or fully inverting the beads to ensure adequate mixing;
mu.L of purified magnetic Beads (0.9×, beads: DNA=0.9:1) were pipetted into the nested PCR product, vortexed, and incubated for 5 min at room temperature;
the PCR tube was briefly centrifuged and placed in a magnetic rack to separate the beads from the liquid, after the solution was clarified (about 5 min), the supernatant was carefully removed;
keeping the PCR tube in a magnetic rack all the time, adding 200 mu L of freshly prepared 80% ethanol to rinse the magnetic beads, incubating at room temperature for 30 s, carefully removing the supernatant, and repeating the steps twice;
keeping the PCR tube in the magnetic rack all the time, and uncovering the air to dry the magnetic beads until cracks just appear (not more than 5 min);
the PCR tube was removed from the magnet holder and 22. Mu.L ddH was added 2 O, vortex oscillation or gentle blowing by using a pipette until the materials are fully mixed, and standing for 5 min at room temperature. The PCR tube was briefly centrifuged and placed in a magnetic rack for standing, after the solution was clarified (about 3 min), 20. Mu.L of supernatant was carefully removed to a new PCR tube.
And identifying the size of the fragment of the purified product by using Qsep100, wherein the size of the amplified fragment is 150-300 bp, and the identification result of the purified product of the S1 sample is shown in figure 2.
(5) Adding barcode
The nested PCR purified product was used as a template, and then amplified by PCR, and different barcode was added for each library, and a complete library was constructed, specific barcode sequences are shown in Table 7, and primers used are shown in Table 8. The PCR amplification system is configured in a PCR tube according to the table 9, the PCR amplification system is uniformly mixed and centrifuged after the PCR amplification system is configured, the PCR amplification system is put into a PCR instrument, the operation procedure is shown in the table 10, and different barcode PCR amplification product identification results are shown in the figure 3.
TABLE 7 barcode sequence
Table 8 primers
TABLE 9 PCR amplification System
TABLE 10 PCR amplification procedure
(6) Library product purification
The method is the same as in the step (4), except that the purified substance is the PCR product obtained in the step (5).
Comparative example 1
A construction method of a mycobacterium tuberculosis drug-resistant mutation site mNGS library comprises the following steps:
(1) Sample nucleic acid extraction
The procedure was as in example 1, and the samples were identical.
(2) mNSS library construction
The library was constructed using the novinak library-building kit (NDM 617).
DNA fragmentation/end repair/dA tail addition
And taking out the FEA Buffer and the FEA Enzyme Mix, thawing, uniformly mixing, centrifuging briefly, collecting to the bottom of a tube, and placing on ice for standby.
The sterile PCR tube was taken and the components as in table 11:
TABLE 11 DNA fragmentation/end repair/dA tail addition reaction System
The mixture was gently stirred or shaken with a pipette, and the reaction mixture was collected to the bottom of the tube by brief centrifugation. To each sample, 10. Mu.L of FEA Enzyme Mix was added, gently swirled and mixed using a pipette, and the reaction solution was collected to the bottom of the tube by brief centrifugation. The PCR tube was placed in a PCR instrument and the procedure is as in table 12.
TABLE 12 DNA fragmentation/end repair/dA tail addition reaction procedure
II. Joint connection
Rapid Ligation buffer 3 and Rapid DNA library are taken out from the temperature of minus 20 ℃, thawed, evenly mixed, centrifugally collected for a short time to the bottom of a tube, and placed on ice for standby.
The new PCR tube was taken and the components as in Table 13 were added:
table 13 Adapter Ligation reaction System
The mixture was gently stirred with a pipette and centrifuged briefly to collect the reaction solution to the bottom of the tube. The PCR tube was placed in a PCR instrument and the procedure is as in table 14.
Table 14 Adapter Ligation reaction procedure
III purification of ligation product magnetic beads
Swirling the DNA Clean Beads equilibrated at room temperature for at least 30 min to ensure adequate mixing, instantaneous centrifugation, and packaging in a Clean 1.5 mL collection tube at 60 μl;
placing the connection product obtained in the step II into a collecting pipe containing 60 mu L DNA Clean Beads, blowing and mixing uniformly (shaking) and incubating for 5 min at room temperature;
centrifuging the collecting pipe for a short time, placing the collecting pipe in a magnetic rack to separate magnetic beads and liquid, and carefully removing the supernatant after the solution is clarified;
keeping the collection tube in a magnetic rack all the time, adding 200 mu L of 80% ethanol to rinse the magnetic beads, incubating at room temperature for 30 s, carefully removing the supernatant, and repeating the steps once;
centrifuging the collecting tube instantaneously, putting the collecting tube back into the magnetic frame, carefully removing residual liquid, taking care not to touch the magnetic beads, and uncovering the air to dry the magnetic beads until the surfaces of the magnetic beads are matt or crack (not more than 5 min) is just generated;
the collection tube was removed from the magnet holder and 23. Mu.L ddH was added directly 2 O, lightly blowing and mixing or shaking and mixing by using a pipettor, and standing for 5 min at room temperature;
after the collection tube is briefly centrifuged, the collection tube is placed in a magnetic rack for standing, and after the solution is clarified, 20 mu L of supernatant is carefully removed to a new PCR tube without touching the magnetic beads.
IV. Library amplification
And (3) carrying out PCR amplification on the purified connection product. PCR Primer Mix for MGI and VAHTS HiFi Amplification Mix were thawed and mixed upside down, briefly centrifuged to the bottom of the tube, and the reaction as shown in Table 15 was prepared in a sterile PCR tube:
table 15 Library Amplification reaction System
The mixture was gently stirred with a pipette (stirring without shaking) and the reaction mixture was collected to the bottom of the tube by brief centrifugation. The PCR tube was placed in a PCR instrument and the procedure is as in table 16.
Table 16 Library Amplification reaction procedure
And (3) purifying the reaction product by using VAHTS DNA Clean Beads, wherein the method is the same as the step III, and the purified library amplification product is obtained.
Comparative example 2
A method for constructing a library by targeting capture of a mycobacterium tuberculosis drug-resistant mutation site probe comprises the following steps:
(1) Sample nucleic acid extraction
The procedure was as in example 1, and the samples were identical.
(2) Probe hybridization Capture
The mNGS library obtained in the comparative example was used to construct a targeted capture library using a targeted capture kit (why, P10018).
Library hybridization blocking
The Human Cot-1 DNA and Un-Blocker/MGI-Dual-Blocker were taken out from-20deg.C and placed on ice for natural thawing. 500 ng of the mNGS library prepared in comparative example 1, 5. Mu.L of Human Cot-1 DNA and 2. Mu.L of MGI-Blocker were taken and mixed in a PCR tube. The mixed reaction solution was vortexed and centrifuged instantaneously to allow the reaction solution to flow at the bottom of the tube. The PCR tube was placed in a vacuum rotary evaporator and the reaction was evaporated to dryness at 60 ℃.
Library hybridization Capture
The HYB-EB and Probe (Panel Probe) were removed and placed on ice for natural thawing. To the evaporated PCR tube were added 12. Mu.L HYB-EB, 2. Mu.L Probe and 2. Mu.L Nuclear-Free H 2 O, vortex vibration and mixing for 2 min until the evaporated dry powder is completely dissolved, and instantaneous centrifugation. The mixture was placed in a PCR apparatus set in advance and incubated at 95℃for 5 min, and the temperature of the PCR hotplate was 105 ℃. And taking out the PCR tube after the incubation is finished, uniformly mixing by vortex oscillation, performing instantaneous centrifugation, and incubating for 30 min at 65 ℃ in a PCR instrument, wherein the temperature of a hot cover is 75 ℃.
III library and magnetic bead binding
Placing streptavidin magnetic Beads, namely SA Beads, at room temperature for 10 min, and balancing the system;
vortex oscillating SA beams, and fully and uniformly mixing;
using 50 mu L of SA Beads magnetic bead solution for each hybridization reaction, and sub-packaging into a new PCR tube;
placing the PCR tube on a magnetic rack for magnetic attraction, discarding the supernatant after complete magnetic attraction, and reserving SA beads;
immediately placing the PCR tube containing SA beams on a PCR instrument at 65 ℃;
transferring all 16 μl of the hybridization solution after capture to the corresponding numbered SA-Beads-containing PCR tube of the previous step (performed on a PCR instrument at 65 ℃);
after the reagent is added, immediately vortex and shake, fully mix, instantly centrifuge, continue to incubate for 30 min in a 65 ℃ PCR instrument (thermal cover 75 ℃) (take out shaking 5 s every 6 min, immediately put into the PCR instrument to react until the total reaction time is met);
IV. Thermal elution
Placing 150 mu L of 1 XWash Mix in a PCR instrument for preheating;
placing a 0.2 mL PCR tube with the library and the magnetic beads combined on a magnetic rack for attracting magnetism, and discarding the supernatant after the complete attracting magnetism;
150. Mu.L of 1 XWash Mix preheated at 65℃was added to the PCR tube;
putting the PCR tube back on the PCR instrument, repeatedly blowing and mixing by a pipetting gun, and incubating at 65 ℃ for 5 min;
placing the mixture on a magnetic rack, and rapidly sucking and discarding supernatant;
adding 150 mu L of 1 XWash Mix preheated at 65 ℃ into the PCR tube again, putting the PCR tube back onto a PCR instrument, repeatedly blowing and mixing by a pipetting gun, incubating at 65 ℃ for 5 min, placing on a magnetic rack, and rapidly sucking and discarding the supernatant;
v. cold elution
Adding 150 mu L of 1 XWash Mix at room temperature into the PCR tube subjected to thermal elution, carrying out vortex oscillation for 2 min, fully oscillating and uniformly mixing, fully suspending magnetic beads, placing on a magnetic rack, and absorbing and discarding supernatant;
adding 150 μl of 1 xWash Mix at room temperature, shaking for 1min by vortex, mixing, placing on a magnetic rack, and removing supernatant;
adding 150 μl of 1 xWash Mix at room temperature, repeatedly sucking and beating, mixing, and centrifuging instantaneously;
transferring the mixed solution to a new PCR tube, placing the PCR tube on a magnetic rack, and sucking and discarding the supernatant after the magnetic beads and the solution are completely separated;
the PCR tube was centrifuged instantaneously, placed on a magnetic rack, the residual liquid was removed, and 23. Mu.L of ddH was directly added 2 O, resuspension the beads.
VI library enrichment
The new PCR tube was added to the composition as in table 17:
TABLE 17 POST-PCR reaction System
The magnetic beads are kept suspended in the solution by short vortex and light throwing. The PCR tube was placed in a PCR instrument and the thermal lid was set at 105 ℃. PCR amplification was performed according to the procedure in Table 18.
TABLE 18 POST-PCR amplification procedure
VII. Purification of the product
Adding 55 mu L of magnetic beads into the PCR reaction product, mixing uniformly by vortex, and standing for 5 min at room temperature;
placing the PCR tube on a magnetic rack, completely separating magnetic beads from the solution, and discarding the supernatant;
adding 100 mu L of 80% ethanol into the PCR tube, and replacing the surfaces of the PCR tube on two sides of the magnetic frame to ensure that the magnetic beads are fully washed by the 80% ethanol, and discarding the supernatant (100 mu L of 80% ethanol is washed twice together);
airing for 2 min until no reflection exists on the surface;
add 25. Mu.L ddH 2 Fully suspending the magnetic beads by using a pipettor, and standing for 3 min;
and placing the PCR tube in a magnetic rack, completely separating the magnetic beads from the solution, and transferring the supernatant to a new 1.5 mL centrifuge tube with corresponding number to obtain the purified library amplification product.
Test 1
(1) DNB preparation
Taking out TE buffer solution, DNB preparation buffer solution, DNB polymerase mixed solution I (OS), DNB polymerase mixed solution II (OS) and DNB termination buffer solution, placing on an ice box, shaking and uniformly mixing by a vortex oscillator for 5 s after melting, and centrifuging briefly and placing on the ice box for standby. The libraries obtained in example 1, comparative example 1 and comparative example 2 were mixed according to table 19.
TABLE 19 pulling Table
After mixing all libraries of example 1, comparative example 1 and comparative example 2, vortex shaking was mixed and then centrifuged instantaneously. A new PCR tube was taken and added to the composition as in Table 20.
TABLE 20 DNB preparation System 1
The reaction Mix was mixed by shaking with a vortex shaker, centrifuged in a mini centrifuge 5 s, and reacted in a PCR instrument. The reaction conditions are shown in Table 21:
TABLE 21 DNB reaction Condition 1
After the end of the procedure, the PCR tube was removed and the mini-centrifuge centrifuged 5 s before adding the components as in table 22 on ice.
TABLE 22 DNB preparation System 2
The reaction Mix was mixed by shaking with a vortex oscillator, centrifuged in a mini centrifuge at 5. 5 s and then placed in a PCR instrument to start the reaction under the reaction conditions shown in table 23:
TABLE 23 DNB reaction Condition 2
When the reaction was completed, the PCR tube was taken out, 20. Mu.L of DNB stop buffer was added to the ice, and the mixture was gently stirred with a pipette for about 10 times and then mixed.
After the preparation of DNB, 2. Mu.L of DNB was taken and concentration was measured using Qubit. The concentration of 8 ng/. Mu.L or more is qualified. (2) DNB loading and processing
Taking out DNB loading buffer solution I and DNB loading buffer solution II, placing on an ice box for about 0.5. 0.5 h, shaking and uniformly mixing by using a vortex oscillator for 5 s, and placing on the ice box for standby after short centrifugation.
The 0.5. 0.5 mL frozen tube was removed and reagents were added (as prepared) as per Table 24.
TABLE 24 DNB Loading reaction System
The mixture was gently beaten about 10 times with a pipette (the mouth of the gun was widened, no air bubbles could be generated), and no shaking and vigorous beaten were performed.
(3) Sequencing
Taking out the sequencing reagent tank, dNTPs mixed solution and dNTPs mixed solution II, thawing at room temperature, and immediately placing in a refrigerator at 4 ℃ for standby. Before use, the DNA polymerase mixed solution is taken out and placed at 4 ℃ for standby; a clean 1 mL gun head is used for lightly stamping a sample adding hole site with the diameter smaller than 1cm at the edge positions of the No. 1 hole and the No. 2 hole. 0.7 mL of dNTPs mixture and 0.7 mL of DNA polymerase mixture were added to well 1, and 0.6 mL of dNTPs mixture II and 0.6 mL of DNA polymerase mixture were added to well 2.
The sample adding hole is sealed by a matched transparent sealing film, so that the central position of the hole is not covered, and the reagent needle is prevented from being influenced to descend. The kit is horizontally placed on a tabletop, two hands hold the two sides, shake clockwise for 10-20 times and shake anticlockwise for 10-20 times, and the swirl is ensured to be visible to naked eyes during the period so as to ensure the full mixing of the reagents.
The reference gene sequencer (MGISEQ-200 RS) was used to start the gene sequencer, complete DNB tube, sequencing slide and sequencing reagent tank loading, and start the sequencing program, sequencing mode SE50. Example 1, 1M reads per library, comparative example 1, 20M reads per library, and comparative example 2, 5M reads per library. Sequencing read length 50 bp.
TABLE 25 detection results of tuberculosis drug resistance gene mutations of different construction libraries
Note that: + indicates detected, -indicates not detected
As can be seen from Table 25, 10 different positive samples are selected and three different library construction methods are adopted to obtain three second generation sequencing libraries of the core drug-resistant mutation sites of the mycobacterium tuberculosis.
The foregoing is merely a preferred embodiment of the present invention, and it should be noted that modifications and variations could be made by those skilled in the art without departing from the technical principles of the present invention, and such modifications and variations should also be regarded as being within the scope of the invention.

Claims (9)

1. A method for constructing a mycobacterium tuberculosis drug-resistant mutation site sequencing library, which is characterized by comprising the following steps:
extracting DNA of a positive sample of the mycobacterium tuberculosis;
amplifying target fragments of drug-resistant genes rpoB, katG and inhA by using an outer primer, performing first round amplification of nested PCR, and performing second round amplification of nested PCR by using an inner primer and an inner control nucleic acid fragment by using an amplification product as a template;
purifying a product obtained by nested PCR amplification, taking the purified product as a template, and adding barcode through PCR amplification to construct a complete library;
the outer primers used for the first round of amplification of the nested PCR are specifically:
primer DNA sequence for amplifying target fragment of drug-resistant gene rpoB:
Frpob-out：5'-GAGGGTCAGACCACGATGA-3'，
Rrpob-out：5'-GCGTTTCGATGAACCCGA-3'；
primer DNA sequence for amplifying target fragment of drug-resistant gene KatG:
FkatG-out：5'-GCCATGAACGACGTCGAA-3'，
RkatG-out：5'-GTCAGTGGCCAGCATCGT-3'；
primer DNA sequence for amplifying target fragment of drug-resistant gene inhA:
Finha-out：5'-CACATTCGACGCCAAACA-3'，
Rinha-out：5'-GCAATTCGTAGGGCGTCA-3'；
the inner primers used for the second round of amplification of the nested PCR are specifically:
Frpob-L1：5'-GAACGACATGGCTACGATCCGACTTCCGCGATCAAGGAGTTCTT-3'，
Frpob-L2：5'-GAACGACATGGCTACGATCCGACTTACCAGCCAGCTGAGCCA-3'，
Frpob-L3：5'-GAACGACATGGCTACGATCCGACTTCAATTCATGGACCAGAACAACC-3'，
Frpob-L4：5'-GAACGACATGGCTACGATCCGACTTGCTGTCGGGGTTGACCC-3'，
Rrpob-L：5'-CTAAGACCGCTTGGCCTCCGACTTAGCCGATCAGACCGATGTT-3'，
FkatG-L：5'-GAACGACATGGCTACGATCCGACTTGAACCGGTAAGGACGCGA-3'，
RkatG-L：5'-CTAAGACCGCTTGGCCTCCGACTTTTGGCGGTGTATTGCCAA-3'，
Finha-L：5'-GAACGACATGGCTACGATCCGACTTTGTGGCAGTCACCCCGA-3'，
Rinha-L：5'-CTAAGACCGCTTGGCCTCCGACTTGTCGAAGTGTGCTGAGTCACA-3'，
IC-F：5'-GAACGACATGGCTACGATCCGACTTGTCCTACCGTCTCCCTCGTA-3'，
IC-R：5'-TAAGACCGCTTGGCCTCCGACTTGCCCAGCTCTTTATCTACCCG-3'，
F0：5'-GAACGACATGGCTACGATC-3'，
R0：5'-CTAAGACCGCTTGGCCT-3'；
the gene sequence of the internal control nucleic acid fragment is as follows: 5'-GTCCTACCGTCTCCCTCGTAACCTGGTGATACATTAGATGGCGTGGGCTAGGCGGAGACACTTGTGTGCGTCCCAGAACGTTCCGGACGGCATATTGCTGTGGATTTGCTACTCAGGCGAACTCAGCTGTAAGATTGCAACGTCTGCTTCGTTCCACGGGTAGATAAAGAGCTGGGC-3'.
2. The method for constructing a sequencing library of drug-resistant mutation sites of mycobacterium tuberculosis according to claim 1, wherein the first round of amplification of the nested PCR reaction system is: the total volume was 25. Mu.L, wherein 2 XBuffer 12.5. Mu.L, 10U/. Mu.L Taq DNA polymerase 1. Mu.L, 10. Mu.M primer Frpob-out 0.5. Mu.L, 10. Mu.M primer Rrpob-out 0.5. Mu.L, 10. Mu.M primer FkatG-out 0.5. Mu.L, 10. Mu.M primer RkatG-out 0.5. Mu.L, 10. Mu.M primer Finha-out 0.5. Mu.L, 10. Mu.M primer Rinha-out 0.5. Mu.L, template 8.5. Mu.L.
3. The method for constructing a sequencing library of drug-resistant mutation sites of Mycobacterium tuberculosis according to claim 1, wherein the PCR reaction procedure of the first round of amplification of the nested PCR is as follows: 95. at the temperature of 5 min; 95. the temperature is reduced by 1 ℃ and 72 ℃ for 1min for 10 cycles after 30 s and 70 ℃ for 1 min; 95. the temperature is 30 s,60 ℃, 1min, 72 ℃, 1min, 10 cycles; 72. at the temperature of 5 min.
4. The method for constructing a sequencing library of drug-resistant mutation sites of mycobacterium tuberculosis according to claim 1, wherein the PCR reaction system of the second round of amplification of the nested PCR is as follows: the total volume was 50. Mu.L, wherein 2 XBuffer 25. Mu.L, 10U/. Mu.L Taq DNA polymerase 2. Mu.L, 10. Mu.M primer Frpob-L1.6. Mu.L, 10. Mu.M primer Frpob-L2.6. Mu.L, 10. Mu.M primer Frpob-L3.6. Mu.L, 10. Mu.M primer Frpob-L4.6. Mu.L, 10. Mu.M primer Rrpob-L0.6. Mu.L, 10. Mu.M primer Finha-L0.6. Mu.L, 10. Mu.M primer Rinha-L0.6. Mu.L, 10. Mu.M primer FkatG-L0.6. Mu.L, 10. Mu.M primer RkatG-L0.6. Mu.L, 10. Mu.M primer IC-F0.6. Mu.L, 10. Mu.M primer IC-R0.6. Mu.L, 10. Mu.M primer F25. Mu.L, 10. Mu.M primer 35. Mu.L, 10. Mu.M 4 ~10 5 copy/. Mu.L of internal control nucleic acid fragment 2. Mu.L, first round amplification product of nested PCR 5. Mu. L, ddH 2 O 3.4 μL。
5. The method for constructing a sequencing library of drug-resistant mutation sites of Mycobacterium tuberculosis according to claim 1, wherein the PCR reaction procedure of the second round of amplification of the nested PCR is as follows: 95. at the temperature of 5 min; 95. 30 s,60 ℃, 1min, 72 ℃, 1min, 15 cycles; 95. the temperature is 30 s,57 ℃, 1min, 72 ℃, 1min, 10 cycles; 72. at the temperature of 5 min.
6. The method for constructing a mycobacterium tuberculosis drug-resistant mutation site sequencing library according to claim 1, wherein the primer added with the barcode by PCR amplification is:
F1: 5'-GAACGACATGGCTACGA-3'，
R1: 5'-TGTGAGCCAAGGAGTTG-3'，
R-IDn：5'-TGTGAGCCAAGGAGTTGNNNNNNNNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT-3'。
7. the method for constructing a mycobacterium tuberculosis drug-resistant mutation site sequencing library according to claim 6, wherein the PCR reaction system added with the barcode is as follows: the total volume was 50. Mu.L, wherein 2 XBuffer was 25. Mu.L, 10U/. Mu.L Taq DNA polymerase was 2. Mu.L, 100. Mu.M primer F1.5. Mu.L, 100. Mu.M primer R1.5. Mu.L, 10. Mu.M primer R-IDn 2. Mu.L, and nested PCR purified product was 20. Mu.L.
8. The method for constructing a mycobacterium tuberculosis drug-resistant mutation site sequencing library according to claim 1, wherein the PCR reaction program of adding the barcode is as follows: 95. at the temperature of 5 min; 95. 30 s,54 ℃, 30 s,72 ℃, 30 s,25 cycles; 72. at the temperature of 5 min.
9. A kit for constructing a sequencing library of drug-resistant mutation sites of mycobacterium tuberculosis, comprising: 2. xBuffer, taq DNA polymerase, a mixture of the outer primers of claim 1, a mixture of the inner primers of claim 1 and the inner nucleic acid fragment of claim 1, and a mixture of primers added by PCR amplification of the barcode of claim 6.
CN202311151810.2A 2023-09-07 2023-09-07 Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library Active CN116875718B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311151810.2A CN116875718B (en) 2023-09-07 2023-09-07 Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311151810.2A CN116875718B (en) 2023-09-07 2023-09-07 Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library

Publications (2)

Publication Number Publication Date
CN116875718A CN116875718A (en) 2023-10-13
CN116875718B true CN116875718B (en) 2023-12-01

Family

ID=88266631

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311151810.2A Active CN116875718B (en) 2023-09-07 2023-09-07 Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library

Country Status (1)

Country Link
CN (1) CN116875718B (en)

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104561350A (en) * 2015-01-28 2015-04-29 深圳华大基因研究院 Kit and application thereof
CN110878334A (en) * 2019-11-12 2020-03-13 北京康普森生物技术有限公司 Primer for sequencing amplicon and two-step PCR library building method
CN111378732A (en) * 2018-12-27 2020-07-07 北京希望组生物科技有限公司 Mitochondrial genome sequencing primer, kit and method
CN112852937A (en) * 2021-03-10 2021-05-28 美格医学检验所(广州)有限公司 Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof
CN113493848A (en) * 2021-07-23 2021-10-12 杭州圣庭医疗科技有限公司 Mycobacterium tuberculosis drug-resistant type identification method based on nanopore sequencer
CN115992272A (en) * 2022-10-17 2023-04-21 杭州遂真生物技术有限公司 Composition for detecting mycobacterium tuberculosis and drug-resistant gene thereof and integrated kit
CN116377095A (en) * 2023-03-06 2023-07-04 福州奥吉芯生物科技有限公司 Primer library, kit and detection method for detecting mycobacterium and/or tuberculosis drug-resistant genes

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104561350A (en) * 2015-01-28 2015-04-29 深圳华大基因研究院 Kit and application thereof
CN111378732A (en) * 2018-12-27 2020-07-07 北京希望组生物科技有限公司 Mitochondrial genome sequencing primer, kit and method
CN110878334A (en) * 2019-11-12 2020-03-13 北京康普森生物技术有限公司 Primer for sequencing amplicon and two-step PCR library building method
CN112852937A (en) * 2021-03-10 2021-05-28 美格医学检验所(广州)有限公司 Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof
CN113493848A (en) * 2021-07-23 2021-10-12 杭州圣庭医疗科技有限公司 Mycobacterium tuberculosis drug-resistant type identification method based on nanopore sequencer
CN115992272A (en) * 2022-10-17 2023-04-21 杭州遂真生物技术有限公司 Composition for detecting mycobacterium tuberculosis and drug-resistant gene thereof and integrated kit
CN116377095A (en) * 2023-03-06 2023-07-04 福州奥吉芯生物科技有限公司 Primer library, kit and detection method for detecting mycobacterium and/or tuberculosis drug-resistant genes

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
应用套式PCR分段扩增犬瘟热病毒融合蛋白的全基因;李金中, 夏咸柱, 殷震, 涂长春, 金宁一;中国兽医学报(第02期);第124-125页 *
高通量测序技术在分枝杆菌病诊断中的应用专家共识;高通量测序共识专家组;中华传染病杂志;第41卷(第4期);第175-182页 *

Also Published As

Publication number Publication date
CN116875718A (en) 2023-10-13

Similar Documents

Publication Publication Date Title
ES2206485T3 (en) ISOLATION OF NUCLEIC ACID.
CN108517360A (en) A kind of circulating tumor dissociative DNA abrupt climatic change quality-control product and preparation method thereof
CN106399546B (en) Capture probe and kit for detecting human circulating tumor DNA EGFR gene by high-throughput sequencing
CN107893100A (en) A kind of unicellular mRNA reverse transcriptions and the method for amplification
CN112877403B (en) Method for constructing sequencing library of target sequence
CN106835291B (en) The preparation method and kit of DNA library
CN106520963B (en) Capture probe and kit for detecting human circulating tumor DNA KRAS gene by high-throughput sequencing
CN105779649A (en) Immune PCR reagent kit for detecting avian leukemia virus
CN110396557A (en) A kind of specific HPV nucleic acid detection method based on CRISPR/Cas12a
CN105986039A (en) Detection kit for drug-resistant mutation locus and genotype of hepatitis B virus, use method and application thereof
CN111961713A (en) Probe composition and kit for screening carriers of pathogenic genes of genetic diseases and preparation method of probe composition and kit
CN111705135A (en) Method for detecting MGMT promoter region methylation
CN116790718B (en) Construction method and application of multiplex amplicon library
CN110777154A (en) Mutant gene for drug resistance detection of mycobacterium tuberculosis, and detection method and kit thereof
CN116875718B (en) Construction method and kit of mycobacterium tuberculosis drug-resistant mutation site sequencing library
WO2021232186A1 (en) Digital micro-fluidic platform-based nucleic acid enrichment and sequencing library construction methods
CN115386622A (en) Transcriptome library building method and application thereof
CN110600082B (en) Nucleic acid capture probe for HLA typing and design method thereof
CN102899401A (en) IRF4 gene polymorphism detection kit through pyrosequencing method, and method thereof
CN101892328A (en) Method for detecting medicament resistance of hepatitis B virus
CN113462759A (en) Method for enriching and sequencing single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection
EP3935163A1 (en) Preparation methods and apparatus adapted to filter small nucleic acids from biological samples
CN111172319A (en) Primer pair for detecting porcine epidemic diarrhea virus, kit and application thereof
CN112538657B (en) Cerebrospinal fluid gene sequencing library building and detecting method and application thereof
CN115976281B (en) Primer group for simultaneously detecting 15 pathogens of pigs through high-throughput targeted sequencing and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant