CN107893100A

CN107893100A - A kind of unicellular mRNA reverse transcriptions and the method for amplification

Info

Publication number: CN107893100A
Application number: CN201711139327.7A
Authority: CN
Inventors: 胡春旭; 陆思嘉; 任军
Original assignee: Medical Technology (suzhou) Co Ltd
Current assignee: Medical Technology (suzhou) Co Ltd
Priority date: 2017-11-16
Filing date: 2017-11-16
Publication date: 2018-04-10

Abstract

The invention belongs to transcriptome analysis field, and in particular to a kind of unicellular mRNA reverse transcriptions and amplification method.The present invention can be starting by the extracted eucaryote total serum IgE of 1 2000 cells or 10pg 20ng, and amplified 20 500ng high quality total length double-strands cDNA in 56 hours.The present invention can obtain more than 95% reverse transcription and amplification success rate, and the full-length cDNA of amplification can seamless connection main flow microarray dataset.The present invention is to study the strong instrument of gene expression in individual cell level, it is greatly expanded RNA Seq application, through reverse transcription of the present invention and the cDNA that amplifies, it can be used as the expression analysis (individual cells) of denier sample, early embryo development research, the heterogeneous Journal of Sex Research of tumour cell, immunocyte group research, stem cell differentiation are studied.

Description

A kind of unicellular mRNA reverse transcriptions and the method for amplification

Technical field

The present invention relates to biological technical field, is related to genomic sequence analysis field, and in particular to one kind identification embryo puts down The method of weighing apparatus transposition breakaway poing and balanced translocation carrier state.

Background technology

Transcript profile refers to some species or specific cells under a certain states of physiologic function, the mRNA of intracellular all transcriptions The set of product, the restriction in time and space is contained, be to connect genome hereditary information and the protein group of biological function Inevitable tie.

Transcriptome analysis includes but is not limited to：The analysis of encoding gene, the prediction of translating albumen, extron introne are cut Cut splicing, the structural analysis functional analysis of transcript, mRNA secondary structures, differential expression of gene etc..Mature and reliable at present Transcriptome analysis means include RT-qPCR analyses gene expression amount, chip hybridization Platform Analysis analyzes some knowns Transcription activity or high throughput sequencing technologies etc..

It is one wherein to carry out transcript profile sequencing (RNA-seq) using high throughput sequencing technologies (sequencing technologies of future generation, NGS) The quick reliable method for obtaining transcription group information of kind.Relative to traditional RT-qPCR platforms or chip hybridization platform, NGS skills Art is applied to transcriptome analysis without in advance for known sequences Design probe or primer, you can in transcript degree and gene Level detects to overall transcription activity, and with quantitative more accurate, and it is excellent that detection flux is higher, and detection range is wider etc. Point.In addition, while transcript structures and expression is analyzed, moreover it is possible to find unknown transcript and rare transcript, accurately Identification variable sheer site and possible point mutation, there is provided most comprehensively transcription group information.

Transcript profile is in depth accurately analyzed, contributes to the effect of comprehensive understanding cellular gene expression and regulated and control network.It is identical Histiocytic genotype is almost consistent, but the expression of cell subsets is often different；The cell of different tissues each possesses uniqueness Transcript profile.The nuance for studying these transcript profiles can be from different physiologic functions and phenotype angle explaination gene regulation Network.General transcript profile experiment usually requires individual cells thousands of or even up to a million.But body early embryo cell and stem cell etc. Few cells can only be collected into, this requires to utilize cell as few as possible in experiment, is preferably turned in individual cell level Record group analysis.It recent studies have shown that, the gene expression of similar cellular has heterogeneity, and this heterogeneity is by different derivative bases Because of decisions such as group, cell cycle and microenvironments.What conventional method obtained is the general character of a large amount of cellular gene expression information, it is difficult to Show mutual heterogeneity.Analysis to unicellular transcript profile, the heterogeneity of gene expression can not only be studied, can also study expression Randomness, further disclose a series of important informations related to development, disease etc..Therefore transcribed in individual cell level Group analysis have important scientific meaning be also reality there is an urgent need to.

Carrying out RNA-seq in theory with NGS technologies can be carried out on individual cell level, and according to point of different depth Analysis, it can finally obtain the expressing information of integral level full gene.The method has the following advantages that：A. high resolution, sample is originated Product amount is individual cells；B. high sensitivity；C. digitized signal, phase in single base difference, gene family can directly be detected The different expression like caused by gene and alternative splicing；D. detection range is wide, can not only detect gene, moreover it is possible to detects RNA splicings Body；E. favorable reproducibility.The most important link of the method is unicellular mRNA expression analysis, i.e., by obtaining research object mRNA Site, variable sheer etc. occurs for the information in (transcript, subgenomic transcription region), identification transcription, and its accurate method of counting is more Accurate quantitative analysis can be carried out to gene.The important prerequisite of unicellular mRNA expression analysis is the mRNA of unicellular middle trace (6-10pg) or the mRNA of pg ranks are by efficient and homogeneous reverse transcription and amplification.

In practice, unicellular mRNA sequencings from single celled separation and are handled to amplification from sample preparation to data processing When sensitivity and skewed popularity many technical problems all be present.From rich reward of soup in 2009 et al. in " mRNA-Seq whole- transcriptome analysis of a single cell".Nat Methods.6(5):377-82. report first it is slender Since born of the same parents' RNA sequencing technologies, many novel technologies are developed, can more rapidly, more information is provided more at low cost. The important unicellular RNA sequencing technologies related to this patent have：

Smart-Seq

Smart-Seq (the end of the RNAtranscript of Switching mechanism at 5 ') is a tool The technology of milestone significance, in scientist's joint development by the U.S. and Sweden in 2012.As a kind of unicellular sequencing scheme, It makes moderate progress on the sequence coverage of transcript.The complete covering of genome realize this isomers of alternative transcription and SNV detection.

In this scheme, people's cell lysis, and by RNA and the primer hybridization for including oligo (dT).Then add several The C nucleotide of individual no template, generate first chain.This poly (C), which overhangs, to be only added on total length transcript.Then by few core Thuja acid primer and the prominent hybridization of poly (C), synthesize Article 2 chain.Full-length cDNA expands by PCR, to obtain the DNA of nanogram level. PCR primer can be used for being sequenced (Fig. 1) after purification.

Advantage：

1. require no knowledge about mRNA sequence.

2. use as little as 50pg parent material.

3. the coverage of transcript improves.

4. high-caliber can positioning sequence.

Shortcoming：

1. it is not that chain is special.

2. transcript length skewed popularity, efficient transcription is unable to the sequence more than 4Kb.

3. high abundance transcript is by preferential amplification.

4. purification step may cause material to lose.

Smart-Seq2

Smart-Seq2 is published in after 1 year《Nature Methods》(2013,10(11):1096) on, to initial Smart-Seq schemes have made some improvements.New departure uses lock nucleic acid (LNA), the MgCl2 and glycine betaine of higher concentration.It Purification step is no longer needed, is greatly improved yield.

In this scheme, people are in oligo (dT) few nucleosides comprising free dNTP and with general 5 ' anchor series Cracked in the buffer solution of acid unicellular.Carry out reverse transcription afterwards, this reaction is also individual without template in cDNA 3 ' end addition 2-5 C nucleotide.Then template switch oligonucleotide (TSO) is added, it carries two ribose guanosines and a modification guanosine, 3 ' End produces LNA, as last base.After the first chain reaction, limited cyclic amplification cDNA is utilized.Then pass through Tagmentation, sequencing library is fast and effeciently built using the cDNA amplified.

Advantage：

1. use as little as 50pg parent material.

2. require no knowledge about mRNA sequence.

3. no longer need purification step.

4. the coverage of transcript improves.

5. high-caliber can positioning sequence.

Shortcoming：

1. not chain is special.

2. amplification efficiency is not high.

This area needs more efficient more special unicellular amplification technique.

The content of the invention

The present invention makes on the basis of SMART-seq2 to be sexually revised at all, and efficient and homogeneous total length transcript can be achieved and expand Increase.Particular technique is：

Release total serum IgE, the reverse transcription joint GAT_ of particular design after unicellular (or denier cell) is hot cracked 30dTVN_V2 (MALBAC primer sequences add 30 T bases, and 5 ' ends are modified with hydrophobic property blocking groupses such as C18 carbon skeletons) Poly (A) tails complementary specificity with mRNA in environment is cracked is matched, and reverse transcription is carried out to mRNA in the presence of reverse transcriptase And obtain the chains of cDNA first (Fig. 3).

Then without template added at the cDNA obtained 3 ' ends with template switch (Template-switching) technology Add 2-5 (being usually 3) C nucleotides.Template switch oligonucleotide GAT_6N3G_V2 (its 5 ' end of particular design in system Using MALBAC primers as starting, and last is used as in 3 ' end 1-4 ribose guanosines of carrying and 1 LNA guanosine, LNA guanosines Base, 5 ' ends of this template switch oligonucleotide are with hydrophobic property blocking groupses such as NH₂- C6 does Seal treatment) cDNA's 3 ' one section of joint sequence of end addition, special reaction protective agent can greatly strengthen the template switch activity of reverse transcriptase, and inverse Under the polymerization activity using DNA as template of transcriptase guides, the generation of the chains of cDNA bis- is carried out.Because template switch can only turn template Change oligonucleotides GAT_6N3G_V2 and be added in mRNA5 ' ends most end, and the generation of two chains relies on the 2-5 of template switch activity generation Individual no template C nucleotide carries out joint addition, and obtained cDNA is theoretically total length and (Fig. 4,6N expression is added wherein also show Quantitative molecular label).

After the generation of the second chain, circulated using limited number of time (such as 6-18 times) and cDNA is expanded with MALBAC primers.

In some embodiments, the reverse transcriptase is selected from Invitrogen^TMCompany SuperScript^TM II Reverse Transcriptase or Invitrogen^TMCompany SuperScript^TM III Reverse Transcriptase、Thermo Scientific^TMCompany Maxima H Minus Reverse Transcriptase, RevertAid H Minus Reverse Transcriptase。

In some embodiments, the hydrophobic property blocking groupses be selected from C18 carbon skeletons, C6 carbon skeletons, NH2-C6, NH2-C12、Biotin、Biotin-TEG、Dual biotin。

In a preferred embodiment, the MALBAC primer sequences are GTGAGTGATGGTTGAGGTAGTGTGGAG (SEQ ID NO:1)。

In a preferred embodiment, template switch oligonucleotide is in MALBAC primer sequences and the ribose guanosine of addition Between also include expression quantitative molecular label, the expression quantitative molecular label is 4-10 any bases (N bases).At one In further preferred embodiment, the expression quantitative molecular label is 6 any bases (NNNNNN).

The label effect of expression quantitative molecular has at 2 points：

1) by taking 6 N bases as an example, it, which is optionally combined, produces 4096 kinds of variants, and same gene is marked with 4096 kinds of variants Transcript, cooperation interrupt structure library mode, you can obtain the expression quantity absolute quantitation value of the gene.

2) label specific can only be added in the chains of cDNA bis-, coordinate biological data analysis, can obtain transcriptional orientation.

The invention further relates to a kind of method in construction cDNA library, wherein using by above-mentioned unicellular mRNA reverse transcriptions with The cDNA that amplification method obtains builds library.

The invention further relates to a kind of method to this absolute quantitation of Intracellular transcription, including：

Library using the inventive method structure is sequenced, it is fixed comprising MALBAC primer sequences+expression then to find out Amount molecular label+GGG adds the Reads of part transcript sequence, and by part transcript sequence, its specific comparison is arrived into base Because upper, the variant number of the expression quantitative molecular label is then analyzed, such as a certain variant occurs multiple, then thinks the feelings Condition comes from the Duplication in PCR amplifications, is counted as 1, the variant number after duplicate removal, as expression quantity absolute quantitation value.

Beneficial effect：

The present invention can be by the extracted eucaryote total serum IgE of 1-2000 cell or 10pg-20ng within 5-6 hours Starting, reverse transcription is carried out to wherein mRNA in the presence of reverse transcriptase and obtains the chains of cDNA first, then with template switch skill Art adds one section of joint sequence (with expression quantitative molecular label) at cDNA 3 ' ends and carries out the generation of the chains of cDNA bis-, then with Joint section is that primer anchored site carries out exponential amplification, and the high quality that downstream analysis or library construction requirement are met with acquisition is complete Long cDNA.This invention effectively prevent the pollution of 3 ' Preferences and genomic DNA and rRNA in cDNA building-up processes, and expression is fixed Measure molecular label can auxiliary gene expression quantity calculate, while completely amplification mRNA sequence information while the expression quantitative molecular Label can also retain chain source-information.Generally, it is complete depending on input amount can to amplify 20-500ng high quality for a reaction Long double-strand cDNA.The present invention can obtain more than 95% reverse transcription and amplification success rate, and the cDNA amplified productions of total length can be seamless It is connected main flow microarray dataset, such as Illumina, Ion torrent, PGM, Ion Proton sequenators, lower machine data (5M Reads more than 90% gene expression) is can detect, gene expression uniformity is expanded without obvious bias more than 90%, and is needed Sample input amount it is less.

The present invention is to study the strong instrument of gene expression in individual cell level, is greatly expanded answering for RNA-Seq With scope, through reverse transcription of the present invention and the cDNA amplified, it can be used as expression analysis (individual cells), the embryo of denier sample Early development research, the heterogeneous Journal of Sex Research of tumour cell, immunocyte group research, stem cell differentiation research.

Brief description of the drawings

Fig. 1 is Smart-Seq1 method schematic diagrams.

Fig. 2 is Smart-Seq2 method schematic diagrams.

Fig. 3 is to carry out reverse transcription to mRNA in the presence of reverse transcriptase using reverse transcription joint of the present invention and obtain cDNA The schematic diagram of first chain.

Fig. 4 is the schematic diagram that the chains of cDNA second are obtained using the template switch oligonucleotide of the present invention.

Fig. 5 is the yield and the testing result (A) and negative control (B) of fragment distribution of cDNA amplified productions.

Fig. 6 is that the result for preparing the fragment length distribution in DNA library is detected with agarose gel electrophoresis.L：DNA Ladder；S：Library is built using 200ng cDNA, magnetic bead carries out result after selection recovery.

Fig. 7 is the knot that the fragment length distribution in DNA library is prepared with Agilent 2100Bioanalyzer detections Fruit.

Fig. 8 is to be expanded using Smart-seq2 methods and carry out Agilent to cDNA amplified productions The result of 2100Bioanalyzer detections, 20ng Input, 10ng Input, 5ng Input, 2.5ng Input, 1ng Input, 500pg Input, 250pg Input, 125pg Input, 25pg Input and No RNAinput represent reaction respectively RNA input amount in system, Water represent pure water control group.

Fig. 9 is to be expanded using the inventive method and carry out Agilent 2100Bioanalyzer inspections to cDNA amplified productions The result of survey, 20ng Input, 10ng Input, 5ng Input, 2.5ng Input, 1ng Input, 500pg Input, 250pg Input, 125pg Input, 25pg Input and No RNAinput represent the input amount of RNA in reaction system respectively, Water represents pure water control group.

Embodiment

Further to illustrate the technological means and its effect of the invention taken, enter one below by way of specific embodiment Step explanation technical scheme, but the present invention is not limited in scope of embodiments.

Embodiment 1 obtains unicellular (or few cells) total serum IgE

1. provide the cell (even culture medium) of a adherent growth on Tissue Culture Flask.This method chooses human lymphocyte GM12878 is that material carries out subsequent experimental.

2. the culture medium in Tissue Culture Flask described in step 1 is fallen off, abandon.Add 5mL 1x PBS (following PBS Refer both to 1 × PBS) buffer solution, cleans twice, then falls off the liquid after cleaning, abandon.By pancreatin with super Pure water is diluted to 0.25% concentration, adds 3mL into blake bottle, gently rotates, and liquid is uniformly stained with bottle inwall, 37 DEG C of processing 3 minutes, after incubation terminates, bottleneck is held, with the strength gently liquid in shake flask of wrist, liquid is suctioned out with liquid-transfering gun and put It is standby in 15mL centrifuge tubes.

3. the liquid obtained by step 2 is connected into centrifuge tube, it is placed in a centrifuge, at room temperature with 12,000rpm rotating speeds, centrifugation 1 Minute, supernatant is abandoned, obtains cell precipitation；1x PBSs are added in cell precipitation, form cell suspension.

4. the operation in repeat step 32 times, culture medium and pancreatin raffinate are cleaned, according to gained cell quantity, is added as one sees fit 1x PBSs carry out gradient dilution, often dilute once, and all taking-up 2uL, which is placed on slide, observes cell quantity, until most Cell suspension of the density for~20 cells per μ L is obtained eventually.

5. the cell suspension 5uL of the gained of aspiration step 4, is placed on slide, taken with mouth suction pipe choose it is unicellular.

6. will be obtained by step 5 it is unicellular, be blown into that (cell cracks containing 4 μ L Cell Lysis Buffer with mouth suction pipe Liquid) PCR pipe in formed treat lysed sample.

7. 13.3*N μ L RT Buffer (RT Buffer) are placed in PCR pipe, (N is the quantity of reaction, pays attention to adding Enter 10% liquid relief loss)；The reverse transcription joint and template switch of particular design of the present invention are included in the RT Buffer Oligonucleotides and dNTP.

8. will treat that lysed sample and RT Buffer are respectively placed in and be preheating in 72 DEG C of PCR instrument, hot lid temperature setting is 105 DEG C, it is incubated 3 minutes, is immediately placed on after taking-up on 0 DEG C of program temperature reduction box (ice chest), stands 2.5 minutes.

The reverse transcription of embodiment 2 obtains double-stranded full-length cDNA

1. draw 1.7*N (N is the quantity of reaction, pays attention to adding 10% liquid relief loss) μ L reverse transcriptase mixed liquor (component name：RT Enzyme Mix) it is added in the RT Buffer obtained by the step 8 of embodiment 1, mix, centrifuge manually, formed Mixture is labeled as " RT Mix ".

Wherein described reverse transcriptase mixed liquor contains reverse transcriptase, reverse transcriptase protective agent, BSA, RNase inhibitor.

The reverse transcription joint is in * GTGAGTGATGGTTGAGGTAGTGTGGAGTTTTTTTTTTTTTTTTTTTTTTT TTTTTTT(SEQ ID NO:2, * represent to be closed by C18 carbon skeletons).

The template switch oligonucleotide is

#GTGAGTGATGGTTGAGGTAGTGTGGAGNNNNNNrGrGLNA-G(SEQ ID NO:3, # represent by NH₂-C6 Closing).

2. into the cell lysed sample obtained by the step 8 of embodiment 1, add 15 μ L " RT Mix ", after brief centrifugation immediately It is placed on ice, reverse transcription is carried out in PCR instrument, obtain reverse transcription product solution, condition is as follows：

3. 30 μ L PCR Mix (PCR amplification mixtures) are added in reverse transcription product (now liquor capacity is 50 μ L),

Expanded in PCR instrument, reaction condition is as follows：

The amplified production of embodiment 3 detects

Step 1：Purifying

1) amplified production is transferred in 1.5mL centrifuge tubes, 0.8 × (40uL) Ampure XP magnetic beads is taken, with amplified production 10min is stood after mixing；

2) upper step is stood to the 1.5mL centrifuge tubes finished to be placed on magnetic frame, treats that magnetic bead is all adsorbed onto on tube wall (about 5min), inhaled with 200uL liquid-transfering guns and abandon supernatant, 80% ethanol then newly prepared with 200uL cleans magnetic bead twice, abandons supernatant；

3) be stored at room temperature 5min, after magnetic bead drying (please note should not overdrying cause magnetic bead to ftracture, in order to avoid influence back Produce effects rate), magnetic bead is resuspended with 17.5uL Elution Buffer or stoning sour water；

4) centrifuge tube is placed on magnetic frame after being stored at room temperature 5min, draws 15uL supernatants, this supernatant finishes for amplification The double-strand cDNA purified afterwards.

Step 2：The yield of cDNA amplified productions detects with fragment distribution

The yield of cDNA amplified productions is to judge its whether qualified important indicator with fragment distribution, and Agilent can be used 2100Bioanalyzer is detected.(500pg/ is typically diluted to after taking the rationally dilution of the cDNA amplified productions of 1 μ l after purification UL), detected using Agilent 2100Bioanalyzer and High Sensitivity DNAChip, operating instruction is shown in High Sensitivity DNAChip operation manuals.Generally, it is different according to the starting template used, successfully reaction Output 20-500ng amplified productions, are distributed in 400-10000bp, and the peak value of amplified production is located at 2000bp or so.As a result figure is seen Shown in 5A.Fig. 5 B are without Template-negative controls (no product).

The unicellular mRNA reverse transcriptions of embodiment 4 interrupt with amplified production (cDNA) fragment

It is Covaris M220DNAShearing steps below：

Start checks

1. check whether the connection of the computer being fixed at the top of machine and machine is appropriate.

2. confirm that water pond (Drip Tray) is placed below machine.

3. insertion operation pipe holder (Tube Holder)

Water-bath is set

1. it will operate and slide counterweight (Sliding Weight) pull-up and rotation 90 at the top of pipe holder (Tube Holder) ℃。

2. about 15ml distilled water or deionized water are added into carriage center with random water bottle (wash bottle), water level arrives Reach or be advisable more than operation mark (" RUN " marker).

Sample is placed

2. being put into sample cell, rotate and put down and slide counterweight, be pressed against sample cell, be then shut off safety door.

3. start:Instrument host is first opened, is then turned on computer and software.

Parameter setting

1. clicking on the Method at software Run interfaces, edited Method information is shown in drop-down menu, can be carried out Method select, click on New it is newly-built or in lists select an existing operating method after point Edit edit.

2. relevant parameter is set according to the length of the sample purpose fragment to be interrupted.Design parameter refers to following table：

Ultrasound interrupts pipe 50ul sample object length 150bp to 800bp

Ultrasound interrupts pipe 50ul sample object length 150bp to 1500bp

Operation program

" Run " button, operation program are clicked at Run interfaces.

Close software and machine

1. empty water-bath with supporting syringe；If water pond (Drip Tray) has water, it need to outwell and be dried with blotting paper.

2. closing software, instrument host is then shut off, finally closes computer.

The cDNA library construction step of embodiment 5

CDNA after interrupting is used for library construction step, it is that rapid DNA is sequenced generation in century two to build that library construction, which chooses health, Storehouse kit (Illumina) catalog number (Cat.No.)：CW2585S(24 rxns).

Repair reaction in step 1 DNA ends

1. following reagent is added into 200ul PCR pipes：

Reagent name	Volume
		○10x End Repair Reaction Buffer	3.25μl
○End Prep Enzyme Mix	1μl
		Fragmented cDNA	X(5ng-1ug)
RNase-free Water	Up to 32.5μl

2. with the pipette tips gently above-mentioned solution of pressure-vaccum, of short duration centrifugation, all components are made to be collected into ttom of pipe.

3. above-mentioned PCR pipe is placed in PCR instrument, heat lid is opened, and response procedures are as follows：

Step 2 Adaptor connections

It is preferred that being attached using health for adaptor, the adaptor using NEB, illumina company, tool also may be selected Body connection method refers to the products instruction of each company.It using health is that adaptor (catalog number (Cat.No.) CW2586) enters to be below The operating procedure of row connection：

1. it is directly added into following reagent into the above-mentioned reaction solution for having completed the reparation of DNA ends

Reagent name	Volume
		○T4DNA ligase buffer	7μl
○T4DNA ligase	1μl
		Adaptor	1.25μl

Now overall solution volume is 41.75ul in pipe.

Pay attention to：If original samples amount is less than 100ng, adaptor deionized waters are please diluted 10 times to making after 1.5uM With.

2. being mixed mentioned reagent pressure-vaccum with pipette tips, of short duration centrifugation, solution is set to be collected into ttom of pipe.

3. 20 DEG C of warm bath 15 minutes.

Pay attention to：If this operates with PCR instrument, please heat lid is closed.

The selective recovery of step 3 DNA fragmentation

It is recommended that carry out DNA fragmentation selectivity using hundred million health paramagnetic particle method DNA purifying reclaim reagents (catalog number (Cat.No.) KT110700596) Recovery.

Pay attention to：DNA fragmentation selective recovery is optional step, if original samples amount is less than 50ng, it is not recommended that carries out DNA pieces Section selective recovery, directly carries out the purifying of DNA fragmentation.When building different size of library in addition, DNA fragmentation selective recovery Magnetic bead usage amount it is different, specific magnetic bead dosage can refer to subordinate list 1 and (if using the magnetic bead of the producer in addition to hundred million health, need to voluntarily touch The optimal magnetic bead dosage of rope).

In following operating procedure, it is 320bp (Insert Fragment length 200bp) that recovery DNA fragmentation length peak value, which may be selected, instead It is 50ul to answer initial volume.

1. the vortex oscillation CMPure20 seconds, it is set thoroughly to mix as uniform solution.

2. adding 8.25 μ l deionized waters into coupled reaction liquid, make adaptor coupled reaction buffer solution volumes to 50ul.

3. above-mentioned adaptor reaction buffers are transferred in a new 1.5ml centrifuge tubes.

4. add the well mixed CMPure of 35 μ l, gently inhaled with pipettor and make a call to more than 10 times and mix, be stored at room temperature 5 points Clock.

5. of short duration centrifugation, centrifuge tube is placed on magnetic frame, separate magnetic bead and supernatant solution, until solution clarification is (about Need 5 minutes), carefully supernatant solution is transferred in new 1.5ml centrifuge tubes, and discard magnetic bead.

Pay attention to：Should not reject supernatant.

6. add the well mixed CMPure of 10 μ l into supernatant, gently inhaled with pipettor and make a call to more than 10 times and mix, room temperature Stand 5 minutes.

7. of short duration centrifugation, centrifuge tube is put on magnetic frame, separate magnetic bead and supernatant solution, until solution clarification is (about Need 5 minutes), it is careful to draw supernatant and reject, during which avoid contact with the magnetic bead of combining target DNA.

Pay attention to：Should not reject magnetic bead.

8. continuing to keep centrifuge tube to be fixed on magnetic frame, 80% ethanol that 200 μ l are newly configured, room are added into centrifuge tube Temperature is placed 30 seconds, careful reject supernatant.

9. repeat step 8 is twice.

10. keeping centrifuge tube to be fixed on magnetic frame, it is stored at room temperature 10 minutes, magnetic bead is dried in atmosphere.

11. centrifuge tube is kept to be fixed on magnetic frame, to magnetic bead surfaces plus 14 μ l EB or deionized water (providing for oneself), with shifting Liquid device, which is gently inhaled, makes a call to 10 mixing magnetic beads, magnetic bead is fully resuspended in eluent rear room temperature and places 5 minutes.

12. of short duration centrifugation, centrifuge tube is put on magnetic frame until solution clarification (about needing 5 minutes), 11.5ul is eluted Liquid is transferred in a new 0.2mL PCR pipe；

Pay attention to：Magnetic bead is not shifted necessarily, and micro magnetic bead pollution can influence being normally carried out for follow-up PCR reactions.

Magnetic bead suggests dosage during different fragments selection recovery

Step 4 PCR is expanded

1 adds following reagent and mixes in PCR pipe

Reagent name	Volume
		Connect the DNA fragmentation after adaptor	11.5μl
○HiFidelity 2X PCR Master Mix	12.5μl
		○Universal primer	0.5μl
○Index primer^*	0.5μl

^*Two generations sequencing multisample adapter-primer kit (the catalog number (Cat.No.) CW2587M that health is century can be used directly； CW2586M)

2PCR reaction conditions

Pay attention to：It is recommended that PCR cycle number is 6 cycles during 1ug sample initial amounts, when 10 cycles during 50ng, 5ng 14-15 cycles, PCR cycle number can also optimize according to experiment needs.

The purifying of step 5 PCR primer

1. carried out using hundred million health paramagnetic particle method DNA purifying reclaim reagents (catalog number (Cat.No.) KT110700596).Vortex oscillation The CMPure20 seconds, it is set thoroughly to mix as uniform solution.

2. PCR reaction solutions are transferred in a new 1.5ml centrifuge tubes.

3. adding the CMPure of 1 times of sample volume, gently inhaled with pipettor and make a call to more than 10 times and mix, be stored at room temperature 5 minutes.

4. of short duration centrifugation, centrifuge tube is put on magnetic frame, separate magnetic bead and supernatant solution, until solution clarification is (about Need 5 minutes).It is careful to draw supernatant and reject, during which avoid contact with the magnetic bead of combining target DNA.

Pay attention to：Should not reject magnetic bead.

5. continuing to keep centrifuge tube to be fixed on magnetic frame, 80% ethanol of the 200 fresh configurations of μ l is added into centrifuge tube, Room temperature is placed 30 seconds, careful reject supernatant.

6. repeat step 5.

7. keeping centrifuge tube to be fixed on magnetic frame, it is stored at room temperature 10 minutes, magnetic bead is dried in atmosphere.

8 holding centrifuge tubes are fixed on magnetic frame, to magnetic bead surfaces plus 30 μ l EB or deionized water (providing for oneself), use liquid relief Device, which is gently inhaled, makes a call to 10 mixing magnetic beads, magnetic bead is fully resuspended in eluent rear room temperature and places 5 minutes.

9 of short duration centrifugations, centrifuge tube is put on magnetic frame until solution clarification (about needing 5 minutes), eluent is transferred to About 25ul in one new PCR pipe, DNA library is in -20 DEG C of preservations.

The Library Quality of embodiment 6 detects

1 library concentration

In order to obtain the sequencing result of high quality, it is necessary to carry out accurate quantification to DNA library, recommend first Realtime PCR methods carry out absolute quantitation to DNA library.In addition, fluorescent dye determination also can be used, such as Qubit methods or fluorescence Dyestuff Picogreen methods, please don't use the quantitative approach based on absorbance measuring herein.Following approximate formula finally can be used to change Calculate the molar concentration of DNA library.

2 library distribution of lengths

The DNA library prepared can use agarose gel electrophoresis or Agilent 2100Bioanalyzer detection DNA libraries In fragment length distribution.As a result Fig. 6 and Fig. 7 are seen.

The upper machine of the sequencing of embodiment 7 (data volume is 5M reads)

Library is sequenced using the sequenators of HiSeq 2500, machine beats testing result and see the table below 1：

Table 1

Embodiment 8 expresses absolute quantitation

Find out and add part transcript sequence comprising GTGAGTGATGGTTGAGGTAGTGTGGAGACATNNNNNNGGG Reads, by part transcript sequence, by its specific comparison to gene, 6N variant number is then analyzed, such as 6N A certain variant occurs multiple, then thinks that the situation comes from the Duplication in PCR amplifications, is counted as 1, after duplicate removal Variant number, as expression quantity absolute quantitation value.

The mouse brain cell total rna of embodiment 9 carries out reverse transcription with situation is sequenced after amplification

The step described in embodiment 1-7 is repeated using mouse brain cell total rna, machine beats sequencing result and see the table below 2：

Table 2

The inventive method of embodiment 10 builds the contrast of the sequencing result in storehouse with the amplification of Smart-seq2 methods

A. mouse brain cell total rna is built into storehouse using the amplification of Smart-seq2 methods and be sequenced, as a result such as Fig. 8 and following machine Shown in type tables (table 3).

Table 3

According to Fig. 9 as can be seen that zigzag miscellaneous peak is excessive, display non-specific amplification is excessive；Main peak unobvious, display are complete Long cDNA is very few, i.e., template switch is inefficient.

And it can be seen from upper table, Clean rate are very low, illustrate that non-specific amplification or Overlap PCR are excessive.

B. mouse brain cell total rna is built into storehouse using the inventive method amplification and be sequenced, as a result as Fig. 9 and following machine play table Shown in lattice (table 4).

Table 4

According to Fig. 9 as can be seen that zigzag miscellaneous peak disappears, display non-specific amplification disappears；Main peak is obvious, shows total length CDNA is more, i.e. template switch efficiency high.

And it can be seen from upper table, Clean rate are higher, illustrate that non-specific amplification or Overlap PCR are not sent out substantially It is raw.

Applicant states that the present invention illustrates the method detailed of the present invention, but not office of the invention by above-described embodiment It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implemented.Art Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention Addition, selection of concrete mode etc., within the scope of all falling within protection scope of the present invention and disclosing.

Sequence table

<110>The Co., Ltd of health medical test institute of Shanghai hundred million

<120>A kind of unicellular mRNA reverse transcriptions and the method for amplification

<130> PYS201711681EC

<141> 2017-11-16

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 27

<212> DNA

<213>Artificial sequence ()

<400> 1

gtgagtgatg gttgaggtag tgtggag 27

<210> 2

<211> 57

<212> DNA

<213>Artificial sequence ()

<220>

<221> misc_feature

<222> (1)

<223>5 ' hold and are closed by C18 groups

<400> 2

gtgagtgatg gttgaggtag tgtggagttt tttttttttt tttttttttt ttttttt 57

<210> 3

<211> 36

<212> DNA

<213>Artificial sequence ()

<220>

<221> misc_feature

<222> (1)

<223>5 ' hold and are closed by NH2-C6 groups

<220>

<221> misc_feature

Claims

1. a kind of unicellular mRNA reverse transcriptions and amplification method, including：

1) crack unicellular or denier cell and obtain total serum IgE

2) reverse transcription is carried out to mRNA in the presence of reverse transcriptase using reverse transcription joint and obtains the chains of cDNA first；

Wherein described reverse transcription joint is the end of MALBAC primer sequences 3 ' plus 15-40 T base, and base is closed in 5 ' ends with hydrophobic property Group's modification；

3) acquisition the chains of cDNA first 3 ' ends independent of template, add 2-5 C nucleotide；

4) cDNA obtained using step 3) is template, using template switch oligonucleotide in reverse transcriptase using DNA as template Polymerization activity under carry out the generation of cDNA bis- chains；

The template switch oligonucleotide is that the end of MALBAC primer sequences 3 ' order adds 1-4 ribose guanosine and a LNA guanosine, And do Seal treatment at 5 ' ends with hydrophobic property blocking groupses；

5) after the generation of the second chain, amplification is carried out with MALBAC primers and obtains cDNA.

2. according to the method for claim 1, wherein the reverse transcriptase is selected from Invitrogen^TMCompany SuperScript^TMII Reverse Transcriptase or Invitrogen^TMCompany SuperScript^TMIII Reverse Transcriptase、Thermo Scientific^TMCompany Maxima H Minus Reverse Transcriptase、RevertAid H Minus Reverse Transcriptase。

3. method according to claim 1 or 2, wherein the hydrophobic property blocking groupses are selected from C18 carbon skeletons, C6 carbon bones Frame, NH2-C6, NH2-C12, Biotin, Biotin-TEG, Dual biotin.

4. according to the method described in claim any one of 1-3, wherein the reverse transcription joint is held for MALBAC primer sequences 3 ' Add 30 T bases, 5 ' ends are modified with C18 carbon skeletons.

5. according to the method described in claim any one of 1-4, wherein the template switch oligonucleotide is MALBAC primer sequences The end of row 3 ' order plus 2 ribose guanosines and a LNA guanosine, and Seal treatment is done with NH2-C6 at 5 ' ends.

6. according to the method described in claim any one of 1-5, wherein the MALBAC primer sequences are GTGAGTGATGGTTGAGGTAGTGTGGAG。

7. according to the method described in claim any one of 1-6, wherein the template switch oligonucleotide is in MALBAC primer sequences Also include expression quantitative molecular label between row and the ribose guanosine of addition, the expression quantitative molecular label is 4-10 any Base.

8. according to the method for claim 7, wherein the expression quantitative molecular label is 6 any bases.

9. a kind of method in construction cDNA library, wherein by the cDNA that is obtained by any one of claim 1-8 methods described come Build library.

10. a kind of method to this absolute quantitation of Intracellular transcription, including：

After the library sequencing of claim 9, find out and add comprising MALBAC primer sequences+expression quantitative molecular label+GGG The Reads of part transcript sequence, by part transcript sequence, by its specific comparison to gene, then analyze institute The variant number of expression quantitative molecular label is stated, such as a certain variant occurs multiple, then think that the situation comes from PCR amplifications In Duplication, be counted as 1, the variant number after duplicate removal, as expression quantity absolute quantitation value.