CN114317732B - Composition for lung cancer screening and application thereof - Google Patents
Composition for lung cancer screening and application thereof Download PDFInfo
- Publication number
- CN114317732B CN114317732B CN202110627263.5A CN202110627263A CN114317732B CN 114317732 B CN114317732 B CN 114317732B CN 202110627263 A CN202110627263 A CN 202110627263A CN 114317732 B CN114317732 B CN 114317732B
- Authority
- CN
- China
- Prior art keywords
- gene
- methylation
- composition
- target sequence
- nxph1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application discloses a composition for lung cancer screening and application thereof. The composition for lung cancer screening comprises a nucleic acid for detecting methylation of a target sequence of a NXPH1 gene. The application discovers a methylation gene related to lung cancer, determines a target sequence of methylation abnormality of the methylation gene of the lung cancer, can sensitively and specifically detect the methylation state of the gene through the target sequence of the methylation gene, so that the methylation gene can be used for detecting free DNA of peripheral blood, and the composition can be used for screening asymptomatic people in a non-invasive way, so that the hazard caused by invasive detection is reduced, and the composition has higher sensitivity and accuracy and can realize real-time monitoring.
Description
Technical Field
The application relates to the technical field of biology, in particular to a composition for lung cancer screening and application thereof.
Background
Lung cancer is one of the cancers with the highest global morbidity and mortality. In China, the incidence rate and death rate of lung cancer are also the first. Conventional means of screening for lung cancer are, in addition to low dose helical CT (LDCT), some protein markers such as: carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCC), neuron-specific enolase (NSE), and the like. However, these approaches are not very sensitive or specific. Currently, DNA methylation has been demonstrated to be tissue specific, useful in cancer detection, and can be traced to the primary tumor site based on the methylation profile of circulating tumor DNA (ctDNA).
Disclosure of Invention
The application aims to provide a composition for lung cancer screening, which comprises nucleic acid for detecting target sequence methylation of NXPH1 genes, is used for screening asymptomatic people in a non-invasive way and for prognosis detection of cancer patients, reduces harm caused by invasive detection, has higher sensitivity and accuracy, and can realize real-time monitoring.
The specific technical scheme of the application is as follows:
1. a composition for lung cancer screening, the composition comprising a nucleic acid for detecting methylation of a target sequence of a NXPH1 gene.
2. The composition according to item 1, wherein the nucleotide sequence of the target sequence of the NXPH1 gene is shown in SEQ ID NO. 1.
3. The composition of item 1 or 2, wherein the nucleic acid for detecting methylation of a target sequence of a NXPH1 gene comprises a probe composition for hybridization with the target sequence of the NXPH1 gene.
4. The composition of item 3, wherein the probe composition comprises a hypermethylated first probe composition for hybridization to a bisulfite converted CG hypermethylated region and a hypomethylated second probe composition for hybridization to a bisulfite converted CG hypomethylated region.
5. The composition of item 4, wherein the first probe composition comprises n probes that hybridize to each nucleotide of the sense and antisense strands of the bisulfite converted CG hypermethylated region.
6. The composition of item 4, wherein the second probe composition comprises m probes that hybridize to each nucleotide of the sense and antisense strands of the bisulfite converted CG hypomethylated region.
7. The composition according to item 5 or 6, wherein n and m are each any integer from 1 to 10.
8. The composition according to item 7, wherein x is between the (n-1) th probe and the (n) th probe 1 Overlapping of nucleotides, preferably x 1 Is any integer from 0 to 100;
preferably, there is x between the m-1 th probe and the m-th probe 2 Overlapping of nucleotides, preferably x 2 Is any integer from 0 to 100.
9. The composition of any one of claims 4-8, wherein the first probe composition comprises a nucleotide sequence as set forth in SEQ ID NOs 2-7; the second probe composition comprises a nucleotide sequence as shown in SEQ ID NO. 8-13.
10. The composition of item 1 or 2, wherein the nucleic acid for detecting methylation of a target sequence of the NXPH1 gene comprises:
a primer that is a fragment of at least 9 nucleotides in a target sequence of the NXPH1 gene, the fragment comprising at least one CpG dinucleotide sequence.
11. The composition of any one of items 1-2 and 10, wherein the nucleic acid for detecting target sequence methylation of the NXPH1 gene comprises:
a probe that hybridizes under moderately stringent or stringent conditions to at least 15 nucleotide fragments in a target sequence of the NXPH1 gene, said fragments comprising at least one CpG dinucleotide sequence.
12. The composition of any one of items 1-2 and 10-11, further comprising an agent that converts an unmethylated cytosine base at position 5 of the target sequence of the NXPH1 gene to uracil.
13. The composition of any one of items 1-2 and 10-12, wherein the nucleic acid for detecting target sequence methylation of the NXPH1 gene further comprises:
blocking agents that preferentially bind to target sequences in the unmethylated state.
Use of the nxph1 gene in the preparation of a kit for lung cancer screening.
15. A kit comprising the composition of any one of claims 1-13.
16. Use of the composition of any one of claims 1-13 in the manufacture of a kit for lung cancer screening.
17. A chip comprising the composition of any one of claims 1-9.
ADVANTAGEOUS EFFECTS OF INVENTION
The inventor of the present application has found a methylation gene related to lung cancer by analyzing whole genome methylation data of lung cancer using epigenomic and bioinformatics techniques, and has determined a target sequence of methylation abnormality of the methylation gene of lung cancer, and can sensitively and specifically detect the methylation state of the gene by the target sequence of the methylation gene, thereby being useful for detecting free DNA of peripheral blood.
The composition is used for screening asymptomatic people in a non-invasive mode, reduces the harm caused by invasive detection, has higher sensitivity and accuracy, and can realize real-time monitoring.
Detailed Description
The present application will be described in detail below. While specific embodiments of the application are shown, it should be understood that the application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the application to those skilled in the art.
It should be noted that certain terms are used throughout the description and claims to refer to particular components. Those of skill in the art will understand that a person may refer to the same component by different names. The specification and claims do not identify differences in terms of components, but rather differences in terms of the functionality of the components. As referred to throughout the specification and claims, the terms "include" or "comprising" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth a preferred embodiment for practicing the application, but is not intended to limit the scope of the application, as the description proceeds with reference to the general principles of the description. The scope of the application is defined by the appended claims.
The present application provides a composition for lung cancer screening comprising a nucleic acid for detecting methylation of a target sequence of a NXPH1 gene.
Methylation refers to methylation of the 5 th carbon atom on cytosine in CpG dinucleotides, and is taken as a stable modification state, and can inherit new generation progeny DNA along with the replication process of DNA under the action of DNA methyltransferase, so that the methylation of the gene promoter region can lead to silence transcription of cancer suppressor genes during DNA methylation, and the methylation is closely related to tumor occurrence. Aberrant methylation includes hypermethylation of cancer suppressor genes and DNA repair genes, hypomethylation of repeated sequence DNA, imprinting loss of certain genes, which are associated with the occurrence of a variety of tumors.
In one embodiment, the nucleotide sequence of the target sequence of the NXPH1 gene is shown in SEQ ID NO. 1.
The nucleotide sequence of SEQ ID NO. 1 is as follows:
AAGGCCATTTTCCTTCGTCTTCTACAAGAAGCAAGAAACTTTTTTCGACGTAGGCTTCATACCCTCCCTTCGGAAACTCAGTCCGCTGACCAAAGCCGCAGTGTTCAGGCCCCGGGGTTTCCCAGCCGTAGTGGCCGCCGCCACAGCTGCGCGCTTTATTGTCTGCTTTCAGTCGCAGGTGACCTCGA
in one embodiment, the nucleic acid for detecting methylation of a target sequence of a NXPH1 gene comprises a probe composition for hybridization with the target sequence of the NXPH1 gene.
The probe is single-stranded or double-stranded DNA with a length of tens to hundreds or even thousands of base pairs, which can utilize the denaturation, renaturation and high precision of base complementary pairing of molecules, and can be combined with (hybridized with) complementary unlabeled single-stranded DNA or RNA in a sample to be tested in a hydrogen bond manner to form a double-stranded complex (hybrid). After washing off the unpaired and bound probe, the hybridization reaction results can be detected by a detection system such as an autoradiography or an enzyme-linked reaction. In the present application, the region that complementarily binds or hybridizes to the probe is a specific target region. Multiple probes are combined into a probe composition.
In one embodiment, the probe composition comprises a hypermethylated first probe composition for hybridization to a region of bisulfite converted CG hypermethylation and a hypomethylated second probe composition for hybridization to a region of bisulfite converted CG hypomethylation.
In one embodiment, the first probe composition comprises n probes that hybridize to each nucleotide of the sense and antisense strands of the bisulfite converted CG hypermethylated region.
The second probe composition includes m probes that hybridize to each nucleotide of the sense and antisense strands of the bisulfite converted CG hypomethylated region.
The number of probes in the first probe composition and the second probe composition is not limited in any way, and for example, m and n may be any integer of 1 to 10, and m and n may be the same or different.
For example, m and n may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10.
In one embodiment, there is x between the n-1 th probe and the n-th probe 1 Overlapping of nucleotides, preferably x 1 Is any integer from 0 to 100;
preferably, there is x between the m-1 th probe and the m-th probe 2 Overlapping of nucleotides, preferably x 2 Is any integer from 0 to 100.
Wherein x is 1 And x 2 May be the same or different, when x 1 When 0, the tail of the n-1 th probe is linked to the head of the n-th probe, and similarly, when x 2 At 0, the tail of the m-1 th probe is shown attached to the head of the m-th probe.
According to the application, the probe composition is hybridized with the target sequence converted by the bisulfite, wherein the hypermethylated first probe composition is hybridized with the CG hypermethylated region, and the hypomethylated second probe composition is hybridized with the CG hypomethylated region, so that the methylation level of the target sequence can be detected efficiently and accurately, and the probe composition can be further used for lung cancer screening.
In one embodiment, the hypermethylated first probe composition comprises a nucleotide sequence as set forth in SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7.
The nucleotide sequence shown in SEQ ID NO. 2 is as follows:
AAAAAAAAATATAAAACCTACGTCGAAAAAAATTTCTTACTTCTTATAAAAAACGAAAAAAAATAACCTTTTAAAATCAATATATAAAAACGAAATCTAAAACATAAAATAAAATATATA
the nucleotide sequence shown in SEQ ID NO. 3 is:
CACACATCCCACCCTATATCTTAAACCCCGTCCTCACACATTAACTTTAAAAAACCATTTTCCTTCGTCTTCTACAAAAAACAAAAAACTTTTTTCGACGTAAACTTCATACCCTCCCTT
the nucleotide sequence shown in SEQ ID NO. 4 is:
ACAACTATAACGACGACCACTACGACTAAAAAACCCCGAAACCTAAACACTACGACTTTAATCAACGAACTAAATTTCCGAAAAAAAAATATAAAACCTACGTCGAAAAAAATTTCTTAC
the nucleotide sequence shown in SEQ ID NO. 5 is:
ACAACTATAACGACGACCACTACGACTAAAAAACCCCGAAACCTAAACACTACGACTTTAATCAACGAACTAAATTTCCGAAAAAAAAATATAAAACCTACGTCGAAAAAAATTTCTTAC
the nucleotide sequence shown in SEQ ID NO. 6 is:
AAAAAAACTACATCTATATTTCCATAAACCTATCGAAATCGCTCGAAATCACCTACGACTAAAAACAAACAATAAAACGCGCAACTATAACGACGACCACTACGACTAAAAAACCCCGAA
the nucleotide sequence shown in SEQ ID NO. 7 is:
CCCGAAATTTCCCAACCGTAATAACCGCCGCCACAACTACGCGCTTTATTATCTACTTTCAATCGCAAATAACCTCGAACGATCTCGACAAATTTATAAAAACACAAATACAACCCTCTC
the hypomethylated second probe composition comprises nucleotide sequences shown as SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12 and SEQ ID NO. 13.
The nucleotide sequence shown in SEQ ID NO. 8 is:
AAAAAAAAATATAAAACCTACATCAAAAAAAATTTCTTACTTCTTATAAAAAACAAAAAAAAATAACCTTTTAAAATCAATATATAAAAACAAAATCTAAAACATAAAATAAAATATATA
the nucleotide sequence shown in SEQ ID NO. 9 is:
CACACATCCCACCCTATATCTTAAACCCCATCCTCACACATTAACTTTAAAAAACCATTTTCCTTCATCTTCTACAAAAAACAAAAAACTTTTTTCAACATAAACTTCATACCCTCCCTT
the nucleotide sequence shown in SEQ ID NO. 10 is:
ACAACTATAACAACAACCACTACAACTAAAAAACCCCAAAACCTAAACACTACAACTTTAATCAACAAACTAAATTTCCAAAAAAAAAATATAAAACCTACATCAAAAAAAATTTCTTAC
the nucleotide sequence shown in SEQ ID NO. 11 is:
ACAAAAAACTTTTTTCAACATAAACTTCATACCCTCCCTTCAAAAACTCAATCCACTAACCAAAACCACAATATTCAAACCCCAAAATTTCCCAACCATAATAACCACCACCACAACTAC
the nucleotide sequence shown in SEQ ID NO. 12 is:
AAAAAAACTACATCTATATTTCCATAAACCTATCAAAATCACTCAAAATCACCTACAACTAAAAACAAACAATAAAACACACAACTATAACAACAACCACTACAACTAAAAAACCCCAAA
the nucleotide sequence shown in SEQ ID NO. 13 is:
CCCAAAATTTCCCAACCATAATAACCACCACCACAACTACACACTTTATTATCTACTTTCAATCACAAATAACCTCAAACAATCTCAACAAATTTATAAAAACACAAATACAACCCTCTC
in one embodiment, the nucleic acid for detecting methylation of a target sequence of a NXPH1 gene comprises:
a primer that is a fragment of at least 9 nucleotides in a target sequence of the NXPH1 gene, the fragment comprising at least one CpG dinucleotide sequence.
Wherein, if bisulfite is used to convert NDA in a sample to be tested, the nucleic acid for detecting methylation of the target sequence of the NXPH1 gene comprises a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the target sequence of the NXPH1 gene, said fragment comprising at least one CpG dinucleotide sequence.
In one embodiment, the nucleic acid for detecting methylation of a target sequence of a NXPH1 gene comprises:
a probe that hybridizes under moderately stringent or stringent conditions to at least 15 nucleotide fragments in a target sequence of the NXPH1 gene, said fragments comprising at least one CpG dinucleotide sequence.
In one embodiment, the composition further comprises an agent that converts an unmethylated cytosine base at position 5 of the target sequence of the NXPH1 gene to uracil, e.g., the agent can be bisulfite or the like.
In one embodiment, the nucleic acid for detecting methylation of a target sequence of a NXPH1 gene further comprises:
blocking agents that preferentially bind to target sequences in the unmethylated state.
The blocker is used for improving the amplification specificity of the PCR amplification primer, the 5 '-end of the blocker nucleotide sequence and the 3' -end nucleotide sequence of the forward or reverse primer have an overlapping region of more than or equal to 5 nucleotides, the blocker is complementary with the forward or reverse primer and the same strand of target gene target sequence DNA, the melting temperature of the blocker is higher than that of the forward or reverse primer by more than (including) 5 ℃, and the nucleotide sequence of the blocker comprises at least one CpG dinucleotide sequence and is complementary with the sequence of the target gene target sequence DNA which is not subjected to methylation after bisulfite conversion. Thus, when the genomic DNA of the biological sample to be detected is a mixture of methylated and unmethylated state, especially in the case where the DNA in the methylated state is far less than the DNA in the unmethylated state, the DNA in the unmethylated state is subjected to bisulfite conversion and then preferentially binds to the blocker, and thus the DNA template binds to the PCR obligation, and thus PCR amplification does not occur, whereas the DNA in the methylated state does not bind to the blocker, and thus the primer set, PCR amplification occurs, and then the fragment obtained by the amplification is detected directly or indirectly.
The application provides application of NXPH1 gene in preparing a kit for lung cancer screening.
The application provides a kit comprising the composition.
In one embodiment, the kit further comprises a container for holding a biological sample from a subject, the kit further comprising instructions for use and interpretation of the test results.
The biological sample may be peripheral blood whole blood, plasma or serum.
The present application is not limited in any way with respect to the method for detecting the methylation level of a target sequence using the above-described kit, and one skilled in the art can select according to need, for example, the present application provides a method for detecting the methylation level of a target sequence using the above-described kit, comprising the steps of:
collecting a sample of a subject;
extracting and purifying DNA in the sample;
constructing a DNA library for sequencing against the purified DNA sample;
transforming said constructed DNA library with bisulfite;
pre-PCR amplifying the bisulfite converted DNA library;
performing hybridization capture on the sample amplified by the pre-PCR by using the probe composition;
amplifying the hybridized and captured product by utilizing PCR;
performing high-throughput second-generation sequencing on the PCR amplified product after hybridization capture;
analyzing the sequencing data to determine the methylation level of the sample;
the patient's condition is interpreted based on the average methylation level of the sample, if the threshold value is exceeded 0.34 for a cancer sample and if it is below 0.34 for a healthy human sample.
Also for example, the present application provides a method for detecting the methylation level of a target sequence using the above-described kit, comprising the steps of:
(1) Extracting peripheral blood of a subject, and separating plasma or serum;
(2) Extracting free DNA from plasma or serum;
(3) Treating the free DNA obtained in step (2) with a reagent to convert the unmethylated cytosine base at position 5 to uracil or other bases, i.e., converting the unmethylated cytosine base at position 5 of the target sequence of the NXPH1 gene to uracil or other bases, the converted bases differing from the unmethylated cytosine base at position 5 in hybridization performance and being detectable;
(4) Contacting the free DNA treated in step (3) with a DNA polymerase and primers for the target sequence of the NXPH1 gene such that the target sequence of the treated NXPH1 gene is amplified to produce an amplified product or not; the target sequence of the treated NXPH1 gene, if subjected to DNA polymerization, produces amplification products; the target sequence of the treated NXPH1 gene is not amplified if DNA polymerization does not occur;
(5) Detecting the amplified product with a probe;
(6) Determining the methylation status of at least one CpG dinucleotide of the target sequence of the NXPH1 gene based on the presence or absence of the amplification product, thereby determining the methylation level of the target sequence of the NXPH1 gene.
The application provides application of the composition in preparation of a kit for lung cancer screening.
The application provides a chip which comprises the composition.
The sequencing principle of the chip, also called a gene chip, is a hybridization sequencing method, namely a method for determining the sequence of nucleic acid by hybridizing with a group of nucleic acid probes with known sequences, wherein probes with target nucleotides with known sequences are immobilized on the surface of a substrate. When the nucleic acid sequence TATGCAATCTAG with fluorescent mark in the solution is complementary matched with the nucleic acid probe at the corresponding position on the gene chip, a group of probe sequences with complete complementary sequences are obtained by determining the probe position with the strongest fluorescence intensity.
The chip is prepared by mainly taking a glass sheet or a silicon wafer as a carrier, and sequentially arranging oligonucleotide fragments or cDNA (complementary deoxyribonucleic acid) serving as probes on the carrier by adopting an in-situ synthesis and microarray method.
The chip is based on signal detection of DNA sequence hybridization after sulfite treatment, wherein unmethylated cytosine is changed into uracil, methylated cytosine is kept unchanged, uracil is then converted into thymine, and finally chip hybridization is carried out; finally, judging the type of the added base according to the fluorescence color, and further determining whether the locus is methylated.
Examples
The materials used in the test and the test methods are described generally and/or specifically in the examples which follow,% represents wt%, i.e. weight percent, unless otherwise specified. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.
EXAMPLE 1 screening of target sequences for detection of the NXPH1 Gene
Differential methylation sites in lung cancer tissues (case, 729) and paracancerous tissues (control, 320) were screened using 450k methylation chip data in the TCGA public database. Selecting sites with average value or median difference greater than 0.25 and P <0.01 in case-control by CHAMP (R package special for methylation 450K data analysis), and finally determining target sequence of NXPH1 gene for lung cancer screening by combining functional description of the gene, wherein the nucleotide sequence is shown as SEQ ID NO:1, and the nucleotide sequence is:
AAGGCCATTTTCCTTCGTCTTCTACAAGAAGCAAGAAACTTTTTTCGACGTAGGCTTCATACCCTCCCTTCGGAAACTCAGTCCGCTGACCAAAGCCGCAGTGTTCAGGCCCCGGGGTTTCCCAGCCGTAGTGGCCGCCGCCACAGCTGCGCGCTTTATTGTCTGCTTTCAGTCGCAGGTGACCTCGA
then, the threshold was determined to be 0.34 using a random forest model, and the sensitivity and specificity were 96.4% and 95.9%, respectively. Customizing a probe composition (panel) comprising a hypermethylated first probe composition and a hypomethylated second probe composition according to the obtained target sequence region, wherein the first probe composition comprises the nucleotide sequence shown as SEQ ID NOS 2-7 and the second probe composition comprises the nucleotide sequence shown as SEQ ID NOS 8-13, wherein
The nucleotide sequence shown in SEQ ID NO. 2 is as follows:
AAAAAAAAATATAAAACCTACGTCGAAAAAAATTTCTTACTTCTTATAAAAAACGAAAAAAAATAACCTTTTAAAATCAATATATAAAAACGAAATCTAAAACATAAAATAAAATATATA
the nucleotide sequence shown in SEQ ID NO. 3 is:
CACACATCCCACCCTATATCTTAAACCCCGTCCTCACACATTAACTTTAAAAAACCATTTTCCTTCGTCTTCTACAAAAAACAAAAAACTTTTTTCGACGTAAACTTCATACCCTCCCTT
the nucleotide sequence shown in SEQ ID NO. 4 is:
ACAACTATAACGACGACCACTACGACTAAAAAACCCCGAAACCTAAACACTACGACTTTAATCAACGAACTAAATTTCCGAAAAAAAAATATAAAACCTACGTCGAAAAAAATTTCTTAC
the nucleotide sequence shown in SEQ ID NO. 5 is:
ACAACTATAACGACGACCACTACGACTAAAAAACCCCGAAACCTAAACACTACGACTTTAATCAACGAACTAAATTTCCGAAAAAAAAATATAAAACCTACGTCGAAAAAAATTTCTTAC
the nucleotide sequence shown in SEQ ID NO. 6 is:
AAAAAAACTACATCTATATTTCCATAAACCTATCGAAATCGCTCGAAATCACCTACGACTAAAAACAAACAATAAAACGCGCAACTATAACGACGACCACTACGACTAAAAAACCCCGAA
the nucleotide sequence shown in SEQ ID NO. 7 is:
CCCGAAATTTCCCAACCGTAATAACCGCCGCCACAACTACGCGCTTTATTATCTACTTTCAATCGCAAATAACCTCGAACGATCTCGACAAATTTATAAAAACACAAATACAACCCTCTC
the nucleotide sequence shown in SEQ ID NO. 8 is:
AAAAAAAAATATAAAACCTACATCAAAAAAAATTTCTTACTTCTTATAAAAAACAAAAAAAAATAACCTTTTAAAATCAATATATAAAAACAAAATCTAAAACATAAAATAAAATATATA
the nucleotide sequence shown in SEQ ID NO. 9 is:
CACACATCCCACCCTATATCTTAAACCCCATCCTCACACATTAACTTTAAAAAACCATTTTCCTTCATCTTCTACAAAAAACAAAAAACTTTTTTCAACATAAACTTCATACCCTCCCTT
the nucleotide sequence shown in SEQ ID NO. 10 is:
ACAACTATAACAACAACCACTACAACTAAAAAACCCCAAAACCTAAACACTACAACTTTAATCAACAAACTAAATTTCCAAAAAAAAAATATAAAACCTACATCAAAAAAAATTTCTTAC
the nucleotide sequence shown in SEQ ID NO. 11 is:
ACAAAAAACTTTTTTCAACATAAACTTCATACCCTCCCTTCAAAAACTCAATCCACTAACCAAAACCACAATATTCAAACCCCAAAATTTCCCAACCATAATAACCACCACCACAACTAC
the nucleotide sequence shown in SEQ ID NO. 12 is:
AAAAAAACTACATCTATATTTCCATAAACCTATCAAAATCACTCAAAATCACCTACAACTAAAAACAAACAATAAAACACACAACTATAACAACAACCACTACAACTAAAAAACCCCAAA
the nucleotide sequence shown in SEQ ID NO. 13 is:
CCCAAAATTTCCCAACCATAATAACCACCACCACAACTACACACTTTATTATCTACTTTCAATCACAAATAACCTCAAACAATCTCAACAAATTTATAAAAACACAAATACAACCCTCTC
then, the sample is verified in a plasma sample, and the experimental detection method is as follows:
cfdna extraction purification
1.1.1. Plasma sample preparation:
the blood samples were centrifuged at 2000g for 10min at 4℃and the plasma was transferred to a new centrifuge tube. The plasma samples were centrifuged at 16000g for 10min at 4℃and the next step was performed depending on the type of collection tube used, which was the other one used in the experiment.
TABLE 1
1.1.2. Cleavage and binding
1.1.2.1. The binding solution/bead mixture was prepared according to the following table and then thoroughly mixed.
TABLE 2
An appropriate volume of plasma sample was added.
1.1.2.2. The plasma sample and binding solution/bead mixture are thoroughly mixed.
1.1.2.3. The cfDNA was bound to the magnetic beads by sufficient binding on a spin mixer for 10 min.
1.1.2.4. The binding tube was placed on a magnetic rack for 5min until the solution became clear and the beads were fully adsorbed on the magnetic rack.
1.1.2.5. The supernatant was carefully discarded with a pipette, the tube was kept on the magnetic rack for several minutes, and the residual supernatant was removed with a pipette.
1.1.3. Washing
1.1.3.1. The beads were resuspended in 1ml of wash solution.
1.1.3.2. The resuspension was transferred to a new non-adsorbed 1.5ml centrifuge tube. The binding tube remains.
1.1.3.3. The centrifuge tube containing the bead resuspension was placed on a magnetic rack for 20s.
1.1.3.4. The separated supernatant was aspirated and the binding tube was washed, and the washed residual beads were collected again into a heavy suspension, discarding the lysis/binding tube.
1.1.3.5. The tube was placed on a magnet rack for 2min until the solution became clear, the beads were collected on the magnet rack and the supernatant was removed with a 1ml pipette.
1.1.3.6. The tube was left on the magnet rack and the remaining liquid was removed as much as possible with a 200. Mu.L pipette.
1.1.3.7. The tube was removed from the magnet holder, 1ml of wash solution was added and vortexed for 30s.
1.1.3.8. The solution was allowed to settle for 2min on a magnetic rack, the beads were collected on the magnetic rack, and the supernatant was removed with a 1ml pipette.
1.1.3.9. The tube was left on the magnet rack and the residual liquid was removed thoroughly with a 200 μl pipette.
1.1.3.10. The tube was removed from the magnet holder, 1ml 80% ethanol was added, and vortexed for 30s.
1.1.3.11. The solution was allowed to settle for 2min on a magnetic rack and the supernatant was removed with a 1ml pipette.
1.1.3.12. The tube was left on the magnet holder and the residual liquid was removed with a 200. Mu.L pipette.
1.1.3.13. The above 1.1.3.10.— 1.1.3.12 steps were repeated with 80% ethanol once, and the supernatant was removed as much as possible.
1.1.3.14. The tube was left on the magnetic rack and the beads were dried in air for 3-5 minutes.
1.1.4. Elution of cfDNA
1.1.4.1. The eluent was added according to the following table.
TABLE 3 Table 3
1.1.4.2. Vortex for 5min, place on a magnetic rack for 2min, the solution becomes clear, and suck cfDNA in the supernatant.
1.1.4.3. The purified cfDNA was used immediately or the supernatant was transferred to a new centrifuge tube and stored at-20 ℃.
Disruption and purification of gDNA:
1.2.1. according to the Qubit concentration, 2. Mu.g of gDNA was taken, added with water to 125. Mu.l, added to a covaries 130. Mu.l disruption tube, and the procedure was set: 50W,20%,200 cycles, 250s.
1.2.2. After the interruption, 1 μl of the sample is taken and subjected to fragment detection by using Agilent2100, and after normal interruption, the main peak of the sample detection is about 150bp-200bp.
For cfDNA samples, agilent2100 performed fragment detection, and direct Qubit was used for subsequent experiments.
1.3. Terminal repair, 3' end plus "a":
1.3.1. 20ng of the cut gDNA or cfDNA was added to a PCR tube, and the mixture was supplemented to 50. Mu.l with nuclease-free water, and the following reagents were added and vortexed to mix well:
TABLE 4 Table 4
| Component (A) | Volume of |
| gDNA/cfDNA | 50μl |
| Stop repair and A tailing buffer | 7μl |
| Termination repair and A tailing enzyme mixture | 3μl |
| Total volume of | 60μl |
1.3.2. The following procedure was set up for the reaction on the PCR instrument: the temperature of the hot cover is 85 ℃.
TABLE 5
| Temperature (temperature) | Time |
| 20℃ | 30min |
| 65℃ | 30min |
| 4℃ | ∞ |
1.4. Joint connection and purification:
1.4.1. the linker was diluted in advance to the appropriate concentration with reference to the following table:
TABLE 6
| Fragmented DNA per 50. Mu.l ER and AT reactions | Concentration of the linker |
| 1μg | 10μM |
| 500ng | 10μM |
| 250ng | 10μM |
| 100ng | 10μM |
| 50ng | 10μM |
| 25ng | 10μM |
| 10ng | 3μM |
| 5ng | 5μM |
| 2.5ng | 2.5μM |
| 1ng | 625nM |
1.4.2. The following reagents were prepared according to the following table, gently blotted and mixed, and centrifuged briefly:
TABLE 7
1.4.3. The following procedure was set up for the reaction on the PCR instrument: there is no thermal cover.
TABLE 8
| Temperature (temperature) | Time |
| 20℃ | 30min |
| 4℃ | ∞ |
1.4.4. Adding purified magnetic beads for experiment (Agencourt AMPure XP magnetic beads are taken to room temperature in advance, and are vibrated and mixed uniformly for standby) according to the following system:
TABLE 9
| Component (A) | Volume of |
| Joint connection product | 110μl |
| Agencourt AMPure XP bead | 110μl |
| Total volume of | 220μl |
1.4.4.1. Gently sucking and beating, and mixing for 6 times.
1.4.4.2. Standing at room temperature for 5-15min, and placing the PCR tube on a magnetic rack for 3min to clarify the solution.
1.4.4.3. The supernatant was removed, the PCR tube was placed on a magnetic rack, 200. Mu.l of 80% ethanol solution was added to the PCR tube, and the mixture was allowed to stand for 30 seconds.
1.4.4.4. The supernatant was removed, 200. Mu.l of 80% ethanol solution was added to the PCR tube, and after standing for 30s, the supernatant was thoroughly removed (it was recommended to remove the bottom residual ethanol solution using a 10. Mu.l pipette).
1.4.4.5. Standing at room temperature for 3-5min to volatilize residual ethanol thoroughly.
1.4.4.6. Adding 22 μl of nuclease-free water, removing the PCR tube from the magnetic rack, gently sucking and beating the resuspended magnetic beads, avoiding generating bubbles, and standing at room temperature for 2min.
1.4.4.7. The PCR tube was placed on a magnetic rack for 2min to clarify the solution.
1.4.4.8. Mu.l of the supernatant was pipetted into a new PCR tube.
1.5 bisulfite treatment and purification:
1.5.1. the desired reagent was taken out in advance and dissolved. The reagents were added according to the following table:
table 10
The DNA protection buffer was added to the liquid to turn blue. Gently blotted and mixed, and then split into two tubes for PCR.
1.5.3. The following procedure was set up and run: the lid was heated to 105 ℃.
TABLE 11
| Temperature (temperature) | Time |
| 95℃ | 5min |
| 60℃ | 10min |
| 95℃ | 5min |
| 60℃ | 10min |
| 4℃ | ∞ |
1.5.4. The same sample from both tubes was combined into the same clean 1.5ml centrifuge tube by brief centrifugation.
1.5.5. To each sample, 310. Mu.l of buffer BL (sample size less than 100ng of 1. Mu.l of carrier RNA (1. Mu.g/. Mu.l) was added), vortexed, and briefly centrifuged.
1.5.6. 250 μl of absolute ethanol was added to each sample, vortexed and mixed for 15s, centrifuged briefly, and the mixture was added to the prepared corresponding column.
1.5.7. Standing for 1min, centrifuging for 1min, transferring the liquid in the collecting pipe into a centrifugal column again, centrifuging for 1min, and discarding the liquid in the centrifugal pipe.
1.5.8. Add 500. Mu.l buffer BW (note whether absolute ethanol was added) centrifuge for 1min and discard the waste.
1.5.9. Add 500. Mu.l buffer BD (note whether absolute ethanol was added) cover the tube and leave it for 15min at room temperature. Centrifuging for 1min, and discarding the centrifuged liquid.
1.5.10. Mu.l of buffer BW (note whether absolute ethanol was added) was added, centrifuged for 1min, the detached liquid was discarded, and repeated 2 times.
1.5.11. 250 μl of absolute ethanol was added, centrifuged for 1min, the column was placed in a new 2ml collection tube and all remaining liquid was discarded.
1.5.12. The column was placed in a clean 1.5ml centrifuge tube, 20. Mu.l of nuclease-free water was added to the center of the column membrane, the lid was gently covered, the column was placed at room temperature for 1min, and the column was centrifuged for 1min.
1.5.13. The liquid in the collection tube was re-transferred to a centrifuge column, left at room temperature for 1min, and centrifuged for 1min.
1.6. Pre-amplification and purification before hybridization:
1.6.1. preparing a reaction system according to the following table, blowing, mixing uniformly and centrifuging briefly:
table 12
1.6.2. The following procedure was set and the PCR procedure was started: thermal cover 105 DEG C
TABLE 13
The number of PCR cycles was adjusted according to the amount of DNA to be added, and the reference data were as follows:
TABLE 14
1.6.4. 50 mu l Agencourt AMPure XP magnetic beads are added into a PCR tube after the reaction is finished, and the mixture is blown and evenly mixed by a pipette to avoid generating bubbles (Agencourt AMPure XP is evenly mixed and balanced at room temperature in advance).
1.6.5. Incubating for 5-15min at room temperature, and placing the PCR tube on a magnetic rack for 3min to clarify the solution.
1.6.6. The supernatant was removed, the PCR tube was placed on a magnetic rack, 200. Mu.l of 80% ethanol solution was added to the PCR tube, and the mixture was allowed to stand for 30 seconds.
1.6.7. The supernatant was removed, 200. Mu.l of 80% ethanol solution was added to the PCR tube, and after standing for 30s, the supernatant was thoroughly removed (it was recommended to remove the bottom residual ethanol solution using a 10. Mu.l pipette).
1.6.8. Standing at room temperature for 5min to volatilize residual ethanol thoroughly.
1.6.9. Add 30. Mu.l of nuclease free water, remove the centrifuge tube from the magnetic rack and gently pipette the resuspended beads using a pipette.
1.6.10. Standing at room temperature for 2min, and placing 200 μl PCR tube on a magnetic rack for 2min to clarify the solution.
1.6.11. The supernatant was transferred to a new 200. Mu.l PCR tube (placed on an ice box) with a pipette, and the reaction tube was marked with a sample number, and prepared for the next reaction.
1.6.12. 1 μl of the sample was used for library concentration determination using Qubit, and library concentration was recorded.
1.6.13. 1 μl of the sample was used for library fragment length measurement using Agilent2100, the library length being approximately between 270bp-320 bp.
1.7. Hybridization of sample to probe:
1.7.1. sample libraries were mixed with various Hyb blockers, labeled B, according to the following system:
TABLE 15
| Component (A) | Volume of |
| Pre-amplification product | 750ng of corresponding volume |
| Hyb human blockers | 5μl |
| Joint blocking material | 6μl |
| Reinforcing agent | 5μl |
1.7.2. The prepared mixture of the sample and the Hyb blocker is put into a vacuum concentration centrifuge, a PCR tube cover is opened, the centrifuge is started, a vacuum pump switch is opened, and concentration is started.
1.7.3. The drained sample was redissolved in about 9 μl of nuclease-free water, and mixed gently by pipetting, briefly centrifuged and placed on ice for use, labeled B.
1.7.4. And (3) placing the Hyb buffer solution in a room temperature for melting, wherein precipitation appears after melting, placing the mixture in a water bath at 65 ℃ for preheating after uniformly mixing, placing 20 mu l of the Hyb buffer solution (without precipitation and turbidity) in a new 200 mu l PCR tube after complete dissolution, covering a tube cover, marking as A, and continuously placing the tube cover in the water bath at 65 ℃ for incubation for later use.
1.7.5. The methylation probe sequence described before was synthesized by Ai Jitai c biotechnology (beijing) limited:
1.7.6. mu.l of the RNase-blocking material and 2. Mu.l of the probe composition were placed in a 200. Mu.l PCR tube, gently blotted and mixed, centrifuged briefly and placed on ice for use, labeled C.
1.7.7. Setting parameters of a PCR instrument, and heating the cover to 100 ℃,95 ℃ for 5min; and (5) maintaining at 65 ℃.
1.7.8. The PCR tube B was placed on a PCR instrument and the procedure was run.
When the temperature of the PCR instrument is reduced to 65 ℃, the PCR tube A is placed on the PCR instrument for incubation, and a thermal cover of the PCR instrument is covered.
After 1.7.10.5min, C was placed on PCR for incubation and covered with the thermal cover of the PCR instrument.
1.7.11. Placing the PCR tube C into a PCR instrument for 2min, adjusting the liquid transfer device to 13 μl, sucking 13 μl of Hyb buffer solution from the PCR tube A, transferring to the PCR tube C, sucking all samples in the PCR tube B, transferring to the PCR tube C, gently sucking for 10 times, mixing thoroughly, avoiding generating a large amount of bubbles, sealing the tube cover, covering the thermal cover of the PCR instrument, and incubating overnight at 65deg.C (16-24 h).
1.8. Capturing a target region DNA library:
1.8.1. preparation of Capture magnetic beads
1.8.1.1. The beads (Dynabeads MyOne Streptavidin T1) were removed from 4 ℃, resuspended by vortexing.
1.8.1.2. 50 μl of magnetic beads were placed in a new PCR tube, placed on a magnetic rack for 1min to clarify the solution, and the supernatant was removed.
1.8.1.3. The PCR tube was removed from the magnetic rack, 200. Mu.L of binding buffer was added and gently pipetted several times to mix well and resuspend the beads.
1.8.1.4. Placing on a magnetic rack for 1min, and removing the supernatant.
1.8.1.5. Repeating the steps 3-4 twice, and washing the magnetic beads for 3 times.
1.8.1.6. The PCR tube was removed from the magnetic rack and 200. Mu.L of binding buffer was added to gently pipette 6 times to resuspend the beads for use.
1.8.2. Capturing a target DNA library
1.8.2.1. The hybridization product PCR tube C is kept on a PCR instrument, 200 mu L of prepared capture magnetic beads are added into the hybridization product PCR tube C, the hybridization product PCR tube C is sucked and beaten for 6 times by a pipette for uniform mixing, and the hybridization product PCR tube C is placed on a rotary mixer for 30min at room temperature (the rotating speed is preferably not more than 10 revolutions per minute).
1.8.2.2. The PCR tube was placed on a magnetic rack for 2min to clarify the solution and the supernatant was removed.
1.8.2.3. 200. Mu.L of washing buffer 1 (23.5 ml of nuclease-free water, 1.25ml of 20 XSSC, 250. Mu.L of 10% SDS) was added to the PCR tube C, gently blotted and homogenized, placed on a rotary kneader and washed for 15min (the rotation speed is preferably not more than 10 rpm), and then centrifuged briefly, and the PCR tube was placed on a magnetic rack for 2min to clarify the solution, and the supernatant was removed.
1.8.2.4. 200. Mu.l of washing buffer 2 (24.6 ml of nuclease-free water, 125. Mu.l of 20 XSSC, 250. Mu.l of 10% SDS) preheated at 65℃was added, gently blotted 6 times and mixed, and incubated on a mixer at 65℃for 10min at a rotational speed of 800 rpm for washing.
1.8.2.5. The PCR tube was placed on a magnetic rack for 2min after brief centrifugation and the supernatant removed. The washing with wash buffer 2 was repeated 2 more times for a total of 3 times. The wash buffer 2 was removed thoroughly last time.
The PCR tube was placed on a magnetic rack, 200. Mu.l of 80% ethanol was added to the PCR tube, and after standing for 30 seconds, the ethanol solution was thoroughly removed and dried at room temperature for 2 minutes.
1.8.2.7. Adding 30 mu L nuclease-free water into the PCR tube, taking the PCR tube off the magnetic rack, and lightly sucking and beating the magnetic beads for 6 times for later use.
1.9. Post-capture amplification and purification
1.9.1. Preparing a reaction system according to the following table, enriching a capture library, lightly blowing and uniformly mixing, and then briefly centrifuging:
table 16
1.9.2. The following procedure was set, the samples were placed in a PCR instrument, and the procedure was run: the lid was heated to 105 ℃.
TABLE 17
After the PCR was completed, 55. Mu. l Agencourt AMPure XP beads were added to the sample, and the mixture was gently pipetted and stirred.
1.9.4. Incubation was performed for 5min at room temperature, and the PCR tube was placed on a magnetic rack for 3min to clarify the solution.
1.9.5. The supernatant was removed, the PCR tube was placed on a magnetic rack, 200. Mu.l of 80% absolute ethanol was added, and the mixture was allowed to stand for 30 seconds.
1.9.6. The supernatant was removed, 200. Mu.l of 80% absolute ethanol was added to the PCR tube, and the supernatant was thoroughly removed after standing for 30 seconds.
1.9.7. Standing at room temperature for 5min to volatilize residual ethanol thoroughly.
1.9.8. Add 25. Mu.l of nuclease-free water, remove the PCR tube from the magnetic rack, gently blow mix and re-suspend the beads and leave for 2min at room temperature.
1.9.9. The PCR tube was placed on a magnetic rack for 2min to clarify the solution.
1.9.10. Mu.l of the supernatant was pipetted into a 1.5ml centrifuge tube and labeled with sample information.
1.9.11. 1 μl of library was quantified using Qubit and library concentrations were recorded.
1.9.12. 1 μl of sample was taken and used for library fragment length determination using Agilent 2100.
1.9.13. Sequencing was performed using Illumina high throughput sequencing platform.
1.10. Methylation letter analysis flow. The method is approximately as follows: checking sequencing quality by using quality control software such as trimmabatic and the like, removing low-quality reads, comparing the quality-controlled clean data to a reference genome by using comparison software such as a Bismarker and the like, and extracting corresponding methylation sites by using R packets such as methyl kit and the like. Finally, the average methylation level of the target region on Panel was calculated, which resulted in a value that interpreted as cancer if it exceeded 0.34 and was normal if it was below 0.34.
Example 2
One example of lung cancer sample, peripheral blood was collected as in example 1 using the Panel test of the present application; establishing a library, and sequencing through an Illumina platform; sequencing data is subjected to the biological information analysis flow to obtain the methylation level of each site, wherein 13 CG methylation sites are contained in the panel, and the specific table is as follows:
TABLE 18
The test sample was interpreted as a cancer sample with an average methylation level of 0.55, greater than a threshold value of 0.34.
Example 3
One example of lung cancer sample, peripheral blood was collected as in example 1 using the Panel test of the present application; establishing a library, and sequencing through an Illumina platform; sequencing data is subjected to the biological information analysis flow to obtain the methylation level of each site, wherein 13 CG methylation sites are contained in the panel, and the specific table is as follows:
TABLE 19
The test sample was interpreted as a cancer sample with an average methylation level of 0.61, greater than a threshold value of 0.34.
Example 4
One example of lung cancer sample, peripheral blood was collected as in example 1 using the Panel test of the present application; establishing a library, and sequencing through an Illumina platform; sequencing data is subjected to the biological information analysis flow to obtain the methylation level of each site, wherein 13 CG methylation sites are contained in the panel, and the specific table is as follows:
table 20
The test sample was interpreted as a cancer sample with an average methylation level of 0.57, greater than a threshold value of 0.34.
Example 5
A healthy human sample, peripheral blood was collected as in example 1 using the Panel test of the present application; establishing a library, and sequencing through an Illumina platform; sequencing data is subjected to the biological information analysis flow to obtain the methylation level of each site, wherein 13 CG methylation sites are contained in the panel, and the specific table is as follows:
table 21
The test sample is interpreted, and the methylation average level of the sample is 0.23 and is smaller than the threshold value of 0.34, so that the sample is interpreted as a healthy sample.
Example 6
A healthy human sample, peripheral blood was collected as in example 1 using the Panel test of the present application; establishing a library, and sequencing through an Illumina platform; sequencing data is subjected to the biological information analysis flow to obtain the methylation level of each site, wherein 13 CG methylation sites are contained in the panel, and the specific table is as follows:
table 22
The test sample is interpreted, and the methylation average level of the sample is 0.21 and is smaller than the threshold value of 0.34, so that the sample is interpreted as a healthy sample.
Example 7
A healthy human sample, peripheral blood was collected as in example 1 using the Panel test of the present application; establishing a library, and sequencing through an Illumina platform; sequencing data is subjected to the biological information analysis flow to obtain the methylation level of each site, wherein 13 CG methylation sites are contained in the panel, and the specific table is as follows:
table 23
The test sample is interpreted, and the methylation average level of the sample is 0.17 and is smaller than the threshold value of 0.34, so that the sample is interpreted as a healthy sample.
In summary, the inventors of the present application have found a methylation gene associated with lung cancer and determined a target sequence of methylation abnormality of the methylation gene of lung cancer, and by the target sequence of the methylation gene, the methylation state of the gene can be sensitively and specifically detected, so that the methylation state can be used for detecting free DNA of peripheral blood, and the composition of the present application can realize real-time monitoring, and has higher sensitivity and accuracy.
The above description is only a preferred embodiment of the present application, and is not intended to limit the application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.
Sequence listing
<110> Bo' er Cheng (Beijing) technology Co., ltd
<120> composition for lung cancer screening and use thereof
<130> PE01552
<150> CN202110378713.1
<151> 2021-04-08
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 188
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 1
aaggccattt tccttcgtct tctacaagaa gcaagaaact tttttcgacg taggcttcat 60
accctccctt cggaaactca gtccgctgac caaagccgca gtgttcaggc cccggggttt 120
cccagccgta gtggccgccg ccacagctgc gcgctttatt gtctgctttc agtcgcaggt 180
gacctcga 188
<210> 2
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 2
aaaaaaaaat ataaaaccta cgtcgaaaaa aatttcttac ttcttataaa aaacgaaaaa 60
aaataacctt ttaaaatcaa tatataaaaa cgaaatctaa aacataaaat aaaatatata 120
<210> 3
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 3
cacacatccc accctatatc ttaaaccccg tcctcacaca ttaactttaa aaaaccattt 60
tccttcgtct tctacaaaaa acaaaaaact tttttcgacg taaacttcat accctccctt 120
<210> 4
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 4
acaactataa cgacgaccac tacgactaaa aaaccccgaa acctaaacac tacgacttta 60
atcaacgaac taaatttccg aaaaaaaaat ataaaaccta cgtcgaaaaa aatttcttac 120
<210> 5
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 5
acaactataa cgacgaccac tacgactaaa aaaccccgaa acctaaacac tacgacttta 60
atcaacgaac taaatttccg aaaaaaaaat ataaaaccta cgtcgaaaaa aatttcttac 120
<210> 6
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 6
aaaaaaacta catctatatt tccataaacc tatcgaaatc gctcgaaatc acctacgact 60
aaaaacaaac aataaaacgc gcaactataa cgacgaccac tacgactaaa aaaccccgaa 120
<210> 7
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 7
cccgaaattt cccaaccgta ataaccgccg ccacaactac gcgctttatt atctactttc 60
aatcgcaaat aacctcgaac gatctcgaca aatttataaa aacacaaata caaccctctc 120
<210> 8
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 8
aaaaaaaaat ataaaaccta catcaaaaaa aatttcttac ttcttataaa aaacaaaaaa 60
aaataacctt ttaaaatcaa tatataaaaa caaaatctaa aacataaaat aaaatatata 120
<210> 9
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 9
cacacatccc accctatatc ttaaacccca tcctcacaca ttaactttaa aaaaccattt 60
tccttcatct tctacaaaaa acaaaaaact tttttcaaca taaacttcat accctccctt 120
<210> 10
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 10
acaactataa caacaaccac tacaactaaa aaaccccaaa acctaaacac tacaacttta 60
atcaacaaac taaatttcca aaaaaaaaat ataaaaccta catcaaaaaa aatttcttac 120
<210> 11
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 11
acaaaaaact tttttcaaca taaacttcat accctccctt caaaaactca atccactaac 60
caaaaccaca atattcaaac cccaaaattt cccaaccata ataaccacca ccacaactac 120
<210> 12
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 12
aaaaaaacta catctatatt tccataaacc tatcaaaatc actcaaaatc acctacaact 60
aaaaacaaac aataaaacac acaactataa caacaaccac tacaactaaa aaaccccaaa 120
<210> 13
<211> 120
<212> DNA
<213> artificial sequence
<220>
<223> artificially synthesized
<400> 13
cccaaaattt cccaaccata ataaccacca ccacaactac acactttatt atctactttc 60
aatcacaaat aacctcaaac aatctcaaca aatttataaa aacacaaata caaccctctc 120
Claims (7)
1. A composition for lung cancer screening, the composition comprising a nucleic acid for detecting methylation of a target sequence of a NXPH1 gene;
the nucleotide sequence of the target sequence of the NXPH1 gene is shown as SEQ ID NO. 1;
the nucleic acid for detecting methylation of a target sequence of a NXPH1 gene includes a probe composition for hybridization with the target sequence of the NXPH1 gene;
the probe composition comprises a hypermethylated first probe composition for hybridization with a region of high methylation of the bisulfite converted CG and a hypomethylated second probe composition for hybridization with a region of low methylation of the bisulfite converted CG;
the first probe composition comprises a nucleotide sequence shown as SEQ ID NO. 2-7; the second probe composition comprises a nucleotide sequence as shown in SEQ ID NO. 8-13.
2. The composition of claim 1, further comprising an agent that converts an unmethylated cytosine base at position 5 of a target sequence of a NXPH1 gene to uracil.
3. The composition of claim 1 or 2, wherein the nucleic acid for detecting target sequence methylation of the NXPH1 gene further comprises:
blocking agents that preferentially bind to target sequences in the unmethylated state.
Use of a target sequence of a NXPH1 gene in the preparation of a kit for lung cancer screening, wherein the nucleotide sequence of the target sequence of the NXPH1 gene is shown as SEQ ID No. 1.
5. A kit comprising the composition of any one of claims 1-3.
6. Use of the composition of any one of claims 1-3 in the manufacture of a kit for lung cancer screening.
7. A chip comprising the composition of any one of claims 1-3.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110378713 | 2021-04-08 | ||
| CN2021103787131 | 2021-04-08 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114317732A CN114317732A (en) | 2022-04-12 |
| CN114317732B true CN114317732B (en) | 2023-08-18 |
Family
ID=81034146
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110627263.5A Active CN114317732B (en) | 2021-04-08 | 2021-06-04 | Composition for lung cancer screening and application thereof |
| CN202110837407.XA Pending CN114317734A (en) | 2021-04-08 | 2021-07-23 | Composition for lung cancer screening and application thereof |
| CN202110930347.6A Active CN114317735B (en) | 2021-04-08 | 2021-08-13 | Composition for lung cancer screening and application thereof |
| CN202111082624.9A Active CN114317737B (en) | 2021-04-08 | 2021-09-15 | Composition for lung cancer screening and application thereof |
Family Applications After (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110837407.XA Pending CN114317734A (en) | 2021-04-08 | 2021-07-23 | Composition for lung cancer screening and application thereof |
| CN202110930347.6A Active CN114317735B (en) | 2021-04-08 | 2021-08-13 | Composition for lung cancer screening and application thereof |
| CN202111082624.9A Active CN114317737B (en) | 2021-04-08 | 2021-09-15 | Composition for lung cancer screening and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (4) | CN114317732B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009153667A2 (en) * | 2008-06-17 | 2009-12-23 | Occure Gmbh | Method for the detection of ovarian cancer |
| CN105925681A (en) * | 2016-05-06 | 2016-09-07 | 博尔诚（北京）科技有限公司 | Composition for lung cancer screening and application of composition |
| CN109609629A (en) * | 2017-09-30 | 2019-04-12 | 博尔诚（北京）科技有限公司 | Composition and application thereof for detecting liver cancer |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002097031A2 (en) * | 2001-03-28 | 2002-12-05 | Incyte Genomics, Inc. | Molecules for diagnostics and therapeutics |
| CN102272325B (en) * | 2008-11-17 | 2015-07-22 | 威拉赛特公司 | Methods and compositions of molecular profiling for disease diagnostics |
| US20120252028A1 (en) * | 2009-08-14 | 2012-10-04 | Michael Shtulman | Target genes for cancer therapy |
| US20140271455A1 (en) * | 2013-03-14 | 2014-09-18 | City Of Hope | Dna methylation biomarkers for small cell lung cancer |
| WO2015116837A1 (en) * | 2014-01-30 | 2015-08-06 | The Regents Of The University Of California | Methylation haplotyping for non-invasive diagnosis (monod) |
| EP3481954A4 (en) * | 2016-07-06 | 2020-04-15 | Youhealth Biotech, Limited | Lung cancer methylation markers and uses thereof |
| MX2019003273A (en) * | 2016-09-23 | 2019-09-13 | Alveo Tech Inc | Methods and compositions for detecting analytes. |
| WO2020036929A1 (en) * | 2018-08-14 | 2020-02-20 | Trustees Of Dartmouth College | Arrays targeting differentially accessible chromatin regions |
| CN111088351A (en) * | 2018-10-23 | 2020-05-01 | 博尔诚（北京）科技有限公司 | Composition for detecting lung cancer and application thereof |
| CN110317875B (en) * | 2019-07-30 | 2024-06-21 | 苏州呼呼健康科技有限公司 | Methylation gene related to lung cancer and detection kit thereof |
-
2021
- 2021-06-04 CN CN202110627263.5A patent/CN114317732B/en active Active
- 2021-07-23 CN CN202110837407.XA patent/CN114317734A/en active Pending
- 2021-08-13 CN CN202110930347.6A patent/CN114317735B/en active Active
- 2021-09-15 CN CN202111082624.9A patent/CN114317737B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009153667A2 (en) * | 2008-06-17 | 2009-12-23 | Occure Gmbh | Method for the detection of ovarian cancer |
| CN105925681A (en) * | 2016-05-06 | 2016-09-07 | 博尔诚（北京）科技有限公司 | Composition for lung cancer screening and application of composition |
| CN109609629A (en) * | 2017-09-30 | 2019-04-12 | 博尔诚（北京）科技有限公司 | Composition and application thereof for detecting liver cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114317734A (en) | 2022-04-12 |
| CN114317735B (en) | 2023-01-31 |
| CN114317735A (en) | 2022-04-12 |
| CN114317732A (en) | 2022-04-12 |
| CN114317737A (en) | 2022-04-12 |
| CN114317737B (en) | 2024-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115176034A (en) | Cancer gene methylation detection system and cancer in-vitro detection method implemented in same | |
| CN110853708B (en) | Design method of nucleic acid capture probe for HLA typing | |
| CN114317740B (en) | Marker for gastric cancer screening, probe composition and application thereof | |
| WO2021185274A1 (en) | Probe composition for detecting 6 cancers with high incidence in china | |
| CN112662762A (en) | Probe composition for detecting 5 tumors of digestive tract | |
| CN112662763A (en) | Probe composition for detecting common amphoteric cancers | |
| CN112259165A (en) | Method and system for detecting microsatellite instability state | |
| CN112662761A (en) | Probe composition for detecting 3 parenchymal organ tumors | |
| CN114317732B (en) | Composition for lung cancer screening and application thereof | |
| CN114507734B (en) | Marker for thyroid cancer screening, probe composition and application thereof | |
| CN114540497B (en) | Marker for bladder cancer screening, probe composition and application thereof | |
| CN114703281B (en) | Marker for screening testicular cancer, probe composition and application thereof | |
| CN114369664B (en) | Marker for pancreatic cancer screening, probe composition and application thereof | |
| CN114231635B (en) | Marker and probe composition for lung cancer screening and application thereof | |
| CN114410792B (en) | Marker for kidney cancer screening, probe composition and application thereof | |
| CN115279924A (en) | Probe composition for detecting 11 cancers | |
| CN114395626B (en) | Marker for cervical cancer screening, probe composition and application thereof | |
| CN114395628B (en) | Marker for colorectal cancer screening, probe composition and application thereof | |
| CN112662759A (en) | Probe composition for detecting 3 lumen organ tumors | |
| CN118272525A (en) | Marker for gastric cancer screening, probe composition and application thereof | |
| CN114369663A (en) | Marker and probe composition for liver cancer screening and application thereof | |
| CN118048451A (en) | Marker for screening liver cancer, probe composition and application thereof | |
| CN114085895B (en) | Detection primer for rapidly detecting MSI and kit thereof | |
| CN114369661A (en) | Marker and probe composition for breast cancer screening and application thereof | |
| CN117448450A (en) | Marker for colorectal cancer screening, probe composition and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |