CN116875618A

CN116875618A - Extension factor complex subunit OsELP3 gene for regulating resistance of rice to rice blast and application thereof

Info

Publication number: CN116875618A
Application number: CN202310640389.5A
Authority: CN
Inventors: 杜雪竹; 盛锋; 巫燕飞; 朱忠林; 张岩; 傅玉全
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2023-05-29
Filing date: 2023-05-29
Publication date: 2023-10-13

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an elongation factor subunit OsELP3 gene for regulating and controlling rice blast resistance and application thereof. Screening an elongation factor subunit OsELP3 gene induced to express by rice blast bacteria, wherein the nucleotide sequence of the elongation factor subunit OsELP3 gene is shown as SEQ ID NO. 1; the protein sequence coded by the gene is shown as SEQ ID NO. 2. The agrobacterium-mediated transformation is utilized to obtain an OsELP3 over-expression transgene strain and a CRISPR/Cas9 mutant strain. Rice blast inoculation identification of the transgenic material shows that the resistance of the OsELP3 over-expressed strain to rice blast is enhanced, and the mutant strain is more sensitive to rice blast bacteria, which shows that the OsELP3 is a positive regulatory factor of the resistance of rice to rice blast. The OsELP3 gene plays a positive regulation role in the resistance of rice blast, and can obviously improve the resistance of rice to rice blast by over-expressing the gene.

Description

Extension factor complex subunit OsELP3 gene for regulating resistance of rice to rice blast and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to functional identification and application of an elongation factor complex subOsELP 3 gene in regulating and controlling rice blast resistance.

Background

Rice is a plant of the genus oryza of the family Gramineae, is widely cultivated and is a major food crop worldwide (Giri J, parida S K, raghuvanshi S, et al Emering Molecular Strategies for Improving Rice Drought Tolerance. Curr Genomics,2021,22 (1): 16-25). Rice Blast caused by ascomycetes (Magnaporthe grisea, anamorph: pyricularia grisea) is one of the common and serious diseases of rice, and occurs to different degrees in the year of popularity, the serious disease area generally reduces the yield by 10-20%, the serious yield can reach 40-50%, the local and even absolute yield is seriously influenced, and the rice Blast is a main factor for limiting the high yield and stable yield of the rice (Li W, zhu Z, chern M, et al A Natural Allele of aTranscription Factor in Rice Confers Broad-Spectrum Blast resistance. Cell,2017,170:114-126;Asif N,Lin F,Li L,Zhu X,Nawaz S.Regulation of Autophagy Machinery in Magnaporthe oryzae.Int J Mol Sci.2022Jul28;23 (15): 8366). The chemical control is high in cost and can cause serious health hazard and environmental problems, and the cultivation of rice blast resistant rice varieties is considered as the most economical and effective way for resisting rice blast, but as the rice blast is physiological and small in variety and rapid in variation, the resistance of the newly bred and popularized resistant varieties is often reduced or even lost after the new bred and popularized resistant varieties are applied for years, so that the rice blast resistance genes are continuously excavated, the disease resistance molecular mechanisms of the rice blast resistant varieties are analyzed, theoretical guidance and germplasm resources are provided for rice blast resistant varieties breeding, and important reference values are provided for safe production of rice.

The elongation factor complex (elongator complex, ELP) is a protein complex identified by Otero et al as capable of tightly binding to highly phosphorylated RNA polymerase II when studying the transcriptional elongation regulatory factor of yeast and is thus named (Wittschieben BO, otero G, de Bizemont T, F et al A novel histone acetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol cell 1999Jul;4 (1): 123-8). Early studies showed that ELP also has histone acetyl transferase (histone acetyl transferase, HAT) activity, thus presumably modulating the transcriptional process of eukaryotic cells by ELP through mediated histone acetylation modifications (oto G, fes J, li Y, bizemont TD, svejstrup J q. Elongator, a multisubunit component of a novel RNA polymerase II holo-enzyme for transcriptional elongation. Mol Cell,1999, 3:109-118); in recent years, increasing reports have demonstrated that ELP is also capable of regulating the translation process by modification of tRNA (Vers W, groeve S D, lijsebettens M.Elongator, a conserved multitasking complex Mol Microbiol,2010, 76:1065-1069). ELP consists of a2 subunit protein complex, a core complex consisting of 2 copies of ELP1, ELP2 and ELP3. Another subunit is an accessory complex consisting of 2 copies of ELP4, ELP5 and ELP6, where ELP1 is the largest subunit in ELP, containing a conserved C-terminal alkaline region and a phosphorylated segment that promotes tRNA binding and modification (Jarosz M, van Lijsebettens M, woloszynska M.plant electrode-protein complex of diverse activities regulates growth, development, and immune responses.int J Mol Sci 2020, 21:6912); ELP2 contains WD40 protein domains, which can serve as assembly scaffolds, linking ELP1 and ELP3 (Sant R D, bandau S, star M J R.A conserved and essential basic region mediates tRNAbinding to the Elp1 subunit of the Saccharomyces cerevisiae Elongator complex. Mol Microbiol,2014, 92:1227-1242); ELP3 is a catalytic subunit, known as the enzyme core protein of ELP, with the catalytic domain (SAM) of Histone Acetyltransferase (HAT) and the free radical S-adenosylmethionine (Qi L, zhang X, zhai H, liu J, wu F, li C, chen Q. Elongator is required for root stem cell maintenance by regulating SHORTROOT trans-formation. Plant Physiol,2019, 179:220-232). The accessory complex assembles to form a hexamer loop structure of the RecA class atpase, involved in tRNA binding and uridine modification of tRNA swing positions (Dalwadi U, yip C k. Structural insights into the function of eiongator. Cell Mol Life Sci,2018, 75:1613-1622), but specific regulatory mechanisms still need further investigation.

Existing studies have shown that ELP can be involved in a variety of cellular behavior regulation, including histone modification, tRNA modification, exocytosis, α -tubulin acetylation, paternal genome demethylation during embryonic development, and the like. In addition, the study found that Arabidopsis Elongator was necessary for the complete induction of the JA/ET defense pathway marker gene plant DEFENSIN1.2 (PDF 1.2) and resistance to the necrotic fungal pathogens Botrytis cinerea and Brassicola (Wang, C.; ding, Y.; yao, J.; zhang, Y.; sun, Y.; colee, J.; mou, Z.Arabidopsis Elongator subunit 2positively contributes to resistance to the necrotrophic fungal pathogens Botrytis cinerea and Alternaria brassicicola.Plant J.2015,83,1019-1033;). Elongator has been shown to play an important role in increasing plant pathogen resistance, however the function of Elongator in rice against rice blast is still unclear.

Disclosure of Invention

The invention aims at providing a rice blast resistance related extension factor complex subunit gene OsELP3. The gene is cloned from a rice genome based on arabidopsis thaliana homologous sequence comparison and rice inoculation rice blast fungus gene expression difference analysis. The nucleotide sequence of the OsELP3 gene is shown as SEQ ID NO:1, or at least 50% homology, and a protein encoded by the above DNA fragment or a modified protein having the same function.

Another object of the present invention is to provide the use of an elongation factor complex subunit gene OsELP3 in the involvement of rice blast resistance. By genetic transformation, SEQ ID NO:1 or a homologous gene functionally equivalent thereto is overexpressed in rice plants. The protein sequence coded by the gene is shown as SEQ ID NO:2, so as to achieve the aim of regulating and controlling the rice blast resistance of the rice, thereby being applied to the cultivation of rice blast resistant strains.

The invention carries out rice blast fungus induced expression pattern analysis on rice elongation factor families, and screens to obtain a gene OsELP3 which is obviously induced by rice blast fungus to up-regulate expression. The agrobacterium-mediated genetic transformation method is utilized to over-express or knock out the gene in rice, and the transgenic material over-expressing the gene is found to have enhanced resistance to rice blast, while the mutant material is more sensitive to rice blast. From this, it was revealed that OsELP3 is a positive regulator of rice response to rice blast resistance. The invention also relates to a vector containing the gene or the homologous gene fragment thereof and the application of designing the gene or the functional analogue thereof to enhance the resistance of plants to rice blast in agricultural breeding.

The technical scheme of the invention is as follows:

the applicant clones and obtains an elongation factor OsELP3 gene for regulating and controlling rice blast resistance, and the nucleotide sequence of the elongation factor OsELP3 gene is shown as SEQ ID NO. 1.

The protein sequence coded by the rice extension factor OsELP3 gene for regulating and controlling the rice blast resistance is shown as SEQ ID NO. 2.

The invention relates to an application of an OsELP3 gene in regulating and controlling rice blast resistance.

The more detailed technical scheme is as follows:

the RT-qPCR method is used for analyzing the expression mode of the rice ELP gene family induced by the rice blast bacteria, and finally determining the research target gene OsELP3 according to the gene induction expression condition (see A diagram in figure 1).

Leaf RNA was extracted from japonica rice variety Nippon, and reverse transcribed into cDNA using reverse transcriptase Superscript III (available from Invitrogen, USA). Reaction conditions: 65℃for 5min,50℃for 60min and 70℃for 10min. By utilizing rice genome information, the forward primer OsELP3-full-F (5'ATGGCCACCGCCGTAGCCGCCGC 3') and the reverse primer OsELP3-full-R (5'TTAGACCAGACATTTGACCATG 3') of the synthetic amplification primers amplify the full length cDNA (1722 bp) of the OsELP3 gene. PCR reaction conditions: pre-denaturation at 94℃for 3min;94℃30sec,59℃30sec,72℃2min 50sec,28 cycles; extending at 72℃for 7min. The PCR product obtained by the amplification was ligated into pGEM-T vector (purchased from Promega, USA), positive clones were selected and sequenced to obtain the desired gene ORF, the sequence of which was the nucleotide sequence shown in SEQ ID NO:1, encoding 574 amino acid sequences (sequence shown in SEQ ID NO: 2). The amino acid sequence was subjected to homology alignment analysis, and found that OsELP3 had the highest homology with the ELP3 gene derived from corn, followed by ELP3 derived from Brevibacterium reesei (panel B in FIG. 1).

The invention respectively constructs the overexpression vector pU1301-OsELP3-Flag (see A diagram in figure 2) and the CRISPR/Cas9-OsELP3 gene knockout vector (see B diagram in figure 2), the applicant respectively converts the two vectors into japonica rice variety Japanese sunny by using an agrobacterium transformation method to obtain the positive strain and CRISPR/Cas9 positive strain of the gene, detects the expression quantity of the gene and selects 2T 1 generation overexpression strains (the numbers of which are OE-ELP3-43 and OE-ELP3-57 (see A diagram in figure 3) and 2 CRISPR/Cas9 transformation strains (the detection primers are designed at the upstream and downstream of target sites, corresponding fragments are amplified and sequenced, gene editing is carried out at the target sites, and materials causing large fragment deletion or premature translation termination are finally selected as the materials for the subsequent experiments, wherein the two premature termination strains (see B diagram in figure 3-7 and ELP-32) are finally selected.

The invention performs rice blast inoculation identification on OsELP3 transgenic materials (an over-expression strain and a CRISPR/Cas9 mutant strain), and discovers that compared with a control material, the resistance of the OsELP3 over-expression material to rice blast is obviously improved, and elp3 mutants are more sensitive to rice blast bacteria (figure 4). After 72 hours of inoculation with Pyricularia oryzae, the expression levels of the disease-resistance related genes PR1.1, PR2, chitinase4, chitinase5 were significantly higher in the OsELP3 over-expressed material than in the control material (FIG. 5). Thus, osELP3 positively regulates rice resistance to rice blast.

The invention has the advantages that:

(1) According to the invention, the rice blast induction expression mode of the rice extension factor complex gene is analyzed, the OsELP3 gene is obtained by screening and identifying the rice extension factor complex gene, and meanwhile, the OsELP3 gene is found to be a positive regulation and control factor for resisting rice blast. Through genetic transformation, the gene is over-expressed to obtain a new rice strain resisting rice blast, and the new rice strain can also be used as a potential marker gene of a rice resistance material.

(2) Rice overexpressing OsELP3 has significantly increased resistance to rice blast, whereas elp mutant is more susceptible to rice blast. This suggests that the OsELP3 gene is involved in the resistance response of rice to rice blast and plays an important role. The accumulation of resistance factors PR1.1, PR2, chitinase4 and Chitinase5 in rice can be regulated by increasing the expression level of the OsELP3 gene, so that the resistance of the rice to rice blast is improved.

Drawings

Fig. 1: osELP3 induced expression pattern and phylogenetic tree analysis. Reference numerals illustrate: panel A in FIG. 1 shows that OsELP3 is significantly induced in expression compared with the control after 0, 48, 72, 96, 144 hours of rice inoculation with Pyricularia oryzae in wild type Nippon Rice. Panel B in FIG. 1 is an OsELP3 phylogenetic tree analysis. Other representative plants were selected for phylogenetic tree analysis and bioinformatics analysis, and the results showed that the sequence of OsELP3 was most homologous to the zmlp 3 sequence of maize (Zea mays), followed by the sequence of ELP3 amino acids of brachypodium distachyon (Brachypodium distachyon).

Fig. 2: osELP3 overexpression vector and CRISPR/Cas9 gene knockout vector construction. Reference numerals illustrate: panel A in FIG. 2 is a map of pU1301-OsELP3-3 x flag overexpression vector. Panel B of FIG. 2 is a CRISPR/Cas9-OsELP3 gene knockout vector map.

Fig. 3: detection results of transgenic offspring. Reference numerals illustrate: panel A in FIG. 3 shows the results of detection of the expression level of OsELP 3-overexpressing material (generation T1). Reference numerals illustrate: two rice transgenic lines of OE-ELP3-43 (high expression level) and OE-ELP3-57 (medium expression level) were selected for subsequent study. Panel B in FIG. 3 is elp3 mutant gene edit-type assay. Two mutant lines, elp3-7 and elp3-32, were selected for early translation termination for subsequent study.

Fig. 4: identification of rice blast resistance of control and transgenic materials. Reference numerals illustrate: panel A in FIG. 4 shows phenotypic observations after 5d inoculation of Magnaporthe grisea with control material (WT) and transgenic material (OE-43, OE-57, elp3-7, elp-32). Panel B in FIG. 4 shows plaque area statistics. The results showed that OsELP3 was over-expressed more resistant to rice blast than the control material, whereas elp3 mutant was more susceptible to rice blast.

Fig. 5: and (5) carrying out disease resistance related gene expression analysis after inoculating the rice blast germ with the control material and the transgenic material for 72 h. Reference numerals illustrate: FIG. 5 shows the results of detecting the expression level of the disease-resistant genes PR1.1, PR2, chitinase4, chitinase5 and the like in the control material (WT) and the transgenic material (OE-43, OE-57, elp3-7, elp 3-32) after inoculation with Pyricularia oryzae for 72 hours.

Detailed Description

Description of the sequence Listing

SEQ ID NO:1 is the nucleotide sequence of the cloned OsELP3 gene of the present invention.

SEQ ID NO:2 is the protein sequence encoded by the OsELP3 gene.

The following examples define the invention and describe the method of the invention in the isolation of cDNA fragments comprising the complete coding segment of the OsELP3 gene, and in the verification of the function of the OsELP3 gene. From the following description and examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

Example 1: isolation and cloning of OsELP3 Gene

1. Rice RNA extraction and reverse transcription

Total RNA was extracted from fresh leaves of rice of the wild japonica variety Nippon (a publicly used rice material) and extracted using a plant RNA extraction kit (MiniBEST Plant RNA Extraction Kit), and the method of use was described in TaKaRa PrimeScript TMRT reagent Kit with gDNA Eraser. Firstly, carrying out a genome DNA elimination reaction on the obtained RNA sample, and removing a DNA reaction liquid system: 2.0. Mu.L of 5X gDNA Eraser Buffer, 1.0. Mu.L of gDNA Eraser, 1.0. Mu.g of RNA, 6.0. Mu.L of RNase free ddH ₂ O, after being uniformly mixed, the mixture reacts for 2 minutes in a dry bath at 42 ℃; taking out the digested mixed solution to carry out reverse transcription reaction. The reaction system: 1.0 mu L Prime Script RT Enzyme Mix I,4.0 mu L RT Primer Mix,4.0 mu L5X Prime Script Buffer 2,1.0 mu L RNase-Free ddH ₂ O, 10.0. Mu.L of the post-digestion mix. Reverse transcription reaction conditions: 37 ℃ for 15min; stored at 85℃for 5sec at 4 ℃.

2. Analysis of OsELP3 gene expression pattern induced by rice blast bacteria

In order to find out whether the OsELP3 gene participates in the disease resistance process of rice, the invention adopts an RT-qPCR method to detect the OsELP3 gene of wild rice which is not inoculated with rice blast fungus and rice which is inoculated with rice blast fungus after 0, 48, 72, 96 and 144 hoursThe result shows that the OsELP3 gene is extremely obviously induced to up-regulate by rice blast bacteria. Wild type Nippon rice belongs to japonica type conventional rice, and rice blast in vitro leaf inoculation is carried out when the greenhouse grows to 4 leaf stages. Rice blast strain Guy11 is given away by the research team of the university of agricultural university of China, proteus oryzae, huang Jun, proteus oryzae. The rice blast fungus inoculation adopts a conventional leaf cutting method, namely, the front 5cm leaf segment in the rice plants growing to four leaves and one heart stage is inoculated. The rice blast bacteria culture followed published methods. The total RNA is extracted from the inoculating leaves at different time points after inoculation, and is reversely transcribed into cDNA as a template. The OsELP3 specific primer forward primer qOsELP3-F (5'TATCAGAAATGGCACCTCCCTT 3') and reverse primer qOsELP3-R (5'GCCTCTTCAACATTAGCAGAAG 3') were designed using rice endogenous Actin action (Gene accession number AK 101613) as internal reference gene action-F (forward primer 5 'GAGACCTTCAACACACCCCTGCTA-3') and reverse primer action-R (5 'ATCAGAGTCCAACAACTTACCT3'). Real-time quantitative RT-qPCR analysis kitGeeen PCR Master Mix, reference kit instructions), the reaction was performed on a BIO-Rad CFX Connect (manufactured by BIO-Rad Co.) fluorescent quantitative PCR apparatus. The results show that the OsELP3 is extremely obviously subjected to rice blast induction up-regulation expression, which suggests that the OsELP3 may be involved in the resistance response of rice to rice blast.

3. OsELP3 Gene sequence acquisition

The full-length sequence of OsELP3 is cloned by using the forward primer OsELP3-full-F (5'ATGGCCACCGCCGTAGCCGCCGC 3') and the reverse primer OsELP3-full-R (5'TTAGACCAGACATTTGACCATG 3') and cDNA of japonica rice Nippon fine as a template. PCR reaction conditions: pre-denaturation at 94℃for 3min;94℃30sec,59℃30sec,72℃1min 330sec,30 cycles; extending at 72℃for 7min. The amplified PCR product was ligated into pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced, and the positive strains were stored at-80 ℃. Obtaining the required Open Reading Frame (ORF) of the OsELP3 gene, wherein the nucleotide sequence of the ORF is shown in SEQ ID NO: 1. The corresponding 574 amino acids of an Open Reading Frame (ORF) of the OsELP3 gene are determined by BlastX (http:// www.ncbi.nlm.nih.gov), so that the protein sequence coded by the OsELP3 gene is presumed to be shown as a sequence table SEQ ID NO: 2.

Example 2: osELP3 overexpression and CRISPR/Cas9 gene knockout vector construction

1. Construction of overexpression vectors

To verify the gene function of OsELP3, the applicant constructed an overexpression vector to transform embryogenic callus. The plasmid of the OsELP3 positive clone obtained in example 1 was used as a template, an over-expression primer was designed, homologous recombination linker bases were added to both ends of the primer, and the primers were named as forward primer OsELP3-OE-F (5 'GAACGATAGCCGTACCGGTACCATGGCCACCGCCGTAGC') and reverse primer OsELP3-OE-R (5'CTTTGTAATCGGATCCTTAGACCAGACATTTGAC 3'), respectively, and PCR amplification was performed. The PCR product obtained was subjected to agarose electrophoresis and purified recovery (purchased from Tiangen Biochemical technologies (Beijing) Co., ltd.) and stored at-20℃for further use. pU1301-3 flag strain was activated in liquid LB medium (50 mg/L kanamycin was added), plasmids were extracted, double digestion was performed with KpnI and BamHI, and the digested products were purified and recovered and stored at-20℃for use. The fragment of OsELP3 to be spliced, which is recovered by the cleavage, is subjected to Infusion connection with linearization vectors pU1301-3 by using homologous recombinase (purchased from Nanjinouzan Biotechnology Co., ltd.) to obtain recombinant vectors (pU 1301-OsELP3-3 by using the following specific reaction system: 1.0. Mu.L of double-digested linearized pU 1301-3. Mu.L of flag vector, 1.0. Mu.L of 5 XCE II Buffer, 0.5. Mu.L of Exnase II homologous recombinase, 0.8. Mu.L of PCR-purified and recovered product with vector adaptor OsELP3, and the volume was made up to 5.0. Mu.L with sterile ddH 2O. After 0.5h reaction at 37 ℃, E.coli heat shock transformation is carried out, and the strain is E.coli DH5 alpha. The specific transformation flow is as follows: melting E.coli DH5 alpha competent cells preserved at-80 ℃ in ice bath, adding 50 mu L of competent cells into 5 mu L of ligation reaction, gently mixing, and standing on ice for 15-30min; after the ice bath is finished, water bath is carried out for 90sec at 42 ℃, and then the ice bath is rapidly placed on ice for 3min; 400 mu L of LB liquid medium is added, and resuscitated and cultured for 45min at 37 ℃ and 200 rpm; after completion of recovery, centrifugation was carried out at 5000rpm for 2min, 300. Mu.L of the supernatant was discarded, and the cells were resuspended in the remaining supernatant; the bacterial liquid was spread evenly on LB solid medium (50 mg/L kanamycin was added), and the culture was inverted at 37℃overnight. The single clone is selected, 2-3 positive clones are selected and sequenced, and the strain without any mutation and the corresponding plasmid are preserved and named as recombinant plasmid pU1301-OsELP3-3 flag. The recombinant plasmid pU1301-OsELP3-3 of correct sequence is transferred into agrobacterium tumefaciens EHA105 to be competent through a freeze thawing method, single colony is selected to be placed in a YEP liquid culture medium (the YEP liquid culture medium is a common culture medium, 30mg/L rifampicin and 50mg/L kanamycin are added in the embodiment), the recombinant plasmid pU1301-OsELP3-3 of correct sequence is subjected to shaking culture for 36-48h at 28 ℃, and after PCR detection, a proper amount of glycerol is added into positive strains to be preserved at-80 ℃ for standby.

2. CRISPR/Cas9 gene knockout vector construction

CRISPR-P2.0 developed by national key laboratory for genetic improvement of large crops in ChinaCRISPR-P v2.0(hzau.edu.cn)) Guide RNA (gRNA) of OsELP3 was designed. Two gRNAs were designed (i.e., gRNA1:5'GCTGGTGGAGATGATCGCGG 3'; gRNA2:5'GTTGCACGTGACACAAACAG 3') based on the DNA sequence and gene structure of OsELP3. Synthesizing a linker primer ELP3-gRNA1-U3F (5'GCTGGTGGAGATGATCGCGGgttttagagctagaaata 3'), ELP3-gRNA1-U3R (5'CCGCGATCATCTCCACCAGCtgcaccagccgggaat 3'), ELP3-gRNA2-U3F (5'GTTGCACGTGACACAAACAGgttttagagctagaaata 3'), ELP3-gRNA2-U3R (5'CTGTTTGTGTCACGTGCAACtgcaccagccgggaat 3'), and a linker primer S5AD5-F (5 'CAGATGATCCGGCACACACAAACAAAGA3') and S5AD5-R (5 'TTTCTAGCTAAAAAAA3') required for ligating the gRNA into an expression vector pRGEB 32; l5AD5-F (5 'CAGATGATCCGGCGGCAACAAAAGCACCAGGGTCTAG3') and L5AD5-R (5 'TTTCTAGTACTAAAAAAAAAAAAGCACCGGCG3'). PCR amplification was performed using pGTR plasmid as template and three pairs of primers L5AD5-F/ELP3-gRNA1-U3R, ELP3-gRNA1-U3F/ELP3-gRNA2-U3R, ELP-gRNA 2-U3F/L5AD 5-R. PCR reaction conditions: pre-denaturation at 94℃for 3min;94℃for 30sec,59℃for 30sec,72℃for 30sec,26 cycles; extending at 72℃for 7min. Diluting the obtained 3 RCR products by 20-50 times, and uniformly mixing the same volume. mu.L of the above mixture was used as a template and amplified with the S5AD5-F/S5AD5-R primer set. PCR reaction conditions: pre-denaturation at 94℃for 3min;94℃30sec,59℃30sec,72℃45sec,26 cyclesThe method comprises the steps of carrying out a first treatment on the surface of the Extending at 72℃for 7min. Purifying and recovering the obtained product (namely, DNA fragments of two gRNAs in series), and measuring the concentration; and (3) performing enzyme digestion on the CRISPR/Cas9 expression vector pRGEB32 by using BsaI, and purifying and recovering enzyme digestion products to obtain the linearized pRGEB32 vector. The purified PCR product was ligated into linearized pRGEB32 vector using the approach of infusion recombination. Specific reaction conditions are as follows: PCR product 100ng, linearized pRGEB32 vector 50-80ng, infusion enzyme (takara) 1. Mu.L, 10X infusion Buffer 1. Mu.L, add ddH ₂ O to 10. Mu.L, and reacted at 50℃for 30min. And (3) carrying out heat shock transformation on the reaction product to obtain escherichia coli DH5 alpha, selecting a monoclonal to carry out positive detection and sequencing, preserving positive strains and plasmids, and transforming positive plasmids into agrobacterium tumefaciens EHA105 competent. Single colonies are picked up in a YEP liquid culture medium (the YEP liquid culture medium is a common culture medium, 30mg/L rifampicin and 50mg/L kanamycin are added in the embodiment), shake culture is carried out for 36-48h at 28 ℃, and after PCR detection, the positive strains are added with a proper amount of glycerol and are preserved at-80 ℃ for standby. The vectors pGTR and pRGEB32 involved in this example teach the benefit of the university of agriculture Xie Ka in China.

Example 3: genetic transformation of rice

1. Inducing callus: sterile callus induction medium was prepared in advance and 40-50mL of induction medium was poured into a100 mL Erlenmeyer flask. Removing glumes from rice seeds (Japanese sunny variety, the same as above), sterilizing in an ultra-clean bench, soaking seeds in 75% ethanol solution for 1min, and then 0.1% HgCl ₂ Soaking the seeds in the solution for 15-20min, and finally washing with sterile water for 5-10 times. 8-12 seeds are planted in each bottle of culture medium, and the culture medium is dark-cultured at 28 ℃ for 40-50 days to induce the generation of callus;

2. and (3) subculture: preparing a secondary culture medium 2-3 days in advance, wherein the formula of the secondary culture medium is a callus induction culture medium. The culture medium is sterilized by conventional methods to dry the medium (too humid medium is unfavorable for callus growth). Selecting yellowish, granular, dry and strong-activity callus from the induced callus, transferring the callus into a secondary culture medium, and culturing for 20d at 28 ℃;

3. pre-culturing: packaging the sterile preculture medium in 500mL triangular flask in advance, adding 300 mu L100Mm acetosyringone and 5mL 40% glucose into each 250mL culture medium before test, mixing uniformly, and packaging 8-10 dishes of culture medium per flask; picking out light yellow, granular and dry calli with strong activity from the subculture calli, inoculating 60-80 calli with mung bean size in each dish, crushing the calli with sterile forceps, and culturing in dark at 8deg.C for 3d;

4. infection and co-cultivation: 2d before the test, the Agrobacterium strain containing the gene of interest (OsELP 3) was streaked and activated on plates containing antibiotics (30 mg/L rifampicin and 50mg/L kanamycin). Suspension medium (100 mL/strain), co-culture medium (250 mL/strain), large dish, small dish (filled with absorbent paper and filter paper, sterilized and dried before use) and 250mL sterile triangular flask were prepared. The streaked Agrobacterium was scraped into 1/2N6 suspension medium (N6 medium is a common plant tissue medium, 100. Mu.L AS+2mL50% glucose was added) and incubated at 28℃for 30min at 200 rpm. Shaking and simultaneously collecting the pre-cultured calli into 250mL sterile triangular flasks. Pouring the agrobacterium liquid into the callus, and soaking for 30min. Pouring out bacteria liquid, firstly inverting the triangular flask filled with the callus on a sterile small dish, sucking the bacteria liquid, spreading the callus on filter paper of the sterile large dish, covering a piece of filter paper on the filter paper, lightly pressing the callus by using sterilized forceps, sucking the surface bacteria liquid, and naturally drying for 3-4 hours. The fully dried callus is spread evenly on the co-culture medium with a sterilized spoon (preferably no longer removed after spreading to reduce the contact of the medium with the callus surface and prevent overgrowth of Agrobacterium) and dark cultured at 19℃for 3d.

5. Washing and screening (S1 medium for short): preparing sterile water, a large dish, a small dish (containing water absorbing paper and filter paper), a plurality of 250mL triangular flasks and screening culture medium; transferring the co-cultured callus to a water washing cup, pouring sterilized distilled water until the callus is completely immersed, covering a cover, shaking for 20-30sec, and pouring the sterilized distilled water. This was repeated 2-3 times. Adding sterilized distilled water until the callus is completely immersed, covering the callus, shaking, mixing, oscillating for 20-30sec, standing for 5min, and pouring sterilized distilled water. Adding sterilized distilled water until the callus is completely immersed, covering with a cover, shaking, mixing, oscillating for 20-30sec, and standing for 10min. Finally, the sterilized distilled water was poured out, sterilized distilled water containing 500mg/L carbenicillin was added thereto, and the mixture was shaken at 200rpm for 30 minutes. Pouring distilled water out, and naturally drying the callus. Transferring the treated callus to a screening culture medium, and culturing for 20d at 28 ℃ in a dark way;

6. screening (abbreviated as medium S2): preparing a screening culture medium S2, adding 300 mu L of carbenicillin, 250 mu L of hygromycin and 5mL of 50% glucose into each 250mL of culture medium, pouring the culture medium into a dish, and opening a cover on an ultra-clean workbench to blow with sterile wind for 1.5-2 hours, wherein the surface of the screening culture medium is not too wet, otherwise, the inhibition of agrobacterium and the growth of resistant callus are not facilitated during screening; selecting dry callus without agrobacterium pollution from the S1 culture medium, placing on the S2 culture medium (25 to 30 calli are inoculated in each dish), and culturing in dark at 28 ℃ for 20d;

7. callus differentiation: differentiation medium was prepared 3-4 days in advance. Selecting pale yellow, compact and dry resistant callus small pieces, inoculating into differentiation medium, and culturing at 28deg.C under light (illumination intensity 3000 Lux) for 40d, and differentiating seedling in late stage.

8. Rooting: rooting medium is prepared 2-3 days in advance. Preparing 4-5 sterilized empty dishes; extracting differentiated seedlings from the differentiation culture medium, taking one callus, cutting off overlong leaves and roots by scissors, inoculating into rooting tubes, and inoculating 1-2 seedlings into each tube; culturing in a light culture room (illumination intensity 3000 Lux) for 15-20d, hardening seedlings for 4-7d after the roots grow fully, and then transplanting to a greenhouse.

The special culture medium formula for genetic transformation of rice and the preparation thereof are provided in the embodiment of the invention:

the mother solution formula comprises:

MSmax stock solution (10X)

Sequentially dissolving, and then adding distilled water to a volume of 1000mL.

MSmin stock solution (100X)

Note that: na (Na) ₂ MoO ₄ It must be dissolved separately, mixed with other components, added with distilled water to 1000mL, and stored at room temperature.

N6max stock solution (10X)

Sequentially dissolving, and then adding distilled water to a volume of 1000mL.

N6min stock solution (100X)

Distilled water is used for constant volume to 1000mL and is preserved at room temperature.

Fe2+ -EDTA stock solution (100X)

Into a reagent bottle, 300mL of distilled water and FeSO are added ₄ ·7H ₂ O 2.78g；

Into another reagent bottle, 300mL of distilled water was added, and heated to 70℃and then Na was added ₂ EDTA·2H ₂ After dissolving 3.73g of O, the solutions in the two reagent bottles are mixed, incubated at 70 ℃ for 2 hours, then distilled water is added to 1000mL, and the mixture is preserved in a dark place at 4 ℃.

Vitamin stock solution (100X)

Adding distilled water to 1000mL, and preserving at 4deg.C.

AAmax stock solution (10X)

Distilled water is added to the mixture to reach 1000mL, and the mixture is preserved at room temperature and in dark place.

AAmin stock solution (100X)

Na ₂ MoO ₄ Separately dissolving, mixing with other components, adding distilled water to 1000mL, and storing at room temperature in dark place.

9.6-BA stock solution (1 mg/mL)

100mg of 6-BA, 1.0mL of 1M KOH was added thereto and shaken until 6-BA was dissolved, then distilled water was added thereto to a volume of 100mL and stored at room temperature.

KT stock solution (1 mg/mL)

KT 100mg; 1.0mL of 1M KOH was added and shaken until KT was dissolved, then distilled water was added to a volume of 100mL and stored at room temperature.

11.2,4-D stock solution (1 mg/mL)

2, 4-D100 mg, 1.0mL of 1M KOH was added and shaken for 5min, then 10mL of distilled water was added and shaken until 2,4-D was dissolved, and distilled water was used to fix the volume to 100mL and stored at room temperature.

12.100. Mu.M AS stock solution

AS 0.196g；

DMSO 10mL；

Subpackaging with 1.5mL centrifuge tube, and preserving at 4deg.C.

IAA stock solution (1 mg/mL)

IAA 100mg was added with 1.0ml of 1N KOH and shaken until IAA was dissolved, then the volume was fixed to 100ml with dH2O, and stored at room temperature in a dark place.

NAA stock solution (1 mg/mL)

NAA 100mg was added with 1.0mL of 1M KOH and shaken until NAA was dissolved, and then distilled water was used to fix the volume to 100mL, and the mixture was stored at room temperature in a dark place.

The formula of the culture medium comprises:

1. induction medium

pH value: 5.9

Distilled water was added to volume 1000mL.

2. Subculture medium

Distilled water was added to volume 1000mL.

3. Pre-culture medium

Distilled water was added to volume to 250mL.

4. Co-culture medium

/>

Distilled water was added to volume to 250mL.

5. Suspension medium

Distilled water was added to volume to 100mL.

6. Screening media

Adding distilled water to constant volume to 250Ml

7. Differentiation medium

/>

Distilled water was added to volume 1000mL.

8. Rooting culture medium

Distilled water was added to volume 1000mL.

Example 4: inoculation identification of transgenic material Pyricularia oryzae

1. Tomato oat medium OM configuration: boiling water to boil, weighing 40g of oatmeal, adding into boiling water, boiling for 30min, and filtering to obtain juice; 150mL of freshly squeezed tomato juice is added into oat juice, water is added to fix the volume to 1L, and 1.6% Agar (Agar) is added; and (3) conventional high-temperature high-pressure sterilization. Culture medium for producing spore of Pyricularia oryzae is prepared by adding 0.6g CaCO into 1L culture medium ₃ 。

2. Purification and preservation of Magnaporthe grisea strains: the conidium liquid of the rice blast germ is coated on a 1.6% water agar plate by a liquid transfer device in an ultra-clean workbench, the plate is placed in a 28 ℃ incubator, after incubation for 12 hours, single germinated conidium is picked by a picking needle under a dissecting mirror, and the single germinated conidium liquid is inoculated on an OM plate and placed in the 28 ℃ incubator. After 2-3d incubation, mycelia formed by germination of individual conidia were transferred to new OM plates, and these single spore purified strains were used for subsequent experiments. The mycelium pellet of the strain to be preserved was spotted onto an OM plate on which a sterilized filter paper sheet had been laid, and placed in an incubator at 28 ℃. After the colony grows up to the culture dish, the filter paper sheet is taken out and put into a sterilized sulfuric acid paper bag. The sulfuric acid paper bag was placed in a desiccator for one week and transferred to a sealed container for storage at-20 ℃.

3. Producing spores: wild strain Guy11 is inoculated on an OM flat plate and placed in a 28 ℃ illumination incubator for inverted culture. After 5d growth, the hyphae are fully broken by a fungus coating ring, evenly coated on a new OM flat plate, and placed in a 28 ℃ illumination incubator for inverted culture. After 36h, the newly born aerial hyphae which are visible to naked eyes are gently washed off by a cotton swab, covered with double-layer gauze and placed at 28 ℃ for illumination culture. After 48h, conidia on OTA plates were thoroughly washed with 30mL distilled water into 50mL centrifuge tubes.

4. Spore liquid inoculation: the conidia were washed from the above-mentioned OM plate cultured for 5d with 30mL of 0.025% Tween solution, and then filtered into a 50mL centrifuge tube via a funnel made of three-layer mirror-cleaning paper, and the concentration of the conidia was adjusted to 2X 10 ⁵ And each mL. Sucking 5-10 mu L of spore suspension with a regulated concentration, and inoculating the spore suspension onto the surface of rice leaves. Sealing the inoculating box with sealing film to preserve heat and moisture, and shading with black cloth for culturing. After 36h, the black cloth is removed, the culture is carried out by visible light (illumination intensity), the sealing film is removed after the culture is continued for 48h, and the onset of disease is generally started after 5d after inoculation.

Claims

1. Application of extension factor complex subunit OsELP3 gene in regulating and controlling rice blast resistance.