CN116836993A - Duke pear bHLH transcription factor gene PbebHLH155 and application thereof - Google Patents

Abstract

The invention discloses a birch-leaf pear bHLH transcription factor PbebHLH155 and application thereof, belonging to the technical field of biological genetic engineering. The PbebHLH155 gene has a nucleotide sequence shown as SEQ ID NO.1 and an amino acid sequence shown as SEQ ID NO. 2. The invention has the beneficial effects that: obtaining the iron deficiency resistant gene of the pyrus pyrifolia, constructing an over-expression recombinant vector by using the gene, and proving the function of the gene in the aspect of iron deficiency resistance by using molecular biology and transgenic technology. Arabidopsis and pear calli overexpressing PbebHLH155 are significantly more resistant to iron deficiency than wild-type plants and calli. And, the activity of Arabidopsis FCR and the chlorophyll content of leaves which are over-expressed with PbebHLH155 are obviously higher than that of wild plants. The FCR activity and iron content of the overexpressed PbebHLH155 callus are obviously higher than those of wild callus. Therefore, pbebHLH155 can be introduced into plants as a target gene to promote iron absorption in plants.

Description

Duke pear bHLH transcription factor gene PbebHLH155 and application thereof

Technical Field

The invention relates to the technical field of biological gene engineering, in particular to a birthwort bHLH transcription factor gene PbebHLH155 and application thereof.

Background

The bHLH transcription factor family is the second largest eukaryotic transcription factor family in plants, and has important regulation and control effects on plant growth and development and abiotic stress. bHLH has a highly conserved domain consisting of approximately 60 amino acids, has two functionally distinct regions, one is an N-terminal basic region containing 13-17 basic amino acids, is capable of binding to the cis-acting element E-BOX (5 '-CACGTG-3') on the gene of interest, and the other is a C-terminal HLH (helix-loop-helix) region consisting of two α -helices, linked by a variable length loop, wherein proteins containing HLH motifs can form homodimers or heteromultimers with other proteins and contribute to specific binding of DNA (ferer et al 2011). At present, crops such as rice (Li et al, 2006), peanut (Gao et al, 2017), corn (Zhang et al, 2018), poplar (Lorenzo et al, 2010), tomato (Wang et al, 2015) and the like all have reports of bHLH transcription factors, and research on bHLH transcription factors participating in iron deficiency regulation also has achieved certain results.

bHLH transcription factors are widely found in various tissues of higher plants, involved in various signal transduction, anabolism, and adverse stress responses, with some members involved in the plant's mechanisms to regulate iron ion balance. A novel bHLH transcription factor, ntbHLH1, plays a key role in regulating the iron deficiency response of tobacco (Li et al 2020). Double overexpression of the GmbHLH57 and GmbHLH300 genes in soybean improved the iron deficiency resistance of plants (Li et al, 2018). OsbHLH058 and OsbHLH059 transcription factors positively regulate the iron deficiency response of rice (Kobayashi et al, 2019). Overexpression of the MdbHLH104 gene significantly increased H in iron deficiency conditions ⁺ ATPase Activity, promoting iron uptake by transgenic apple plants and calliReceive (Zhao et al, 2016). The above is the research on the bHLH transcription factor in the aspect of iron deficiency, but the research on the transcription factor in the aspect of regulating the plant iron deficiency resistance in pears has not been reported yet.

The Chinese patent application document with publication number of CN104031923A discloses a cold-resistant transcription factor PubHLH of sorbic and application thereof. The nucleotide sequence of the sorbic bHLH transcription factor gene PubHLH is shown as a sequence table SEQ ID NO:1, in SEQ ID NO:1 is the coding region of the gene at 409-2043bp of the sequence shown in 1; the coded amino acid sequence is shown in a sequence table SEQ ID NO: 2. The patent clones a new bHLH gene PubHLH from the sorb, utilizes an agrobacterium-mediated genetic transformation method to transform the gene into tobacco and pear, and the cold resistance of the obtained transgenic plant is obviously improved. However, the sorbitol cold-resistant transcription factor PubHLH of the patent does not have the effect of regulating iron absorption of plants.

Disclosure of Invention

The technical problem to be solved by the invention is how to provide an application of a pear PbebHLH155 gene in regulating and controlling plant iron absorption.

The invention solves the technical problems by the following technical means:

the first aspect of the invention provides a birthwort transcription factor gene PbebHLH155, and the nucleotide sequence of the birthwort bHLH transcription factor gene PbebHLH155 is shown in SEQ ID NO. 1.

The beneficial effects are that: the invention discloses a birthwort bHLH transcription factor gene PbebHLH155, which is first reported in pears. Functional verification of transgenic Arabidopsis thaliana and pear callus shows that the over-expression of the gene significantly promotes the iron absorption of Arabidopsis thaliana plants and callus. Therefore, it is expected that the gene is introduced into plants as a target gene to improve the iron deficiency resistance of the plants, thereby improving plant varieties.

The second aspect of the invention provides a protein encoded by the gene PbebHLH155, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

A third aspect of the present invention provides a biological material comprising the gene PbebHLH155 described above, including but not limited to recombinant DNA, expression vectors, host bacteria or plant material.

Preferably, the expression vector is a pCAMBIA-1300 vector plasmid.

Preferably, the host bacterium is agrobacterium GV3101.

Preferably, the plant material includes, but is not limited to, calli of Arabidopsis, pear.

A fourth aspect of the invention proposes the use of the above-described gene PbebHLH155 or a biological material containing the gene PbebHLH155 in any of the following situations:

1) For increasing the resistance of plants to iron deficiency stress;

2) A degree for promoting acidification of the plant roots;

3) For increasing high iron reductase (FCR) activity of plants under iron deficiency stress;

4) For the preparation of transgenic plants;

5) Is used for plant breeding.

Preferably, the plants include, but are not limited to, arabidopsis thaliana, pear callus.

In a fifth aspect, the present invention provides a method of regulating iron uptake by arabidopsis thaliana or pear callus tissue, the method comprising:

(1) Comprising the gene PbebHLH155 or PbebHLH155 of claim 1

(2) Allowing plants to overexpress the gene PbebHLH155 of claim 1.

Preferably, the methods include, but are not limited to, cloning of the PbebHLH155 sequence, construction of the PbebHLH155 gene sequence into a super-expression vector, transformation of a strain with a recombinant vector, transgenesis, and propagation of transgenic material.

The sixth aspect of the invention provides an application of the protein encoded by the birthwort bHLH transcription factor gene PbebHLH155 in regulating and controlling iron absorption of plants.

The invention has the advantages that:

the invention discloses a pear bHLH transcription factor gene PbebHLH155 and a protein encoded by the gene, which is reported for the first time in pears. Functional verification of transgenic Arabidopsis thaliana and pear callus shows that the over-expression of the gene significantly promotes the iron absorption of Arabidopsis thaliana plants and callus. Therefore, it is expected that the gene is introduced into plants as a target gene to improve the iron deficiency resistance of the plants, thereby improving plant varieties.

Drawings

FIG. 1 is a graph showing the relative expression level of the PbebHLH155 gene in the iron deficiency treatment of example 2, wherein the iron deficiency treatments 0, 24, 48 and 60 hours are respectively performed on the pyrus pyrifolia material, and the expression level of the PbebHLH155 gene in each time period of the iron deficiency treatment is analyzed;

FIG. 2 is a phenotypic map of PbebHLH155 Arabidopsis seedlings overexpressed in example 4 in MS medium with normal iron content (+Fe) and iron deficiency (-Fe), where PbebHLH155-OE-1, pbebHLH155-OE-2 represent two overexpressed transgenic lines and WT is wild-type;

FIG. 3 is the FCR (high valent iron reductase) activity of transgenic Arabidopsis lines (PbebHLH 155-OE-1, pbebHLH 155-OE-2) and wild-type material (WT) in +Fe and-Fe culture in example 4;

FIG. 4 is chlorophyll content of transgenic Arabidopsis lines (PbebHLH 155-OE-1, pbebHLH 155-OE-2) and wild-type material (WT) in +Fe and-Fe culture in example 4;

FIG. 5 is a phenotype of transgenic calli in MS medium of +Fe and-Fe in example 5, wherein PbebHLH155-OE-1, pbebHLH155-OE-2 represent two overexpressed transgenic lines, WT wild-type;

FIG. 6 is FCR activity of transgenic calli (PbebHLH 155-OE-1, pbebHLH 155-OE-2) and wild-type calli (WT) in +Fe and-Fe culture in example 5;

FIG. 7 shows the iron content of transgenic calli (PbebHLH 155-OE-1, pbebHLH 155-OE-2) and wild-type calli (WT) in +Fe and-Fe culture in example 5.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described in the following in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1: acquisition of the PbebHLH155 Gene

Collecting the seed of fructus Pyri from pear producing area in Anhui, chengzhou, and collecting the seed of fructus Pyri, treating with sand, and accelerating germination to obtain seedling. And then carrying out iron deficiency treatment on the seedlings, and screening out plants with the strongest iron deficiency resistance. Plant leaves are collected, total RNA of the samples is extracted by using an RNA extraction kit, and cDNA is obtained by reverse transcription.

According to the transcriptome sequencing results of samples before and after iron deficiency treatment of the iron deficiency resistant pyrus pyrifolia seedlings, selecting a PbebHLH155 sequence with complete ORF and differential expression, and designing primers P1 and P2 on the upstream and downstream of CDS of a gene according to Primer Premier 5 software;

P1：ATGGAGGAAATTATATCCTCTTGTTCT；(SEQ ID NO：3)

P2：GTTGTACCATCTGTTCAAAATAGCAGT。(SEQ ID NO：4)

pre-denaturing the pear cDNA as template at 95 deg.c for 1min; denaturation at 95℃for 20s; annealing at 58-60 ℃ for 20s; extending at 72 ℃ for 30s; after 40 cycles, the mixture was further amplified at 72℃for 10 minutes as a reaction condition, and after the amplification was completed, 10. Mu.L of 6 XLoading Buffer was added and mixed uniformly, followed by detection by agarose gel electrophoresis, and the target band was recovered.

The sequence was found to be identical to the sequence in the genome and the gene name was PbebHLH155. The nucleotide sequence of PbebHLH155 is shown in SEQ ID NO:1, the coded amino acid sequence is shown as SEQ ID NO: 2.

Example 2: analysis of expression of PbebHLH155 Gene

On the basis of screening iron deficiency resistant birch-leaf seedlings in the early stage, selecting iron deficiency resistant gene type birch-leaf leaves for detoxification and sterilization treatment. And inducing callus and buds through tissue culture to obtain 12 pear tissue culture seedlings. After the growth state is stable, carrying out iron deficiency treatment on 12 pear seedlings, sampling at 0h, 24h, 48h and 60h respectively after the treatment, rapidly placing the pear seedlings into liquid nitrogen for freezing, and storing the pear seedlings in a refrigerator at the temperature of minus 80 ℃. And extracting total RNA of the sample by using the RNA extraction kit respectively, and performing reverse transcription to obtain cDNA.

Quantitative primers P3 and P4 designed based on the PbebHLH155 sequence;

P3：TGAACGCACTAAAAGACCTGGA；(SEQ ID NO：5)

P4：CCATGAGGCACTCTTACCACAA。(SEQ ID NO：6)

preparing a reaction system according to the operation of a kit by taking an Actin of a pear reference gene as a control, wherein each reaction is repeated for 3 times; the reaction program was set up in the StepOne Real-time PCR System instrument as follows: pre-denaturation at 95℃for 2min, denaturation at 95℃for 15s, annealing at 60℃for 15-20s, extension at 72℃for 20-30s, and running for 40 cycles. At 2 ^-ΔΔCT The calculation method of (2) analyzes and calculates the fluorescence quantitative result. The results showed that PbebHLH155 expression levels were significantly increased at 48 hours after iron deficiency treatment (as shown in fig. 1).

Example 3: construction of super-expression vector of PbebHLH155 gene

The restriction endonuclease provided by Shangying biosciences, inc. is used for carrying out double enzyme digestion on the enzyme digestion sites Xba I and BamH I of the pCAMBIA-1300 vector plasmid, the sample is added according to the system requirement, then the reaction is carried out for 2 hours at 37 ℃, the double enzyme digestion target strip is obtained through agarose gel electrophoresis, and the cut gel is recovered, thus obtaining the linearization vector.

Two restriction sites of Xba I and BamH I are selected, and primers P5 and P6 are designed by using CE Design V1.04 software;

P5：GAGAACACGGGGGACTCTAGAATGGAGGAAATTATATCCTCTTGTTCT；(SEQ ID NO：7)

P6：GCCCTTGCTCACCATGGATCCGTTGTACCATCTGTTCAAAATAGCAGT。

(SEQ ID NO：8)

and (3) carrying out PCR amplification by taking a target gene bacterial liquid with a correct sequencing result as a template, adding 10 mu L of 6×loading Buffer into the amplified product, uniformly mixing, carrying out agarose gel electrophoresis detection, recovering a target strip, and preserving at-20 ℃.

Finally using Hieff offered by YEASEN IncPlus One Step Cloning Kit the insert was subjected to a recombination reaction with a linearized vector. The reaction product is transformed into escherichia coli again, and the plate is coatedThen placing the culture medium in a 37 ℃ incubator for culturing for 12 hours, picking a monoclonal colony, culturing the monoclonal colony in a liquid LB culture medium containing 100mg/L kanamycin sulfate (Kan) for 3 hours in a shaking way, and detecting the monoclonal colony, a carrier and a primer. After sequencing and comparison are correct, 50% glycerol is added according to the volume ratio of 1:1, and the mixture is stored in a refrigerator at the temperature of minus 80 ℃.

Example 4: arabidopsis transformation and screening

The transgenic arabidopsis thaliana is obtained by an agrobacterium-mediated inflorescence infection method. Selecting an arabidopsis plant in a full-bloom stage, and removing redundant flower pods to leave buds. Subsequently, an invader solution was prepared, and sucrose (30 g/L final concentration) and Silwet L-77 (200. Mu.l final concentration) were added to the MS liquid medium. After the agrobacterium transferred into the PbebHLH155 overexpression vector is activated, shaking until the OD600 = 0.8-1.0. The agrobacteria are centrifuged, the supernatant is decanted and the agrobacteria pellet is resuspended with the infecting solution. And then, completely immersing the arabidopsis inflorescences in the infection liquid for 60s, completely wrapping flowers with a preservative film to preserve moisture after infection, culturing in dark for 1d, lifting the preservative film the next day, and carrying out infection again after 5-6 d. Cleaning seeds, airing, uniformly spot-sowing the seeds on a screening culture medium containing hygromycin, and culturing the seeds in an illumination incubator. After 2-3 true leaves grow on the seedlings, extracting leaf DNA from the seedlings with normal growth and developed root systems, and identifying, wherein positive plants are T0 plants. And harvesting the T0 generation seeds, continuously planting the obtained positive strain, and harvesting the seeds by a single plant.

(1) Identification of iron deficiency resistance (MS medium method): taking a proper amount of transgenic arabidopsis seeds and wild type seeds in a 2mL centrifuge tube, cleaning the seeds, air-drying, then spot-seeding in a normal MS and iron-deficiency MS solid culture medium, normally culturing in a light incubator at 28 ℃, and observing phenotype differences. Throughout the growth, the MS plates were placed vertically.

After 2 weeks of growth on the medium, the leaves of the plants of the different lines showed a difference in yellowing degree. The results show that on the culture medium with normal iron content, the growth conditions and the yellowing degree of the wild type and the transgenic plants have no obvious difference; whereas on iron-deficient medium, leaves of the PbebHLH155 overexpressing arabidopsis plants were significantly greener than wild-type plants (as shown in fig. 2).

(2) Iron deficiency physiological index determination: FCR activity analysis and chlorophyll content determination were performed on wild-type and overexpressed PbebHLH155 arabidopsis under normal and iron deficiency conditions, respectively. The results showed that the over-expressed PbebHLH155 and wild-type arabidopsis grown on medium with normal iron content, did not have significant differences in FCR activity in roots and chlorophyll content in leaves (as shown in fig. 3). The FCR activity in the iron-deficiency treated overexpressed PbebHLH155 Arabidopsis roots is significantly higher than in the wild Arabidopsis roots; and, chlorophyll content in leaves of PbebHLH155 overexpressing plants was significantly higher than that of wild-type plants (as shown in fig. 4). It is shown that the overexpression of PbebHLH155 significantly promotes iron uptake by Arabidopsis plants.

Example 5: transformation verification of pear callus

The recombinant plasmid of the PbebHLH155 constructed to the super-expression vector is transformed into agrobacterium GV3101 (host bacterium), and after plating, the recombinant plasmid is cultured for 2-3d in a 28 ℃ incubator, and single colony is selected for PCR detection. And taking a single colony of the agrobacterium with positive PCR detection, carrying out shake culture until the OD600 value of the bacterial liquid is between 0.6 and 0.8, and collecting thalli. The cells were resuspended in an ultra clean bench and the OD600 was adjusted to 0.6-0.8. Then activating and inducing the bacterial liquid in a shaking table for 1h. Taking the callus, grinding, putting into an conical flask with bacteria liquid, continuously shaking for 10-30min, and keeping away from light. After the bacterial liquid in the callus is sucked to be dry, the bacterial liquid grows on an MS co-culture medium for 2 days, and is cultivated at 25 ℃ in a dark place. Then transferring to MS screening culture medium, dark culturing at 25deg.C, and culturing for a period of time.

(1) Identification of iron deficiency resistance (MS medium method): wild-type and transgenic calli grown normally on MS plates were transferred to iron-deficient MS plates and incubated in the dark at 25℃for 30 days to observe phenotypic differences. Throughout the growth process, the MS plates were placed horizontally.

The growth conditions of wild-type and overexpressed PbebHLH155 calli have no obvious difference before iron deficiency treatment; and after iron deficiency treatment, the growth amount of the PbebHLH155 transgenic callus is obviously higher than that of the wild callus. The degree of yellowing of wild-type calli was more severe than that of the PbebHLH155 calli overexpressed (as shown in fig. 5).

(2) Iron deficiency physiological index determination: FCR activity analysis and iron content determination were performed on wild-type and overexpressed PbebHLH155 calli under normal and iron deficiency conditions, respectively. The super-expressed PbebHLH155 and wild-type calli grown on medium with normal iron content did not differ significantly in both their FCR activity and iron content (as shown in fig. 6). The FCR activity in the iron-deficiency treated overexpression PbebHLH155 callus is obviously higher than that of the wild callus; moreover, the iron content of PbebHLH155 overexpressing calli was significantly higher than that of wild-type calli (as shown in fig. 7). It is shown that overexpression of PbebHLH155 significantly promotes iron uptake by pear callus.

The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims (10)

1. A birchlamydia trachycarpa transcription factor gene PbebHLH155 is characterized in that the nucleotide sequence is shown in SEQ ID NO. 1.

2. A protein encoded by the birch-leaf pear bHLH transcription factor gene PbebHLH155 of claim 1, wherein the amino acid sequence is shown in SEQ ID No. 2.

3. A biological material comprising the birch-leaf pear bHLH transcription factor gene PbebHLH155 of claim 1, wherein the biological material is recombinant DNA, an expression vector, a host bacterium, or a plant material.

4. A biomaterial according to claim 3 wherein the expression vector is a pCAMBIA-1300 vector plasmid.

5. A biomaterial according to claim 3, wherein the host bacterium is agrobacterium GV3101; the plant material is callus of Arabidopsis thaliana and pear.

6. Use of the gene PbebHLH155 of claim 1 or the biomaterial of claim 3 in any of the following cases:

1) For increasing the resistance of plants to iron deficiency stress;

2) A degree for promoting acidification of the plant roots;

3) For increasing high iron reductase (FCR) activity of plants under iron deficiency stress;

4) For the preparation of transgenic plants;

5) Is used for plant breeding.

7. The use according to claim 6, wherein the plants are arabidopsis thaliana or pear calli.

8. A method of modulating iron uptake by arabidopsis or pear callus tissue, the method comprising:

(1) Comprising the gene PbebHLH155 or PbebHLH155 of claim 1

(2) Allowing plants to overexpress the gene PbebHLH155 of claim 1.

9. The method of claim 8, wherein the method comprises cloning the PbebHLH155 sequence, constructing the PbebHLH155 gene sequence into an over-expression vector, transforming a strain with a recombinant vector, propagating a transgene, or propagating a transgenic material.

10. Use of the protein encoded by the birch-leaf pear bHLH transcription factor gene PbebHLH155 of claim 2 for regulating iron absorption in plants.