CN116814623A

CN116814623A - Application of MOTOR gene in preparation of medicine for treating sepsis and medicine

Info

Publication number: CN116814623A
Application number: CN202310773883.9A
Authority: CN
Inventors: 黄蔚; 邱海波; 方可; 谢剑锋; 刘玲; 杨毅; 杨然
Original assignee: Southeast University
Current assignee: Southeast University
Priority date: 2023-06-28
Filing date: 2023-06-28
Publication date: 2023-09-29

Abstract

The application discloses an application of hsa_circRNA gene MOTOR in preparation of a medicine for treating sepsis and a medicine, and belongs to the technical field of circRNA coding small peptide genes. Based on the gene sequence of hsa_circRNA_056558, a vector overexpressing hsa_circRNA_056558 was constructed by molecular cloning, transfected into cells, and exosomes produced by the cells, including MOTOR, were collected by ultracentrifugation. MOTOR can enhance monocyte function, and can be used for sepsis immunomodulatory treatment.

Description

Application of MOTOR gene in preparation of medicine for treating sepsis and medicine

Technical Field

The application relates to the technical field of gene of small peptide coded by circRNA, in particular to application of MOTOR gene in preparation of a medicine for treating sepsis and a medicine.

Background

Sepsis (sepsis) is a malfunction of life-threatening organs caused by deregulation of the body's response to infection, and presents a great threat to human health. The multi-center cross section research in China shows that: the sepsis patients in China account for about 20.6% of ICU hospitalization, and the death rate of the patients in 90 days is as high as 35.5%. Therefore, the intensive research on the pathogenesis of sepsis and the search for new therapeutic target molecules are both the prevention and treatment requirements of serious national and social diseases and the great challenges facing the clinic.

Immune imbalance is the underlying mechanism of sepsis development. Although multiple organ damage caused by excessive inflammatory reactions is an important link in the pathogenesis of sepsis, the Gao Yan state of sepsis is often accompanied by long-term and persistent immunosuppression. Monocytic LPS tolerance is a key feature of sepsis immunosuppression. The ability of LPS-resistant monocyte internalization to kill pathogenic microorganisms is reduced and an effective response is not made at the time of secondary infection, leading to an increased risk of secondary infection in sepsis patients, which is precisely the leading cause of death in sepsis patients. However, the exact mechanism of LPS tolerance of monocytes is not yet elucidated, and the lack of molecular drugs for regulating LPS tolerance of monocytes is a core problem which is seriously required.

Disclosure of Invention

Aiming at the defects of the prior art, the application provides application of hsa_circRNA gene MOTOR in preparation of medicines for treating sepsis, and the MOTOR reverses LPS tolerance of sepsis mononuclear cells and prolongs survival time of mice.

The aim of the application can be achieved by the following technical scheme:

the first aspect of the application provides application of a MOTOR gene or a medicinal derivative thereof in preparing a medicament for treating sepsis, wherein the nucleotide sequence of the MOTOR gene is shown as SEQ NO. 1.

Further, the medicament is used in a dosage form suitable for releasing the MOTOR gene or a pharmaceutically acceptable derivative thereof in the peripheral blood of a user.

The application also provides a medicament comprising an exosome comprising a MOTOR gene; the nucleotide sequence of the MOTOR gene is shown as SEQ NO. 1.

The medicine of the application can be added with conventional auxiliary materials and prepared into various pharmaceutically acceptable dosage forms, such as tablets, capsules, oral liquid, troches, injections, ointments, granules or various sustained and controlled release preparations and the like according to the conventional process.

The carriers of the medicament of the application are of the usual types available in the pharmaceutical field and include: binding agents, lubricants, disintegrants, co-solvents, diluents, stabilizers, suspending agents or matrices, and the like.

Preferably, the dosage form is an injection.

The application has the beneficial effects that:

the hsa_circRNA_056558 gene sequence can reverse monocyte LPS tolerance during sepsis, promote expression of chemotactic factors, pro-inflammatory cytokines and antigen presenting genes secreted by single cells under bacterial infection, regulate inherent immunity and adaptive immunity of patients with sepsis, prevent secondary infection and improve survival time.

Drawings

The application is further described below with reference to the accompanying drawings.

FIG. 1 is a schematic diagram of a cytoplasmic localization of MOTOR of the present application;

FIG. 2 is a graph showing expression of knockdown MOTOR of the present application inhibiting inflammatory factors and chemokines;

FIG. 3 is a graph showing the expression of over-expressed MOTOR-promoted inflammatory and chemokines of the application;

FIG. 4 is a graph showing particle size analysis of Motor exosomes according to the present application.

Detailed Description

The following description of the embodiments of the present application will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present application, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

In the description of the present specification, the descriptions of the terms "one embodiment," "example," "specific example," and the like, mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present application. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples.

The application adopts the following steps to verify the influence of MOTOR on the tolerance of monocyte LPS in sepsis, and the specific steps are shown in the accompanying figures 1-4;

example 1MOTOR is a coding capability of circRNA capable of translating 137aa of small peptide

1.1 identification of MOTOR as a circRNA by PCR and Sanger, prediction of the coding ability of MOTOR by bioinformatics, verification of the coding ability and subcellular localization of MOTOR by Westernblot and immunofluorescence techniques, the translation of MOTOR to small peptides localized to the cytoplasm was found (see FIG. 1).

1.1.1PCR and Sanger sequencing experiments

(1) RNA extraction:

a) Preparing required reagents and consumables: trizol; chloroform; isopropyl alcohol; DEPC water; gun heads with different specifications of Rnase-free; 1.5mLRnase-freep tube

b) The operation is specifically as follows: human monocyte THP1 was collected in EP tubes, and after 1ml Trizol was added to each EP tube, the cells were repeatedly blown off with a pipette until no cell pellet was seen; precooling to 4deg.C with a centrifuge, adding 0.2ml chloroform into each EP tube, swirling for 15s, and standing at room temperature for 5min; setting the centrifugation condition to 12000rcf, and centrifuging for 15 minutes; after centrifugation, the mixture is divided into three layers, wherein the upper layer is colorless aqueous RNA, the middle layer and the lower layer are organic phenol chloroform layers, an EP tube is carefully taken out, 0.4ml of supernatant is vertically sucked, 0.5ml of isopropanol is added, the mixture is inverted and mixed uniformly for ten times, and the mixture is stood for 10 minutes at room temperature; setting the centrifugation condition to 12000rcf for 10 minutes; then the supernatant is discarded, 75% ethanol prepared by DEPC water is added into each EP tube, and the mixture is inverted and mixed uniformly; setting the centrifugation condition to 7500rcf for 5 minutes, and taking out the discarded supernatant; transiently separating for 15 seconds, discarding supernatant, and retaining RNA precipitation; RNA concentration was then measured spectrophotometrically after 30ul of DEPC water was added to dissolve the precipitate, followed by adjusting the concentration to 1ng/ul using DEPC water.

(2) Reverse transcription PCR: using reverse transcription kit (PrimeScript ^TM RT reagent Kit with gDNA Eraser, TAKARA, RR 047A) reverse transcription PCR was performed on 500ng of RNA.

(3) And (2) PCR: the cDNA obtained in the previous step was three-fold diluted with RNase-free water and prepared according to the following system:

2×PCRbufferforKODFX	25.0μl
		Primer1(10μM)	0.4μl
Primer2(10μM)	0.4μl
		2mMdNTPs	10.0μl
TemplateDNA/cDNA	2.0μl
		KODFX(1.0U/μl)	1.0μl
ddH2O	To20.0μl

the PCR primer sequences were as follows:

MOTOR-F	GGCAGAAGTGAAAGATACAACC
		MOTOR-R	ACTCCTCCTGCCAGATTACAGAT

after the PCR system was prepared, the reaction was performed using a Bio-Rad PCR apparatus, and the PCR product was sent to Shanghai Biotechnology for Sanger sequencing (FIG. 1).

1.1.2Western Blot experiment

(1) Protein extraction experiment:

a) Preparing required reagents and consumables: RIPA protein lysate; cocktail protease inhibitors; sterilized 1.5ml EP tube

b) The specific operation is as follows: FLAG-MOTOR plasmid was transfected into cells in 12-well plates, 100. Mu.l of RIPA and Cocktail inhibitor were added, and the mixture was ice-incubated for 10min; then setting the centrifugation condition at 12000rpm and 4 ℃ for 20min; carefully pipetting the supernatant as the desired protein. Adding 5xloading buffer,100 deg.C and heating for 5min.

(2) Immunoblotting experiments

a) And (3) glue preparation: preparation of a kit using a 12% PAGE gel (Bio-rad; 64484826) A12% SDS-PAGE gel was prepared:

1.3 ml of ResolverA and ResolverB solutions were taken, respectively, and 3. Mu.l TEMED and 30. Mu.l 10% AP were added. Vibrating and mixing uniformly, and injecting into a glue-making glass plate, wherein the distance between the liquid level and the upper edge of the short glass plate is 0.5cm longer than that of the comb teeth; 1ml of StackA and ResolverB solutions were taken, respectively, and 2. Mu.l of TEMED and 10. Mu.l of 10% AP were added. Vibrating and mixing uniformly, injecting into a glue-making glass plate, and inserting comb teeth;

2. after waiting for 30 minutes, the upper layer is gelled and fixed, and the comb teeth are pulled out for electrophoresis.

b) Electrophoresis:

1. placing the solidified rubber plate into an electrophoresis tank, and adding a sufficient amount of 1xRunning buffer;

2. mixing the boiled protein sample by vortex, and respectively adding 5 mu L of molecular weight protein standard sample and 15 mu L of protein sample into sample application holes after instantaneous separation;

3. setting electrophoresis conditions: constant pressure 200v,45 min;

c) Transferring:

1. cutting PVDF film with corresponding size according to the target strip, and waking up with methanol for 10 minutes;

2. after electrophoresis, using a glue opener to pry the glass plate, cutting off the separating glue, and placing the separating glue in a transfer film buffer solution;

3. using a sandwich method: the whole process of operation is operated in the film transfer liquid, and the film is gently rolled layer by layer to remove bubbles.

4. Setting film transfer conditions: constant current 300mA for 60 minutes, adding 1x film transferring liquid; the transfer film tank is required to be placed in a low-temperature environment because heat is generated in the transfer film process.

d) Closing:

1. the membrane was placed in a previously prepared blocking solution (2.5 g bovine serum albumin +50 ml1 xTBST) and blocked for 1 hour on a shaking table at normal temperature.

f) Immune response:

1. slowly washing off the surface blocking solution by using 1 xTBST;

2. primary antibody (5 μl flag primary antibody +10ml1 xTBST) was formulated and added to the incubation cassette so that the membrane could be gently rocked in the cassette with a shaker overnight at 4 ℃.

3. Recovering the primary antibody, washing the membrane 3 times by using 1xTBST, incubating the secondary antibody at normal temperature after 7 minutes each time for 60 minutes, recovering the secondary antibody, and washing the membrane 3 times by using 1xTBST for 7 minutes each time. The membrane was immersed in a 1xTBST solution for the next step.

g) Color reaction

1. Opening an Eblot ultrasensitive full-automatic luminescence imaging analysis system;

2. according to the luminous solution A: liquid b=1:1, and the pipettor was spread evenly onto the film, and the exposure was photographed.

The results indicate that Flag-MOTOR can be detected, indicating that MOTOR can encode a protein.

1.1.3 immunofluorescent staining

(1) Incubation with primary antibody

Flag-MOTORTHP1 cells were harvested, 4% PFA was fixed at room temperature for 1h, and rinsed 3 times with PBS for 5min each; after Blocking with Blocking medium (1% fetal bovine serum+0.5% Triton x-100) for 1h at room temperature, 1: the Flag antibody was diluted 200 and incubated overnight at 4 ℃.

(2) Second antibody incubation

Rinsing with PBS 3 times for 5min each; the corresponding secondary antibody was then pressed with PBS 1:400 dilutions (further DAPI 1:1000 dilution), incubation at room temperature for 1h followed by 3 rinses with PBS 5min each, nail oil sealing plates; the pictures were taken with a confocal microscope.

The results showed that Flag-MOTOR was mainly present in the cytoplasm.

Example 2 knockdown of MOTOR inhibits chemokines and pro-inflammatory cytokines released by monocytes stimulated by LPS

2.1 ordering siRNA targeting specifically MOTOR circRNA by in vitro culture of human monocyte THP1, transfecting the MOTOR-targeted siRNA and control siRNA into cells using NEON electrotransfection system, and adding 1 μg/ml LPS 24h after transfection, and harvesting cells 24h after LPS treatment. Expression of cytokines and antigen presentation related factors was detected by second generation sequencing and qPCR, and knockdown MOTORs were found to significantly inhibit their expression (see figure 2).

2.1.1 second Generation sequencing and analysis

(1) Cells were collected, centrifuged at 500rcf for 5min at room temperature, the medium was discarded, the cell pellet was washed once with PBS, and 1ml Trizol was added.

(2) Trizol samples containing cells were snap frozen in liquid nitrogen for 30s and sent to the company for second generation sequencing by dry ice.

(3) After the company returns sequencing data, the expression of chemokines and pro-inflammatory factors is analyzed, the FPKM and z-score algorithm are utilized to perform normalization processing, and a heat map is made to reflect the expression difference of related genes.

2.1.2 qPCR

(1) The qPCR system was formulated as follows:

cDNA	2μL
		SYBR	5μL
F-primer	0.2μL
		R-primer	0.2μL
ddH ₂ O	2.6μL
		Total	10μL

and (3) performing qPCR on-machine detection, analyzing the obtained CT value, and calculating the expression levels of the corresponding chemotactic factors and the pro-inflammatory factors.

The results show that knocking down MOTOR with siRNA can significantly reduce expression levels of chemokines and pro-inflammatory factors in both second generation sequencing and qPCR assays.

Example 3 overexpression of MOTOR chemokines and pro-inflammatory cytokines promoting monocyte release under LPS stimulation

Over-expression of moter in monocytes by means of lentiviral infection the effect of over-expression of moter on cytokine release from monocytes under LPS stimulation was examined by qPCR and was found to promote the response of monocytes to LPS (see figure 3).

3.1 lentivirus packaging and purification

(1) Co-transfecting HEK293T cells with vsvg, rev, gag and Flag-MOTOR plasmids; wherein the nucleotide sequence of the MOTOR plasmid encoding the biological factor MOTOR is shown in SEQ NO. 1.

(2) After 48 hours of transfection, the supernatant from the dishes was harvested and replaced with fresh DMEM medium containing 1% fbs. After 96 hours, the supernatant was collected a second time.

(3) Adding 1/5 of the virus concentrate, mixing, and standing at 4deg.C overnight.

(4) Centrifuging the supernatant containing the virus concentrate at 4deg.C for 11000rcf for 30min, discarding the supernatant, and precipitating to obtain virus particles. The virus was resuspended in 1.5ml DMEM medium and stored in a-80℃refrigerator.

3.2 lentiviral infection

(1) Take 2x10 ⁵ THP1 cells were placed in 12-well plates, 500. Mu.l of virus solution was added, and the mixture was placed in a cell incubator for culture.

(2) One week after infection puromycin was added and the screened cells were MOTOR overexpressing cells (MOTOR OE).

3.3 detection of chemokines and proinflammatory cytokines

(1) MOTOR OE and control cells were stimulated with 1. Mu.g/ml LPS, and after 24h the cells were collected by centrifugation and RNA was extracted.

(2) Detection of chemokine and proinflammatory cytokine expression Using qPCR

The results show that over-expression of MOTOR significantly increases expression of chemokines and pro-inflammatory cytokines.

Example 4 MOTOR-containing exosomes extend survival time of sepsis mice

The exosomes over-expressing MOTOR are collected and injected into sepsis mice in a tail vein injection mode, so that the survival time of the sepsis mice can be remarkably prolonged.

4.1 extraction of MOTOR-containing exosomes

(1) Collecting supernatant of 293T and 293T cells over expressing MOTOR, centrifuging 500g for 5min, discarding precipitate, and retaining supernatant; centrifuging at 2000g for 5min, discarding the precipitate, and retaining the supernatant; centrifuging at 12000g for 30min, discarding precipitate, and retaining supernatant; centrifuging for 90min at 200000g, discarding supernatant, and retaining precipitate; the pellet was resuspended in PBS, centrifuged at 200000g for 90min, the supernatant discarded, the pellet retained and resuspended in 200ul PBS.

(2) Negative dyeing and electron microscope photographing are carried out

4.2 injecting MOTOR-containing exosomes and control exosomes into sepsis mice, and observing the survival time of the mice

4.2.1 cecal ligation puncture (Cecum ligation andpuncture, CLP) to establish a sepsis mouse model

(1) C57BL/6 wild type mice (Male, 6-7w,20-29 g), anesthetized animals were sheared about 0.5cm below the ventral midline xiphoid, the cecum was probed and pulled slowly outside the abdominal cavity, the cecum was ligated, after 2 times in the middle of the ligation band, it was confirmed that no significant bleeding would be left to avoid the cecum and still be contained in the abdomen, 0.9% saline 1ml antishock treatment was performed subcutaneously, and water was freely fed after the operation, keeping room temperature constant.

(2) The exosomes were diluted to 1x10 per 200 μl with PBS ⁹ The individual exosomes, 200 μl of exosome solution was injected into mice by tail vein injection at 24h, 48h and 72h of sepsis model.

(3) The time to first injection of exosomes was recorded as 0h, and survival of mice was observed and recorded every 24 h.

The results show that injection of MOTOR-containing exosomes can significantly extend survival time of sepsis mice.

FIG. 1 shows that MOTOR is a coding-capable circRNA; a. First generation sequencing of MOTOR schematic and junction site; B. RNA encoding ability of raw message prediction, CDR1as and HOTAIR are classical circle RNA and lncRNA, respectively, which are proved to be non-coding proteins, and function in RNA form, actin is a definite protein encoding gene; the western blot shows that the Flag antibody can detect Flag-MOTOR; D. Flag-MOTOR immunofluorescence was shown. FIG. 2 is an RNA-seq (A) and qPCR (B) expression of a knockdown MOTOR-inhibiting chemokine and antigen presenting related molecule showing expression of a chemokine and cellular antigen presenting related molecule after knockdown MOTOR;

FIG. 3 shows that overexpression of MOTOR promotes the expression level of MOTOR following the chemokine A. Overexpression of MOTOR for monocyte analysis under LPS stimulation; B. mRNA levels of CCL2, CCL3 and CCL4 under LPS stimulation after over-expression of MOTOR were detected for qRT-PCR.

MOTOR-containing exosomes in FIG. 4 promote the survival time of sepsis mice A and B.NTA and electron microscopy analysis showed that exosomes were mentioned by this method; C. exosomes containing MOTOR were injected into mice by tail vein injection and found to significantly increase survival time of muscle sepsis mice.

The foregoing has shown and described the basic principles, principal features and advantages of the application. It will be understood by those skilled in the art that the present application is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present application, and various changes and modifications may be made without departing from the spirit and scope of the application, which is defined in the appended claims.

Claims

The application of MOTOR gene or its medicinal derivative in preparing medicine for treating sepsis is characterized in that the nucleotide sequence of MOTOR gene is shown as SEQNO. 1.
2. The use according to claim 1, wherein the medicament is in a dosage form suitable for releasing the MOTOR gene or a pharmaceutically acceptable derivative thereof in the peripheral blood of a user.
3. The use according to claim 2, wherein the dosage form is a tablet, capsule, liquid, lozenge, aerosol, injection, ointment, granule.
4. The use according to claim 3, wherein the dosage form is an injection.
5. A medicament for preventing or treating sepsis, characterized in that the medicament comprises an exosome comprising a MOTOR gene; the nucleotide sequence of the MOTOR gene is shown as SEQ NO. 1.
6. The medicament according to claim 5, which is in the form of tablets, capsules, solutions, lozenges, aerosols, injections, ointments, granules.
7. The medicament according to claim 6, wherein the dosage form is an injection.