CN107903319A - Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris - Google Patents
Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris Download PDFInfo
- Publication number
- CN107903319A CN107903319A CN201711462568.5A CN201711462568A CN107903319A CN 107903319 A CN107903319 A CN 107903319A CN 201711462568 A CN201711462568 A CN 201711462568A CN 107903319 A CN107903319 A CN 107903319A
- Authority
- CN
- China
- Prior art keywords
- trp1
- expression
- wssv
- ppiczaa
- red claw
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/66—Thymopoietins
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/184—Hormones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Endocrinology (AREA)
- Gastroenterology & Hepatology (AREA)
- Polymers & Plastics (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Animal Husbandry (AREA)
- Food Science & Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris, are related to red claw crayfish thymus gland fibroin.Red claw crayfish thymosin extrasin is named as Cq TRP1.According to pPICZaA vector multiple cloning sites, the specific forward primer F1 and anti-sense primer R1 of design amplification coding red claw crayfish Cq TRP1 genes ORF, in the 5 ' end addition EcoR I restriction enzyme sites of sense primer F1；In the base of the 5 ' end addition XbaI enzyme cutting sites of anti-sense primer R1, terminator codon and coding His tag.Cq TRP1 genes are connected to carrier for expression of eukaryon pPICZaA, build pPICZaA Cq TRP1 carrier for expression of eukaryon；Gained recombinant eukaryotic expression plasmid is imported in Pichia pastoris, induced expression is carried out to it, obtains expression product；First the expression product of gained is dialysed, then affinity chromatography.
Description
Technical field
The present invention relates to red claw crayfish thymus gland fibroin, has more particularly, to the thymus gland fibroin and suppresses guttate morphea syndrome
The function that viral (WSSV) is replicated, using technique for gene engineering, builds red claw crayfish thymosin extrasin protein gene expression carrier, establishes
Expression and its application process of a kind of thymosin extrasin PROTEIN C q-TRP1 with Anti-infection to WSSV activity in Pichia pastoris.
Background technology
White spot syndrome virus (White spot syndrome virus, WSSV) is to cause shrimp culture especially right
One of pathogeny of shrimp aquaculture, economic cultivation of the virus to aquatic products crustacean cause great threat, therefore, improve shrimps
Anti-infection to WSSV ability is the emphasis and difficult point studied at present.Shrimps not can be used for the cell line of research at present, this is to shrimps
The preventing and controlling of Study on Molecular Mechanism and later stage to Anti-infection to WSSV cause obstruction.Red claw crayfish
(Cheraxquadricarinatus) it is one of economic shrimp species of freshwater aquiculture, its hematopoietic tissue (Hematopoietic
Tissue, Hpt) stem cell can in vitro culture, therefore using red claw crayfish as research mode shrimp, opened by cultivating its Hpt cell
Research of the shrimps to Anti-infection to WSSV molecular mechanism is opened up to have great importance.
Thymosin extrasin was found from embryo's ox thymus protein extracting solution first by Goldstein and White in 1966
Micromolecule polypeptide containing various ingredients, can be divided into α, β, γ three classes according to the difference of isoelectric point, wherein β races thymosin extrasin (β-
Thymosin) it is small molecule albumen of the isoelectric point between 5.0~7.0[1].Red claw crayfish described in this patent
(Cheraxquadricarinatus) thymus gland fibroin (Thymosin-repeated protein1, TRP1), is named as Cq-
TRP1, its PREDICTION FOR THE ISOELECTRIC POINT value are 5.3, are β races thymosin extrasin.β races thymosin extrasin is a kind of highly conserved superfamily in evolution
Albumen, containing 40~44 amino acid, molecular weight is about 5kDa or so.β thymosin extrasins are a series of tissues and cell actin
Effective regulatory factor of polymerization, is distributed widely in vertebrate and invertebrate, it is raw in immunological regulation, body development etc.
Play a significant role in reason activity[2,3].In most of mammals, extrasin beta 4 is that β races thymosin extrasins is primarily present form,
Account for the 70%-80% of its total content.In eucaryote, extrasin beta 4 is one of main chelating molecule of actin[4], chest
Thymosin beta 4 promotes the immunoloregulation function such as cell survival and regeneration with Apoptosis is prevented[5]。
The thymosin extrasin of oceanic invertebrate has identity function with human thymosin beta 4, such as can be with G-actin monomer knots
Close, prevent G-actin in the extension polymerization of F-actin (F-actin) "+,-" end[6].Quickly it is moved through when cell is in
, it is necessary to which the F-actin of net distribution coordinates and then quick assembling during journey, it can discharge G-actin rapidly again, there is provided F-actin
Raw material needed for synthesis[7].Studies have shown that is subject to virus and bacterium when invertebrates such as red claw crayfish, haliotis diversicolor Reeve and bollworms
After stimulation, the expression of thymosin extrasin gene is significantly raised in haemocyte[8-11], display thymosin extrasin be probably it is important it is immune because
Son.Infection of the cytoskeleton F-actin of host for virus is essential, and thymosin extrasin combination G-actin, plays adjusting
Effect, there is research prompting thymosin extrasin to participate in the antiviral process of body[12-13].Chest is found in bollworm spermary cell
Parathyrine can adjust the assembling of F-actin and then change cellular morphology to resist AcMNPV (Autographacalifornica M
Nucleopolyhedrovirus, AcMNPV) infection[14].According to having studied, in virus infection, host may
By adjusting the expression of thymosin extrasin and then the assembling for regulating and controlling F-actin to hinder the duplication of progeny virus, resist so as to play assistance
The effect of virus[15].Therefore WSSV is prevented in the research in terms of the expression and purification and function of development red claw crayfish thymus gland fibroin
Control significant.
Bibliography：
[1]Goldstein A L,Slater F D,White A.Preparation,Assay,and Partial
Purification of a ThymicLymphocytopoietic Factor(Thymosin)[J].Proceedings of
the National Academy of Sciences of the United States of America,1966,56(3):
1010.
[2] Gomez-Marquez J, AnadonR.The beta-thymosins, small actinbinding
peptides widely expressed in the developing and adultcerebellum[J]
.Cerebellum,2002,1(2):95-102.
[3] Manuel M, Kruse M, Muller WE, et al.The comparison of beta-thymosin
homologues among metazoa supports an arthropod-nematode clade[J].J MolEvol,
2000,51(4).
[4]Erickson-Viitanen S,Ruggieri S,Natalini P,et al.Distribution of
thymosinβ4,in vertebrate classes[J].Archives of Biochemistry&Biophysics,1983,
221(2):570-576.
[5]Sosne G,Siddiqi A W M.Thymosin-beta4Inhibits Corneal Epithelial
Cell Apoptosis after Ethanol Exposure In Vitro[J].Invest Ophthalmol Vis Sci,
2004,45(4):1095-1100.
[6]Safer D,Chowrashi P K.Beta-thymosins from marine invertebrates:
primary structure and interaction with actin[J].Cell Motil Cytoskeleton,1997,
38(2):163-171.
[7]Huff T,Zerzawy D,Hannappel E.Interactions of beta-thymosins,
thymosin beta 4-sulfoxide,and N-terminally truncated thymosin beta 4with
actin studied by equilibrium centrifugation,chemical cross-linking and
viscometry[J].Eur J Biochem,1995,230(2):650-657.
[8]Zhang F X,Shao H L,Wang J X,et al.Beta-thymosin is upregulated by
the steroid hormone20-hydroxyecdysone and microorganisms[J].Insect MolBiol,
2011,20(4):519-527.
[9]Ramirez-Gomez F,Ortiz-Pineda P A,Rojas-Cartagena C,et al.Immune-
related genes associated with intestinal tissue in the sea
cucumberHolothuriaglaberrima[J].Immunogenetics,2008,60(1):57-71.
[10]Liu H P,Chen R Y,Zhang Q X,et al.Differential gene expression
profile from haematopoietic tissue stem cells of red claw crayfish,
Cheraxquadricarinatus, in response to WSSV infection [J] .Dev Comp Immunol, 2011,
35(7):716-724.
[11]Wu L,Wu X.Molecular cloning and expression analysis of a beta-
thymosin homologue from a gastropod abalone,Haliotisdiversicolorsupertexta
[J].Fish Shellfish Immunol,2009,27(2):379-382.
[12]Cibulka J,Fraiberk M,Forstova J.Nuclear actin and lamins in viral
infections[J].Viruses,2012,4(3):325–347.
[13]Xu H,Yao L,Lu S,et al.Host filamentous actin is associated with
Heliothisarmigera single nucleopolyhedrosis virus(HaSNPV)nucleocapsid
transport to the host nucleus[J].Curr Microbiol,2007,54(3):199-206.
[14]Zhang X,Chen M,Ma X,et al.Suppression of AcMNPV replication byadf
and thymosin protein up-regulation in a new testis cell line,Ha-shl-t[J].Arch
Insect BiochemPhysiol,2013,82(3):158-171.
[15]Saelee N,Noonin C,Nupan B,et al.Beta-thymosins and hemocyte
Homeostasis in a crustacean [J] .PLoS One, 2013,8 (4):e60974.
The content of the invention
The first object of the present invention is to can be used for the red claw crayfish thymosin extrasin PROTEIN C q- for obtaining a kind of Anti-infection to WSSV
The structure of the recombinant eukaryotic expression plasmid of TRP1.
The second object of the present invention is to provide the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 for preparing a kind of Anti-infection to WSSV
Method, i.e., the induced expression in eukaryotic expression system Pichia pastoris, has the advantages that yield high (about 10mg/L), easy purification,
It is to obtain crustacean thymus gland fibroin using the method for Yeast expression first.
The third object of the present invention is the application for providing red claw crayfish thymosin extrasin PROTEIN C q-TRP1, that is, recombinates red chela chela
Shrimp thymus gland fibroin has the function of that suppressing WSSV replicates, and has potential interest value in prevention and control WSSV diseases.
The red claw crayfish thymosin extrasin is named as Cq-TRP1.
The eucaryon recombination expression of the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 that can be used for obtaining Anti-infection to WSSV a kind of
The construction method of carrier is as follows：
According to pPICZaA vector multiple cloning sites, design amplification coding red claw crayfish Cq-TRP1 (cDNA) genes ORF's
Specific forward primer F1 and anti-sense primer R1, in the 5 ' end addition EcoR I restriction enzyme sites of sense primer F1；In anti-sense primer
5 ' end addition XbaI enzyme cutting sites, terminator codon and the base for encoding His-tag of R1.
Sense primer F：
5′-CCGGAATTCAGCACCGAATCCTCACTCA-3′
Anti-sense primer R：
5′-GCTCTAGATTAATGATGATGATGATGGTGGGCTTTCTTCTCCTGCTCAATCT-3′。
PCR reaction conditions are：94 DEG C of pre-degeneration 3min；30s60 DEG C of annealing 30s of 94 DEG C of denaturation, 72 DEG C of extension 30s, repeat
30 circulations；72 DEG C of extension 10min.
PCR product is recycled using agarose gel purification kit, the PCR product of recycling is after EcoRI and XbaI enzyme cutting
Purifying recycling, is connected with EcoRI and XbaI double digestions linearisation pPICZaA carriers, builds Pichia anomala expression recombinant vector
PPICZaA-Cq-TRP1, sequencing identification reading frame are accurate.
The preparation method of the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 of the Anti-infection to WSSV comprises the following steps：
1) Cq-TRP1 recombinant expression carriers are built：Cq-TRP1 genes are connected to carrier for expression of eukaryon pPICZaA, are built
PPICZaA-Cq-TRP1 carrier for expression of eukaryon；
2) recombinant eukaryotic expression plasmid obtained by step 1) is imported in Pichia pastoris, and induced expression is carried out to it, obtained
Expression product；
3) first the expression product obtained by step 2) is dialysed, then carries out affinity chromatography.
The application of the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 is as follows：
Restructuring red claw crayfish thymus gland fibroin have the function of to suppress WSSV replicate, in prevention and control WSSV diseases with potential
Interest value, rCq-TRP1 is inhibited to WSSV infection duplications, is preparing anti-WSSV kind new medicines and is resisting as animal
There is potential using value in sick feed addictive.
The present invention successfully builds recombinant eukaryotic expression plasmid and in Bichi yeast system according to Cq-TRP1 gene sequence characteristics
Middle expression, purifying obtain recombinant C q-TRP1 albumen, which, which has, suppresses the functional activity that WSSV is replicated.Result of study
Show, rCq-TRP1 can suppress infection duplications of the WSSV in red claw crayfish Hpt cells, be a kind of important anti-WSSV because
Son.Therefore, recombination engineering product Cq-TRP1 albumen has in anti-WSSV kind new medicines development and application potentially applies valency
Value.
The present invention relates to a kind of new gene engineering product：Come from the recombination expression and its system of red claw crayfish thymus gland fibroin
Preparation Method, recombinant C q-TRP1 albumen can suppress infection duplications of the WSSV in red claw crayfish hematopoietic tissue (Hpt) stem cell,
It is a kind of genetic engineered product with anti-WSSV activity, there is important answer in terms of effective prevention of anti-guttate morphea syndrome disease
Use prospect.
Brief description of the drawings
Fig. 1 is pPICZaA-Cq-TRP1 construction of eukaryotic expression vector figures.
Fig. 2 is the electrophoresis that SDS-PAGE analyzes the expression of pPICZaA-Cq-TRP1 recombinant yeast pichia pastoris clones methanol induction
Collection of illustrative plates.M is SDS-PAGE standard proteins Marker；1 is full supernatant of bacteria solution before methanol induction；2nd, 3 be respectively methanol induction 12h
With the secreting, expressing situation of destination protein in 24h supernatant of bacteria solution.From Figure 2 it can be seen that induction purpose band 15kDa-20kDa it
Between, about 18kDa.
Fig. 3 is that SDS-PAGE analyzes pPICZaA-Cq-TRP1 recombinant yeast pichia pastoris methanol inductions expression product after purification
Electrophoresis pattern.In figure 3, rCq-TRP1 albumen size theoretical value 14.3kDa, it is actual to induce table due to glycosylated influence
The molecular weight of albumen reached is higher than theoretical value, about 18kDa, and traction phenomenon occurs in recombinant protein.
Western Blot are identified after Fig. 4 transfects Hpt cells 4h for recombinant protein Cq-TRP1, His-GFP.
Fig. 5 anticipates Hpt cell 4h for recombinant protein Cq-TRP1, and sample is collected when infecting WSSV (MOI=1) 6h, examines
Survey the duplication situation of WSSV pole early gene IE1.
Fig. 6 anticipates Hpt cell 4h for recombinant protein Cq-TRP1, and sample is collected when infecting WSSV (MOI=1) 6h, examines
Survey the duplication situation of WSSV Envelope Protein Genes VP28.
The results show that Cq-TRP1 recombinant proteins can significantly inhibit WSSV poles early gene IE1, Envelope Protein Gene
Transcriptions of the VP28 in Hpt cells.
Embodiment
Technical scheme is described with reference to the accompanying drawings by the following examples.
The structure of 1 red claw crayfish thymosin extrasin Cq-TRP1 carrier for expression of eukaryon of embodiment
According to pPICZaA vector multiple cloning sites, design amplification coding red claw crayfish Cq-TRP1 (cDNA) genes ORF's
Specific forward primer F1 and anti-sense primer R1.In the 5 ' end addition EcoR I restriction enzyme sites of sense primer F1；In anti-sense primer
5 ' end addition XbaI enzyme cutting sites, terminator codon and the base for encoding His-tag of R1.
Sense primer F：5 '-CCGGAATTCAGCACCGAATCCTCACTCA-3 ', anti-sense primer R：5′-GC
TCTAGATTAATGATGATGATGATGGTGGGCTTTCTTCTCCTGCTCAATCT-3′。
PCR reaction conditions are：94 DEG C of pre-degeneration 3min；30s60 DEG C of annealing 30s of 94 DEG C of denaturation, 72 DEG C of extension 30s, repeat
30 circulations；72 DEG C of extension 10min.
PCR product is recycled using agarose gel purification kit, the PCR product of recycling is after EcoRI and XbaI enzyme cutting
Purifying recycling, is connected with EcoRI and XbaI double digestions linearisation pPICZaA carriers, builds Pichia anomala expression recombinant vector
PPICZaA-Cq-TRP1, sequencing identification reading frame are accurate.
PPICZaA-Cq-TRP1 vector construction figures are referring to Fig. 1.
Induced expression of the embodiment 2pPICZaA-Cq-TRP1 recombinant plasmids in Pichia pastoris GS115
Correct pPICZaA-Cq-TRP1 plasmids are sequenced through BamHI linearization for enzyme restriction, are converted with electric shocking method to Pichia pastoris
In GS115 competent cells, and expressed with methanol induction.
The results show that compared with before induction, the Pichia pastoris GS115 induction of pPICZaA-Cq-TRP1 recombinant plasmid transformeds
After can express recombinant protein, size is about 18kDa, and the expressing quantity of methanol induction 24h is significantly raised compared with 12h (referring to figure
2)。
Expression product of the embodiment 3pPICZaA-Cq-TRP1 recombinant plasmids in Pichia pastoris GS115 after methanol induction is pure
Change
Cq-TRP1 recombinant proteins, a large amount of induced expression positive restructuring Pichia pastoris GS115 bacterium are purified using affinity chromatography
After strain, microorganism collection culture medium supernatant 1L is removed by centrifugation (4 DEG C, 12000rpm centrifugations 30min), in dialyzate (50mM phosphorus
Phthalate buffer, 50mM NaCl) in dialysis three times (dialyse 12h every time), obtain upper prop sample.Then use metal chelating layer
Analyse column and affinity chromatography is carried out to the albumen after dialysis.Eluting peak component is collected, is shown through SDS-PAGE electrophoretic analysis (referring to Fig. 3)
There are 2 bands, an about 18kDa, another is about 16kDa, and through Mass Spectrometric Identification, 18kDa and two bands of 16kDa are red chela
Crayfish rCq-TRP1 albumen.
Embodiment 4 recombinantly expresses anti-WSSV activity experiments outside Cq-TRP1 proteosomes
The anti-WSSV activity identifications of rCq-TRP1 albumen：
Crayfish hematopoietic tissue stem cell is cultivated in 24 and 96 porocyte culture plates first, is placed in 20 DEG C of incubators and trains
Support, calculated according to every 1 μ g of hole of 24 orifice plates, 96 orifice plates per hole 0.5ugrCq-TRP1 protein contents, by recombinant protein and transfection reagent room
Temperature incubates 15min altogether, is then added in the cell of culture, wherein Control groups：Only add the transfection reagent of isodose；PBS groups：Together
The transfection reagent of the equivalent PBS buffer identical with albumen volume (with PBS buffer dialysed and temporarily preserved by rCq-TRP1 albumen
It is spare)；RGFP-His groups：The transfection reagent of isodose and 1 μ g inert proteins rGFP-His；RCq-TRP1 groups：Isodose turns
Transfection reagent and 1 μ grCq-TRP1 albumen are experimental group (see Fig. 4,5,6).Albumen and transfection reagent mixed liquor are added to culture
4h to be incubated altogether in cell for 26 DEG C, removes nutrient solution, 96 orifice plate cells collect sample and carry out Western Blot identifications (see Fig. 4), and 24
Orifice plate carries out WSSV infection according to every hole MOI=1, and cell is collected when WSSV infects 6h, extracts cell total rna, takes 1 μ g
Total serum IgE reverse transcription is into cDNA after DnaseI processing.WSSV viruses pole early gene in above-mentioned sample is detected using the method for qPCR
The transcriptional expression of IE1 (see Fig. 5) and Envelope Protein Gene VP28 (see Fig. 6), using 16s rRNA genes as internal reference, the primer is such as
Table 1.
Table 1
The results show that rCq-TRP1 albumen in-vitro transfection processing Hpt cells in IE1 and VP28 mRNA expressions compared with
Control group substantially reduces, and shows that the transcription of WSSV in rCq-TRP1 albumen treatment groups replicates and receives obvious suppression, the result
Illustrate that rCq-TRP1 has the function of that suppressing WSSV replicates.
The present invention obtains red claw crayfish Cq-TRP1 gene engineering expression products, and the activity of its antiviral duplication is carried out
Identification, to in the developing of anti-WSSV novel drugs.The present invention successfully constructs red claw crayfish Cq-TRP1 gene works
Journey recombinant expression pPICZaA-Cq-TRP1 and corresponding eukaryotic expression system, are obtaining Cq-TRP1 recombinant expression proteins
Afterwards, the activity of recombinant protein is further demonstrated, i.e., after albumen transfection Hpt cells, significantly inhibits the infection duplication of WSSV, determines
Cq-TRP1 has the function of Anti-infection to WSSV, and as anti-WSSV disease controls novel drugs key foundation is established for it.
Sequence table
<110>Xiamen University
<120>Expression and application of a kind of thymosin extrasin PROTEIN C q-TRP1 of Anti-infection to WSSV in Pichia pastoris
<141> 2017-12-07
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 582
<212> DNA
<213>Red claw crayfish (Cheraxquadricarinatus)
<400> 1
acgcggggag ttgagctttg gatttcacag aggtaggacg tattcatttc tcacatttta 60
ttgtgttgaa gtttgcttct ccacccaaca ccatgagcac cgaatcctca ctcaaggact 120
tgcctaaggt tgacactgcc cttaagggac aactggaggg cttctctccc gacaaactga 180
aaaagacaga cactgcggag aaaaccgctt tacctaccaa ggaagacgtg gcgcaggaga 240
agcaacacaa tgagctcctt gagaacatca gccaatttcg cagtgaaaga ctgaaacgaa 300
cttctacttc ggagaagatc gtccttccta cacctgaaga tatcgatgcg gaaaagggtc 360
aacaggctct ccgtgagggt attgagggct ttaacccttc tgcactgaaa aaaacacaga 420
cacaagagaa gtgcgttctc ccaactaagg aagagattga gcaggagaag aaagcctaat 480
aaggagtgcg acagcagtgc tgtgcatagc gcatccaagt gatatccttc tccccgctcc 540
ctttgaactt ccttgggagt tctgcaagcc aaaatgtttt gt 582
<210> 2
<211> 128
<212> PRT
<213>Red claw crayfish (Cheraxquadricarinatus)
<400> 2
Met Ser Thr Glu Ser Ser Leu Lys Asp Leu Pro Lys Val Asp Thr Ala
1 5 10 15
Leu Lys Gly Gln Leu Glu Gly Phe Ser Pro Asp Lys Leu Lys Lys Thr
20 25 30
Asp Thr Ala Glu Lys Thr Ala Leu Pro Thr Lys Glu Asp Val Ala Gln
35 40 45
Glu Lys Gln His Asn Glu Leu Leu Glu Asn Ile Ser Gln Phe Arg Ser
50 55 60
Glu Arg Leu Lys Arg Thr Ser Thr Ser Glu Lys Ile Val Leu Pro Thr
65 70 75 80
Pro Glu Asp Ile Asp Ala Glu Lys Gly Gln Gln Ala Leu Arg Glu Gly
85 90 95
Ile Glu Gly Phe Asn Pro Ser Ala Leu Lys Lys Thr Gln Thr Gln Glu
100 105 110
Lys Cys Val Leu Pro Thr Lys Glu Glu Ile Glu Gln Glu Lys Lys Ala
115 120 125
Claims (4)
1. red claw crayfish thymosin extrasin is named as Cq-TRP1.
2. the recombinant eukaryotic expression plasmid available for the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 for obtaining a kind of Anti-infection to WSSV
Construction method, it is characterised in that its step is as follows：
According to pPICZaA vector multiple cloning sites, design amplification coding red claw crayfish Cq-TRP1 (cDNA) genes ORF's is special
Property sense primer F1 and anti-sense primer R1, sense primer F1 5 ' end addition EcoR I restriction enzyme sites；Anti-sense primer R1's
5 ' ends addition XbaI enzyme cutting site, terminator codon and the base for encoding His-tag；
Sense primer F：
5′-CCGGAATTCAGCACCGAATCCTCACTCA-3′
Anti-sense primer R：
5′-GCTCTAGATTAATGATGATGATGATGGTGGGCTTTCTTCTCCTGCTCAATCT-3′；
PCR reaction conditions are：94 DEG C of pre-degeneration 3min；30s60 DEG C of annealing 30s of 94 DEG C of denaturation, 72 DEG C of extension 30s, repeat 30
Circulation；72 DEG C of extension 10min；
PCR product is recycled using agarose gel purification kit, the PCR product of recycling purifies after EcoRI and XbaI enzyme cutting
Recycling, is connected with EcoRI and XbaI double digestions linearisation pPICZaA carriers, builds Pichia anomala expression recombinant vector
PPICZaA-Cq-TRP1, sequencing identification reading frame are accurate.
3. the preparation method of the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 of Anti-infection to WSSV, it is characterised in that comprise the following steps：
1) Cq-TRP1 recombinant expression carriers are built：Cq-TRP1 genes are connected to carrier for expression of eukaryon pPICZaA, are built
PPICZaA-Cq-TRP1 carrier for expression of eukaryon；
2) recombinant eukaryotic expression plasmid obtained by step 1) is imported in Pichia pastoris, and induced expression is carried out to it, expressed
Product；
3) first the expression product obtained by step 2) is dialysed, then carries out affinity chromatography.
4. the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 preparation methods of Anti-infection to WSSV as claimed in claim 3, it is characterised in that
The application of the red claw crayfish thymosin extrasin PROTEIN C q-TRP1 includes：
Restructuring red claw crayfish thymus gland fibroin has the function of that suppressing WSSV replicates, has potential profit in prevention and control WSSV diseases
Benefit value, rCq-TRP1 are inhibited to WSSV infection duplications, are preparing anti-WSSV kind new medicines and raised as animal disease resistant
There is potential using value in feed additives.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711462568.5A CN107903319A (en) | 2017-12-28 | 2017-12-28 | Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711462568.5A CN107903319A (en) | 2017-12-28 | 2017-12-28 | Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107903319A true CN107903319A (en) | 2018-04-13 |
Family
ID=61871799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711462568.5A Pending CN107903319A (en) | 2017-12-28 | 2017-12-28 | Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107903319A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116874575A (en) * | 2023-08-28 | 2023-10-13 | 广西中医药大学 | Apostichopus japonicus antibacterial peptide and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102352363A (en) * | 2011-10-25 | 2012-02-15 | 厦门大学 | Scylla paramamosain antiviral type lipopolysaccharide resistant factor as well as preparation method and application thereof |
| CN104087593A (en) * | 2014-07-10 | 2014-10-08 | 厦门大学 | Anti-white spot syndrome virus (WSSV) autophagy associated gene Cq-Atg8 and preparation method and application thereof |
| CN105219779A (en) * | 2015-11-12 | 2016-01-06 | 厦门大学 | Red claw crayfish coagulogen and preparation method thereof and application |
| CN105274134A (en) * | 2015-11-25 | 2016-01-27 | 厦门大学 | Preparation method and application of scylla paramamosain antimicrobial peptide SCY2 |
| CN107502612A (en) * | 2017-09-30 | 2017-12-22 | 厦门大学 | It is a kind of to identify with reference to WSSV laminin receptor gene C q LR and preparation method and application |
-
2017
- 2017-12-28 CN CN201711462568.5A patent/CN107903319A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102352363A (en) * | 2011-10-25 | 2012-02-15 | 厦门大学 | Scylla paramamosain antiviral type lipopolysaccharide resistant factor as well as preparation method and application thereof |
| CN104087593A (en) * | 2014-07-10 | 2014-10-08 | 厦门大学 | Anti-white spot syndrome virus (WSSV) autophagy associated gene Cq-Atg8 and preparation method and application thereof |
| CN105219779A (en) * | 2015-11-12 | 2016-01-06 | 厦门大学 | Red claw crayfish coagulogen and preparation method thereof and application |
| CN105274134A (en) * | 2015-11-25 | 2016-01-27 | 厦门大学 | Preparation method and application of scylla paramamosain antimicrobial peptide SCY2 |
| CN107502612A (en) * | 2017-09-30 | 2017-12-22 | 厦门大学 | It is a kind of to identify with reference to WSSV laminin receptor gene C q LR and preparation method and application |
Non-Patent Citations (2)
| Title |
|---|
| HAI-PENG LIU等: "《Cherax quadricarinatus clone V12-617 thymosin-repeated protein 1 mRNA, complete cds》", 《GENBANK》 * |
| HAI-PENG LIU等: "《Differential gene expression profile from haematopoietic tissue stem cells of red claw crayfish, Cherax quadricarinatus, in response to WSSV infection》", 《DEVELOPMENTAL AND COMPARATIVE IMMUNOLOGY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116874575A (en) * | 2023-08-28 | 2023-10-13 | 广西中医药大学 | Apostichopus japonicus antibacterial peptide and application thereof |
| CN116874575B (en) * | 2023-08-28 | 2024-04-19 | 广西中医药大学 | Apostichopus japonicus antibacterial peptide and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kappler et al. | Insect immunity. Two 17 bp repeats nesting a kappa B‐related sequence confer inducibility to the diptericin gene and bind a polypeptide in bacteria‐challenged Drosophila. | |
| JPS63500003A (en) | Vectors for expressing γ-interferon in mammalian cells, methods for carrying it out, products obtained and pharmaceutical compositions containing the γ-interferon | |
| Haertle et al. | Identification of the receptor and cellular ortholog of the Marek's disease virus (MDV) CXC chemokine | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| Shi et al. | Identification and characterization of interferon regulatory factor-1 from orange-spotted grouper (Epinephelus coioides) | |
| DE69933528T2 (en) | A method of cytokine production using a Sendai virus expression system | |
| Li et al. | Characterization and roles of Cherry Valley duck NLRP3 in innate immunity during avian pathogenic Escherichia coli infection | |
| de Sousa Neves et al. | Bovine immunisation with a recombinant peptide derived from synthetic SBm7462®(Bm86 epitope construct) immunogen for Rhipicephalus microplus control | |
| Zhang et al. | GSK3β plays a negative role during white spot syndrome virus (WSSV) infection by regulating NF-κB activity in shrimp Litopenaeus vannamei | |
| Lu et al. | Interferon regulatory factors 1 and 2 play different roles in MHC II expression mediated by CIITA in grass carp, Ctenopharyngodon idella | |
| Wei et al. | ATG12 is involved in the antiviral immune response in large yellow croaker (Larimichthys crocea) | |
| CN109627316A (en) | Recombinant protein and the application of 2 gene of grass carp IFN-γ and its coding | |
| Zhang et al. | Trim23 promotes WSSV replication though negative regulation of antimicrobial peptides expression in Macrobrachium nipponense | |
| CN107903319A (en) | Expression and application of a kind of thymosin extrasin PROTEIN C q TRP1 of Anti-infection to WSSV in Pichia pastoris | |
| Sun et al. | A novel TRIM9 protein promotes NF-κB activation through interacting with LvIMD in shrimp during WSSV infection | |
| Klein et al. | Coat protein of the Ectocarpus siliculosus virus | |
| CN1083527A (en) | Recombinant entomopoxvirus | |
| Enault et al. | A complex set of sex pheromones identified in the cuttlefish Sepia officinalis | |
| Reubel et al. | Experimental inoculation of European red foxes with recombinant vaccinia virus expressing zona pellucida C proteins | |
| JPS61129200A (en) | Novel leucocyte interferon | |
| Tsygankov et al. | Synthesis of recombinant gamma interferons resistant to proteolysis in the yeast Pichia pastoris | |
| CN108486127A (en) | 6 α of dog interferon-α, 7 recombinant proteins and the preparation method and application thereof | |
| CN101161676A (en) | Saltant APOBEC3G molecule inhibiting HIV reproduction and uses thereof | |
| Liang et al. | Functional characterization of BAG3 in orange-spotted grouper (Epinephelus coioides) during viral infection | |
| CN104818283B (en) | The gene of porcine interferon alpha 8 and its expression of a kind of optimization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180413 |
|
| WD01 | Invention patent application deemed withdrawn after publication |