CN116790812A - Kit for detecting EB virus nucleic acid copy number and application thereof - Google Patents

Abstract

The application relates to the field of biotechnology, in particular to a kit for detecting the copy number of EB virus nucleic acid and application thereof; the kit comprises an EBV primer pair, wherein the EBV primer pair comprises an EBV forward primer shown as SEQ ID NO.1 and an EBV reverse primer shown as SEQ ID NO. 2; because the microdroplet digital PCR does not need to amplify DNA, the detected data is absolute quantitative value of DNA, compared with RT-PCT, the method has higher precision and accuracy, and microdroplets containing EBV can be amplified by designing a primer pair for EBV aiming at the microdroplet digital PCR to obtain enough effective droplet count, so that microdroplets which do not accord with expectations can be effectively removed in the subsequent microdroplet analysis process, the accuracy of detection of a kit can be improved, the property of a sample can be directly judged by a positive judgment value of the kit, and absolute quantitative detection can be carried out on the sample.

Description

Kit for detecting EB virus nucleic acid copy number and application thereof

Technical Field

The application relates to the field of biotechnology, in particular to a kit for detecting the copy number of EB virus nucleic acid and application thereof.

Background

Epstein Barr Virus (EBV) is a ubiquitous gamma-type herpes virus with adult infection rates exceeding 90% and is associated with a variety of lymphocytic diseases and epithelial cell malignancies. In rare cases, deregulation of the immune response following EBV virus infection can lead to persistent infection of T and/or NK cells and repeated activation of EBV infection and cause the occurrence of non-malignant as well as malignant EBV-associated T/NK lymphoproliferative diseases (EBV-T/NK-LPDs). Non-malignant EBV-T/NK-LPDs appear from mild to aggressive, mainly including chronic active EB virus infection (CAEBV) of the cutaneous or multisystem T/NK cell type, and EBV-associated hemophagocytic syndrome (EBV HLH). The current research finds that the EBV-DNA copy number in plasma and Peripheral Blood Mononuclear Cells (PBMC) is an important prognostic and treatment judgment index for measuring the activity and latency of EBV in vivo.

In addition to detection of EBV virus infected PBMCs and plasma, EBV virus infected B, T, NK lymphocytes also have different clinical manifestations, significance and clinical prognosis. In the clinical environment of the present stage, the EBV-related diseases progress rapidly, so how to rapidly and accurately perform quantitative detection of the EBV-DNA copy number is one of the problems to be solved urgently, and has important significance for clinical patients.

The current commercial EBV-DNA quantitative detection kit detects the EBV copy number in tissues and blood plasma by detecting the gene fragment (such as EBNA-1 gene) stably expressed by the EBV through a Real-Time PCR method; in addition to the EBNA-1 gene, the BALF5 gene and the BamH 1W gene are also commonly used as target genes for detection of EBV-DNA due to their highly conserved properties. The Real-time PCR method is simple and convenient, has wide application at present, but has the problems of high instrument use and precision requirement, difficulty in preparing standard products and the like because the DNA amplification step is needed, the internal reference gene is further used as a reference, and a standard curve is established to measure the DNA value, so the Real-time PCR method is not absolute quantitative detection. Therefore, a kit for detecting the copy number of EB virus nucleic acid is provided to realize absolute quantitative detection of EBV.

Disclosure of Invention

The application provides a kit for detecting the copy number of EB virus nucleic acid and application thereof, which are used for solving the technical problem that absolute quantitative detection is difficult in the process of detecting EBV by adopting a Real-Time PCR method in the prior art.

In a first aspect, the application provides a kit for detecting the copy number of EB virus nucleic acid, which comprises an EBV primer pair, wherein the EBV primer pair comprises an EBV forward primer shown as SEQ ID NO.1 and an EBV reverse primer shown as SEQ ID NO. 2.

Optionally, the kit further comprises an EBV probe, and the nucleotide sequence of the EBV probe is shown as SEQ ID NO. 3.

Optionally, the kit further comprises an internal reference RPP30 primer pair and an internal reference RPP30 probe, wherein an upstream primer of the internal reference RPP30 primer pair is shown as SEQ ID NO.4, and a downstream primer of the internal reference RPP30 primer pair is shown as SEQ ID NO. 5; and/or the number of the groups of groups,

the internal reference RPP30 probe is shown as SEQ ID NO. 6.

Optionally, the kit further comprises a PCR reaction mixed solution and a quality control product solution.

In a second aspect, the application provides a kit for detecting the copy number of EB virus nucleic acid, which comprises the kit according to the first aspect for use in a method for detecting the copy number of EB virus nucleic acid.

Optionally, the method for detecting the copy number of the EB virus nucleic acid specifically comprises the following steps:

extracting a sample, and preprocessing the sample to obtain DNA of lymphocytes;

taking the DNA of the lymphocyte as a sample, and adopting the kit to prepare a reaction system of microdroplet digital PCR;

preparing droplets of the reaction system of the microdroplet digital PCR;

and carrying out droplet PCR reaction on the droplets, and carrying out droplet analysis on reaction products to obtain the copy number of the EB virus nucleic acid in the sample.

Optionally, the step of extracting a sample and performing pretreatment on the sample to obtain DNA of lymphocytes specifically includes:

extracting an in-vitro fresh peripheral blood sample by adopting an anticoagulant, and then carrying out gradient centrifugation and magnetic cell sorting to obtain B lymphocytes, T lymphocytes and NK cells respectively;

extracting the DNA of the B lymphocyte, the T lymphocyte and the NK cell respectively to obtain the DNA of the lymphocyte;

wherein the anticoagulant comprises at least one of ethylenediamine tetraacetic acid, sodium oxalate and sodium citrate.

Alternatively, the droplet PCR reaction is programmed to:

pre-denaturation at 95℃for 10min; denaturation at 94℃for 30s, annealing at 60℃for 1min,45 cycles; enzyme inactivation is carried out for 10min at 95 ℃; the droplets were stable at 4℃for 30min.

Optionally, the temperature rising speed and the temperature reducing speed in the droplet PCR reaction are respectively less than or equal to 2.5 ℃/s.

Optionally, the performing a droplet PCR reaction on the droplet and performing droplet analysis on a reaction product to obtain the epstein barr virus nucleic acid copy number in the sample specifically includes:

performing droplet PCR reaction on the droplets to obtain reaction products;

performing droplet analysis on the reaction product to obtain an effective droplet number of the reaction product;

judging whether the reaction product is an effective product according to the effective liquid drop number and the standard effective liquid drop number;

outputting the copy number corresponding to the reaction product as the EB virus nucleic acid copy number if the effective droplet number is more than the standard effective droplet number;

if the effective liquid drop number is less than or equal to the standard effective liquid drop number, the reaction product is eliminated;

wherein the standard effective droplet count is 1000.

Compared with the prior art, the technical scheme provided by the embodiment of the application has the following advantages:

according to the kit for detecting the copy number of the EBV nucleic acid, which is provided by the embodiment of the application, because the micro-droplet digital PCR does not need to amplify DNA, the detected data are absolute quantitative values of the DNA, compared with RT-PCT, the kit has higher precision and accuracy, and micro-droplets containing the EBV can be amplified to obtain a sufficient effective droplet number by designing a primer pair for the EBV aiming at the micro-droplet digital PCR, so that micro-droplets which do not accord with expectations can be effectively removed in the subsequent micro-droplet analysis process, the detection accuracy of the kit can be improved, the property of a sample can be directly judged by the positive judgment value of the kit, and the absolute quantitative detection of the sample can be performed.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the application and together with the description, serve to explain the principles of the application.

In order to more clearly illustrate the embodiments of the application or the technical solutions of the prior art, the drawings which are used in the description of the embodiments or the prior art will be briefly described, and it will be obvious to a person skilled in the art that other drawings can be obtained from these drawings without inventive effort.

FIG. 1 is a flow chart of a method for detecting the copy number of EB virus nucleic acid according to the embodiment of the application;

FIG. 2 is a schematic diagram showing a detailed flow chart of a method for detecting the copy number of EB virus nucleic acid according to the embodiment of the application;

fig. 3 is a schematic diagram of a peripheral blood sample pretreatment step and a result provided in the embodiment of the present application, wherein fig. 3A is a schematic flow chart of the peripheral blood sample pretreatment step, fig. 3B is a schematic diagram of a result of staining T lymphocytes with an anti-CD 3-PerC table P antibody, fig. 3C is a schematic diagram of a result of staining B cells with an anti-CD 20-FITC antibody, and fig. 3D is a schematic diagram of a result of staining NK cells with an anti-CD 56-PE antibody and an anti-CD 3-PerCP antibody;

FIG. 4 is a schematic diagram showing the result of ddPCR detection provided by the embodiment of the application, wherein black particles are negative control, blue particles are positive for EBV-DNA, green particles are positive for internal reference, and orange particles are positive for both EBV and internal reference;

FIG. 5 is a schematic diagram of a calculation flow of EBV copy number according to an embodiment of the present application;

FIG. 6 is a graph of the results of a consistency analysis of the digital micro-droplet PCR and Real-Time PCR provided by the embodiment of the present application, wherein FIG. 6A is a graph of the results of a linear relationship between predicted and measured copy numbers of the digital micro-droplet PCR and Real-Time PCR, and FIG. 6B is a graph of the correlation of the average measured value for each concentration criterion between the dPCR and RT-PCR of the digital micro-droplet PCR and Real-Time PCR;

FIG. 7 is a graph of the results of the lower detection limits of the digital droplet PCR and Real-Time PCR provided by the present application;

FIG. 8 is a graph comparing the detection of clinical samples by the digital micro-droplet PCR and the Real-Time PCR according to the embodiment of the present application, wherein FIG. 8A is a graph showing the CV values measured by the digital micro-droplet PCR and the Real-Time PCR, FIG. 8B is a scatter diagram showing the copy number data measured by the digital micro-droplet PCR and the Real-Time PCR, FIG. 8C is a graph comparing the copy numbers of the samples detected by the digital micro-droplet PCR and the Real-Time PCR, and FIG. 8D is a graph showing the correspondence between the copy numbers determined by the digital micro-droplet PCR and the Real-Time PCR.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the embodiments of the present application more apparent, the technical solutions of the embodiments of the present application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present application, and it is apparent that the described embodiments are some embodiments of the present application, but not all embodiments of the present application. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

Unless otherwise specifically indicated, the various raw materials, reagents, instruments, equipment and the like used in the present application are commercially available or may be prepared by existing methods.

The inventive thinking of the application is: in addition to the detection of EBV virus-infected PBMCs and plasma, EBV virus-infected B, T, NK lymphocytes also have different clinical manifestations, meanings and clinical prognosis, and first, most of the EBV primary infections typically infect oral epithelial cells first, followed by B lymphocytes, leading to self-limiting Infectious Mononucleosis (IM) in children, or in healthy adolescents and adults, for routine antiviral and symptomatic support therapy. Thereafter, EBV selectively persists in memory B cells and causes a life-long latent infection. Although replication of EBV-infected cells can be prevented by complex immune responses, the host immune system cannot completely eliminate EBV. Second, EBV also infects T lymphocytes or Natural Killer (NK) cells, but its basic mechanism remains elusive. Recurrent and persistent EBV infection in T/NK cells is rare, often life threatening, requires chemotherapy and allogenic hematopoietic stem cell transplantation (allo-HSCT), and is prone to combined hemophagocytic syndrome (HLH), with patients who are significantly worse than IM from B-lymphocyte infection. Notably, EBV-associated T/NK cell lymphoproliferative disease (EBV +

T/NK-LPDs) are various diseases characterized by clonal expansion of EBV infected T or NK cells. In a broad sense, EBV+T/NK-LPDs have a broad spectrum ranging from reactive to neoplastic processes, from palliative to invasive or fulminant, including at least EBV-associated hemophilosis (EBV+HLH) [4], chronically active EBV-infected T/NK cell types (CAEBV+

T/NK). Therefore, in addition to identifying the EBV infection PBMC and the plasma copy number, identifying the type and copy number of the EBV infection B, T, NK lymphocyte is of great significance for disease diagnosis, clinical treatment scheme selection and prediction of long-term prognosis of patients.

The embodiment of the application provides a kit for detecting the copy number of EB virus nucleic acid, which comprises an EBV primer pair, wherein the EBV primer pair comprises an EBV forward primer shown as SEQ ID NO.1 and an EBV reverse primer shown as SEQ ID NO. 2.

In some alternative embodiments, the kit further comprises an EBV probe having the nucleotide sequence shown in SEQ ID NO. 3.

In the embodiment of the application, the designed probe sequence is introduced into the kit, so that the droplet PCR can be ensured to form sufficient identifiable effective droplets, and the accuracy of subsequent droplet analysis is ensured.

In some alternative embodiments, the kit further comprises a reference RPP30 primer pair and a reference RPP30 probe, wherein the upstream primer of the reference RPP30 primer pair is shown in SEQ ID No.4 and the downstream primer of the reference RPP30 primer pair is shown in SEQ ID No. 5; and/or the number of the groups of groups,

the internal reference RPP30 probe is shown as SEQ ID NO. 6.

In the embodiment of the application, the designed internal reference RPP30 primer pair and the internal reference RPP30 probe are introduced, so that the droplet PCR can be further ensured to form sufficient identifiable effective droplets, and the accuracy of subsequent droplet analysis is ensured.

In some alternative embodiments, the kit further comprises a PCR reaction mixture and a quality control solution, wherein the quality control solution comprises an EBV positive quality control solution and an EBV negative quality control solution.

In the embodiment of the application, the specific types of the kit are limited, and the accuracy of positive judgment of the kit on the EBV can be further ensured through the specific composition of the PCR reaction mixed solution and the quality control solution.

Based on one general inventive concept, the application provides an application of a kit for detecting the copy number of EB virus nucleic acid, wherein the application comprises a method for using the kit for detecting the copy number of EB virus nucleic acid.

The application is realized based on the above-mentioned kit, and the specific composition of the kit can refer to the above-mentioned embodiment, and because the application adopts some or all of the technical solutions of the above-mentioned embodiment, at least has all the beneficial effects brought by the technical solutions of the above-mentioned embodiment, and will not be described in detail herein.

In some alternative embodiments, as shown in FIG. 1, the method for detecting the copy number of EB virus nucleic acid specifically comprises the following steps:

s1, extracting a sample, and preprocessing the sample to obtain DNA of lymphocytes;

s2, taking the DNA of the lymphocyte as a sample, and adopting the kit to prepare a reaction system of microdroplet digital PCR;

s3, preparing microdroplets of the reaction system of the microdroplet digital PCR;

s4, performing droplet PCR reaction on the droplets, and performing droplet analysis on reaction products to obtain the copy number of the EB virus nucleic acid in the sample.

In the embodiment of the application, the reagent kit is adopted to prepare a reaction system of the micro-drop digital PCR, micro-drops are prepared through the reaction system of the micro-drop digital PCR, and finally, the micro-drop PCR reaction and analysis are carried out on the micro-drops, so that the copy number of the EB virus nucleic acid in the sample can be definitely obtained, and the reagent kit has higher precision and accuracy compared with RT-PCT.

In some alternative embodiments, as shown in fig. 2, the sample is extracted and pre-processed to obtain DNA of lymphocytes, which specifically includes:

s101, extracting an in-vitro fresh peripheral blood sample by adopting an anticoagulant, and then carrying out gradient centrifugation and magnetic cell sorting to obtain B lymphocytes, T lymphocytes and NK cells respectively;

s102, respectively extracting the DNA of the B lymphocyte, the T lymphocyte and the NK cell to obtain the DNA of the lymphocyte;

wherein the anticoagulant comprises at least one of ethylenediamine tetraacetic acid, sodium oxalate and sodium citrate.

In the embodiment of the application, the three-dimensional blood sample is acquired by adopting the non-heparin anticoagulant, and the reagent kit is detected inaccurately because heparin infects the subsequent microdroplet PCR reaction, so that the problem can be effectively avoided by adopting any one or two combined anticoagulants of ethylenediamine tetraacetic acid, sodium oxalate and sodium citrate.

In some alternative embodiments, the droplet PCR reaction is programmed to:

pre-denaturation at 95℃for 10min; denaturation at 94℃for 30s, annealing at 60℃for 1min,45 cycles; enzyme inactivation is carried out for 10min at 95 ℃; the droplets were stable at 4℃for 30min.

In the embodiment of the application, a specific droplet PCR reaction program is limited, so that the number of effective droplets generated after the droplet PCR reaction is ensured, and the detection accuracy is ensured.

In some alternative embodiments, the rate of temperature increase and the rate of temperature decrease in the droplet PCR reaction are each less than or equal to 2.5 ℃/s.

In the embodiment of the application, the heating speed and the cooling speed of the droplet PCR reaction are limited, so that the smooth proceeding of the PCR reaction can be ensured, the influence of excessive temperature fluctuation on the number of effective droplets is avoided, and the accuracy and precision of the detection of the kit are ensured.

In some alternative embodiments, the performing a droplet PCR reaction on the droplet and performing droplet analysis on the reaction product to obtain the epstein barr virus nucleic acid copy number in the sample specifically comprises:

s401, carrying out droplet PCR reaction on the droplets to obtain reaction products;

s402, performing droplet analysis on the reaction product to obtain the effective droplet number of the reaction product;

s403, judging whether the reaction product is an effective product according to the effective droplet number and the standard effective droplet number;

outputting the copy number corresponding to the reaction product as the EB virus nucleic acid copy number if the effective droplet number is more than the standard effective droplet number;

if the effective liquid drop number is less than or equal to the standard effective liquid drop number, the reaction product is eliminated;

wherein the standard effective droplet count is 1000.

In the embodiment of the application, the effective liquid drop number of the reaction product can be accurately obtained by carrying out the droplet analysis on the reaction product after the droplet PCR reaction, so that the copy number corresponding to the reaction product can be intuitively obtained by judging the effective liquid drop number, thereby having higher precision and accuracy compared with RT-PCT.

The number of the effective liquid drops of the standard is limited to 1000, and whether the number of the effective liquid drops meets the expected requirement can be accurately judged, so that the precision and the accuracy of the droplet PCR are improved.

The application will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present application and are not intended to limit the scope of the present application. The experimental procedures, which are not specified in the following examples, are generally determined according to national standards. If the corresponding national standard does not exist, the method is carried out according to the general international standard, the conventional condition or the condition recommended by the manufacturer.

Example 1

The specific composition information of the formulated kit products is shown in table 1.

TABLE 1 information about the composition of the kit

The kit product is preserved at-15 ℃ to-25 ℃ and has a valid period of 12 months.

Wherein the EBV primer comprises:

EBV forward primer: GCAAGCTCTCAGCCTACAAGA (SEQ ID NO. 1)

EBV reverse primer: GTTGCGCTCGACGAACTTC (SEQ ID NO. 2)

EBV probe: FAM-CCAGATGCCTCACCTGGCCGTCT-MGB (SEQ ID NO. 3)

Internal reference RPP30 forward primer: GGACGGTCATGGGACTTCAG (SEQ ID NO. 4)

Reference RPP30 reverse primer: CGCTCGCAGGTCCAAATC (SEQ ID NO. 5)

Internal reference RPP30 probe: VIC-ATGGCGGTGTTTGC-MGB (SEQ ID NO. 6)

The kit product is suitable for clinical peripheral blood samples, and the peripheral blood samples are collected by adopting blood collection tubes containing anticoagulant sodium citrate (blue cap) and EDTA (purple cap).

Example 2

Example 2 and example 1 were compared, and the difference between example 2 and example 1 is that:

1. sample processing:

(1) Separation and purity determination of samples

As shown in FIG. 3A, fresh peripheral blood (20 mL, EDTA anticoagulant tube) from patients was prepared into Peripheral Blood Mononuclear Cells (PBMCs) by gradient centrifugation using LymphoprepTM (Axis-Shield, oslo, norway). B, T and NK cells were isolated from PBMCs using magnetic cell sorting (MACS) (Mitenyi Biotec, germany) according to the manufacturer's instructions and the purity of MACS-sorted cells was determined using a flow cytometer. T cells were stained with anti-CD 3-PerC Table P antibody (BD Biosciences, USA, 652831) and B cells were stained with anti-CD 20-FITC antibody (BD Biosciences, USA, 652808). NK cells were stained with anti-CD 56-PE antibodies (BD Biosciences, USA, 652825) and anti-CD 3-PerCP antibodies, the results are shown in FIG. 3B.

(2) Extraction of DNA from sorted T, B, NK lymphocytes:

the DNA of T, B, NK lymphocytes from the above step was extracted using a QIAmp DNA Blood Mini kit (Qiagen, germany), and the prepared DNA solution was diluted to a concentration of 10 ng/. Mu.L, with a sampling volume of 3. Mu.L per reaction, and a sampling amount of DNA of about 30ng.

Example 3

Example 3 and example 2 are compared, and the difference between example 3 and example 2 is that:

2. preparing a digital PCR reaction system:

(1) Reagent preparation: and taking out the PCR reagent in the kit, placing the kit in an ice box for melting, shaking and uniformly mixing, and centrifuging for 5 seconds for later use.

(2) Preparing a PCR system: a PCR reaction system was prepared as shown in Table 2, and after shaking and mixing, air bubbles were removed by centrifugation.

TABLE 2 PCR reaction System Condition Table

Reagent name	Sample addition amount (mu L)
		PCR reaction mixture	10
EBV primers and probes	1
		DNA	3
Nuclease water	6
		Total volume of	20

3. Droplet preparation:

(1) Placing a new droplet-generating card in the holder of the droplet-generating apparatus according to the indicated position, noting the notch direction;

(2) Adding 20 mu L of sample reaction system into a row of 8 holes in the middle of a droplet generation card, supplementing less than 8 samples with 20 mu L of 1 Xbuffer control, and slowly pumping out liquid at an angle of about 15 DEG with the side wall when the gun head is close to the bottom of one side of the hole during sample addition, slowly lifting the gun head position after pumping out a part of liquid, pumping out the rest liquid, and avoiding pumping the gun to a first gear position to avoid introducing bubbles;

(3) Adding 70 μl of each of the 8 wells in the lowermost row of the droplet-generating card, again without empty wells;

(4) Covering a rubber pad, and paying attention to the fact that small holes on two sides are firmly hooked;

(5) The holder is gently and stably placed in a droplet generator to start generating droplets, and the state of an indicator light on the generator is noted, and the process is completed within 2 minutes;

(6) The microdroplet is generated in a row of holes on the uppermost surface of the microdroplet generating card, the suction volume is adjusted to 40 mu L, the holder is leveled, the gun head is put in at an angle of 30-45 degrees with the hole wall, the bottom of the hole is lightly touched, the suction volume is about 5 seconds, 40 mu L is sucked, the gun head is also slowly driven into the hole (about 5 seconds) at the corresponding position of the 96-well plate, the gun head is close to the hole wall and approaches the hole bottom, the cover is sealed for preventing oil volatilization, and the used microdroplet generating card and the used rubber pad are discarded each time;

(7) After transferring oil drops into the 96-well plate, sealing the film (with red line upwards) by using a preheated PX1 heat sealing instrument, wherein the recommended operation procedure is as follows: 180 ℃ for 5 seconds without reversing the direction to seal the film secondarily.

4. Microdroplet PCR

(1) The 96-well plate with the sealed film is put into a 96-well PCR instrument for microdroplet PCR, the reaction conditions are set as shown in Table 3, and the temperature rise and fall speed is less than or equal to 2.5 ℃/s.

TABLE 3 PCR reaction conditions Table

Example 3

Example 3 and example 2 are compared, and example 3 and example 1 differ in that:

5. droplet analysis:

(1) Placing the 96-well plate with the PCR into a plate holder of a droplet analyzer for assembly, paying attention to the bevel angle direction of the plate, slightly and stably placing the plate into a droplet reader after assembly, and paying attention to checking whether a state indicator lamp on the droplet reader indicates normal or not;

(2) The QuantaSoft software was opened and a Flush System was recommended before each experiment, and if no advice was used for more than a week to make Prime before Flush System. Then, setting sample information in a 96-well plate, setting an experiment Name in a date-EBV-batch (for example 20200831-EBV-01), setting information on each detection well, filling in a sample Name according to a laboratory number in a laboratory sample management file, selecting ddPCR Supermix forProbes (no dUTP) by Supermix, selecting RED by experiment Type, suggesting that Target 1 is set as a Target gene, filling in EBV by Name, selecting Ch1 unknown by Type, setting Target2 as an internal reference gene, filling in RPP30 by Name, selecting Ch2 unknown by Type, automatically analyzing samples one by an instrument, and completing detection of 32 samples per hour by each droplet through a detector.

6. Analysis of results:

(1) After the reaction detection is finished, clicking "Analyze", selecting all reaction holes, clicking "Events", carrying out the next analysis on the effective liquid drop number larger than 10000, and recording the reaction smaller than 10000.

(2) The threshold between the negative and positive clusters of the two channels ch1 and ch2 is set to-1/3. And then selecting all the reaction holes, setting the general threshold value of the whole plate reaction as the level of a positive reference substance, and selecting to exclude the reaction with the effective liquid drop number less than 10000. Clicking on "Export CSV" to Export data, displaying copy number of sample EBV/RPP30 in column "CopiesPer20uLWell" in file, and judging sample property according to positive judgment value of kit.

Interpretation of detection results:

1. validity determination

The quality control product provided by the kit is adopted to judge the effectiveness of the result, the detection result shows that the effective droplet number (the droplet capable of detecting the fluorescent signal is called effective droplet) is more than 10000, the negative quality control product is detected as negative, the positive quality control product is detected as positive, and the detection result is judged to be effective.

2. Positive judgment value

And when the detection result shows that the number of the target gene EBV positive droplets is more than or equal to 3, reporting that the sample is positive.

The results of the tests performed with different peripheral blood samples are shown in fig. 4, in which the color black: a negative control; blue: EBV-DNA positive; green: positive internal parameters; orange: EBV and internal reference are positive, and according to the distribution of different colors in FIG. 4, the calculation can be performed according to the calculation method shown in FIG. 5 to obtain the EBV-DNA copy number/10 ⁶ Individual cells.

The above results demonstrate that the kit of the present application can be used for quantitative detection of the copy number of EBV-DNA.

According to this feature, a series of standard curves were prepared with plasmids containing different EBV-DNA copy numbers, and linear regression was performed with the EBV copy number reading of the sample as an independent variable, and the results are shown in FIG. 6.

By comparing the RT-PCR technique with the ddPCR technique, each set of standard samples was serially diluted 2-fold to generate concentrations ranging from 80 to 0.625 copies/ml for 5 replicates, the results were expressed as a mean 1SD, the results are shown in FIG. 7 as having a high degree of consistency, and ddPCR was not only better reproducible and reproducible, but also had lower detection limits.

Comparison of drop digital PCR (ddPCR) and real-time PCR were performed simultaneously on clinical samples, with three different clinical samples being compared separately, and the results are shown in fig. 8, wherein CV values, copy number data, and consistency between patient samples and copy numbers between the three samples of the two detection methods were compared separately, and CV (%) of ddPCR and real-time PCR were calculated by dividing each SD by its respective average value, and the results showed that correlation of copy number analysis of the two methods was significant for clinical samples (Pearson r2=0.8952; p < 0.0001).

One or more technical solutions in the embodiments of the present application at least have the following technical effects or advantages:

(1) According to the kit for detecting the copy number of the EB virus nucleic acid, provided by the embodiment of the application, the sensitivity and the accuracy of a detection system can be effectively improved through the sequences of the designed EBV primer and the EBV probe, and the detected DNA is an absolute quantitative value because the DNA does not need to be amplified.

(2) The application of the kit for detecting the EBV nucleic acid copy number provided by the embodiment of the application uses the designed kit in a detection method of the EBV, wherein plasmids containing different EBV-DNA copy numbers are used for preparing a series of standard curves, the reading of the EBV copy number of a sample is used as an independent variable for linear regression, and the established quantitative detection method of digital PCR (ddPCR) is applied to the clinical detection field of the EBV nucleic acid copy number for the first time, so that the blank of clinical research of detecting the EBV copy number by using the ddPCR is filled, and the test technology and method of the virus nucleic acid detection research are perfected.

(3) The ddPCR detection method can also be used in other clinical detection, such as detection of the copy number of the EB virus, detection of the copy number of a chimeric antigen receptor T cell (CAR-T) of circulating tumor DNA (ctDNA), and the like.

Various embodiments of the application may exist in a range of forms; it should be understood that the description in a range format is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the application; it is therefore to be understood that the range description has specifically disclosed all possible sub-ranges and individual values within that range. For example, it should be considered that a description of a range from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5, and 6, wherever applicable. In addition, whenever a numerical range is referred to herein, it is meant to include any reference number (fractional or integer) within the indicated range.

In the present application, unless otherwise specified, terms such as "upper" and "lower" are used specifically to refer to the orientation of the drawing in the figures. In addition, in the description of the present specification, the terms "include", "comprising" and the like mean "including but not limited to".

Relational terms such as "first" and "second", and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Herein, "and/or" describing an association relationship of an association object means that there may be three relationships, for example, a and/or B, may mean: a alone, a and B together, and B alone. Wherein A, B may be singular or plural. Herein, "at least one" means one or more, and "a plurality" means two or more. "at least one", "at least one" or the like refer to any combination of these items, including any combination of single item(s) or plural items(s). For example, "at least one (individual) of a, b, or c," or "at least one (individual) of a, b, and c," may each represent: a, b, c, a-b (i.e., a and b), a-c, b-c, or a-b-c, wherein a, b, c may be single or multiple, respectively.

The foregoing is only a specific embodiment of the application to enable those skilled in the art to understand or practice the application. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the application. Thus, the present application is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (10)

1. A kit for detecting the copy number of EB virus nucleic acid is characterized by comprising an EBV primer pair, wherein the EBV primer pair comprises an EBV forward primer shown as SEQ ID NO.1 and an EBV reverse primer shown as SEQ ID NO. 2.

2. The kit of claim 1, further comprising an EBV probe having a nucleotide sequence set forth in SEQ ID No. 3.

3. The kit of claim 1, further comprising a reference RPP30 primer pair and a reference RPP30 probe, wherein the upstream primer of the reference RPP30 primer pair is shown in SEQ ID No.4 and the downstream primer of the reference RPP30 primer pair is shown in SEQ ID No. 5; and/or the number of the groups of groups,

the internal reference RPP30 probe is shown as SEQ ID NO. 6.

4. The kit of claim 1, further comprising a PCR reaction mixture and a quality control solution.

5. Use of a kit for detecting the copy number of an epstein barr virus nucleic acid, characterized in that the use comprises the use of a kit according to any of claims 1-4 in a method for detecting the copy number of an epstein barr virus nucleic acid.

6. The method according to claim 5, wherein the method for detecting the copy number of the EB virus nucleic acid comprises the following steps:

extracting a sample, and preprocessing the sample to obtain DNA of lymphocytes;

taking the DNA of the lymphocyte as a sample, and adopting the kit to prepare a reaction system of microdroplet digital PCR;

preparing droplets of the reaction system of the microdroplet digital PCR;

and carrying out droplet PCR reaction on the droplets, and carrying out droplet analysis on reaction products to obtain the copy number of the EB virus nucleic acid in the sample.

7. The use according to claim 6, wherein the extraction of the sample and the pretreatment of the sample to obtain the DNA of lymphocytes comprises:

extracting an in-vitro fresh peripheral blood sample by adopting an anticoagulant, and then carrying out gradient centrifugation and magnetic cell sorting to obtain B lymphocytes, T lymphocytes and NK cells respectively;

extracting the DNA of the B lymphocyte, the T lymphocyte and the NK cell respectively to obtain the DNA of the lymphocyte;

wherein the anticoagulant comprises at least one of ethylenediamine tetraacetic acid, sodium oxalate and sodium citrate.

8. The use according to claim 7, wherein the procedure for the droplet PCR reaction is:

pre-denaturation at 95℃for 10min; denaturation at 94℃for 30s, annealing at 60℃for 1min,45 cycles; enzyme inactivation is carried out for 10min at 95 ℃; the droplets were stable at 4℃for 30min.

9. The use according to claim 8, wherein the rate of increase and the rate of decrease in the droplet PCR reaction are each less than or equal to 2.5 ℃/s.

10. The use according to claim 7, wherein said performing a droplet PCR reaction on said droplets and performing a droplet analysis on the reaction products to obtain the epstein barr virus nucleic acid copy number in the sample comprises:

performing droplet PCR reaction on the droplets to obtain reaction products;

performing droplet analysis on the reaction product to obtain an effective droplet number of the reaction product;

judging whether the reaction product is an effective product according to the effective liquid drop number and the standard effective liquid drop number;

outputting the copy number corresponding to the reaction product as the EB virus nucleic acid copy number if the effective droplet number is more than the standard effective droplet number;

if the effective liquid drop number is less than or equal to the standard effective liquid drop number, the reaction product is eliminated;

wherein the standard effective droplet count is 1000.