CN114480659A - Method for determining minimal residual lesion level based on multiplex amplification sequencing - Google Patents
Method for determining minimal residual lesion level based on multiplex amplification sequencing Download PDFInfo
- Publication number
- CN114480659A CN114480659A CN202210337217.6A CN202210337217A CN114480659A CN 114480659 A CN114480659 A CN 114480659A CN 202210337217 A CN202210337217 A CN 202210337217A CN 114480659 A CN114480659 A CN 114480659A
- Authority
- CN
- China
- Prior art keywords
- umi
- sequencing
- primer
- amplification
- level
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for determining the level of minimal residual lesions based on multiplex amplification sequencing. The method comprises the following steps: processing an S1 sample, preparing an S2 primer pool, performing single-ended amplification on S3, performing quality control on S4, purifying S5, performing mixed sequencing on S6, analyzing sequencing data of S7, and calculating the level of a tiny residual lesion in S8. The determination method of the invention uses simple single-ended amplification, can accurately and quantitatively detect the level of the tiny residual lesion, does not need to add an external reference, can avoid generating primer dimer, improves the proportion of effective data, and further improves the accuracy of determining the level of MRD.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a method for determining minimal residual lesion level based on multiple amplification sequencing.
Background
The B cell antigen receptor (BCR) is an immunoglobulin molecule (Ig) that grows on the surface of B lymphocytes and comprises two heavy (H) and two light (L) chains. The heavy chain comprises a variable region (VH) and 3 constant regions (CH 1/CH2/CH 3), and the light chain comprises a variable region (VL) and a constant region (CL). Also within the variable region are 4 framework regions (FR 1/FR2/FR3/FR 4) which vary relatively little and 3 complementarity determining regions (CDR 1/CDR2/CDR 3) which vary relatively much, the most varied being the CDR3 region. Depending on the gene segment encoding the variable region, the heavy chain may be divided into V-D-J regions and the light chain may be divided into V-J regions.
The genes encoding the three immunoglobulin Ig chains (IgH, IgK, IgL) are not located on the same chromosome, the gene encoding the heavy chain H is located on the long arm of chromosome 14, the gene encoding the light chain K is located on the short arm of chromosome 2, and the gene encoding the light chain L is located on the long arm of chromosome 22. A B cell clone only shows a V-D-J gene rearrangement and only secretes an antibody, normal people whether BCR or TCR should be polyclonal, and detection of monoclonal rearrangement by BCR gene often indicates tumors of B lymphocyte line such as CLL, MM, B cell lymphoma, B-ALL and the like.
Gene rearrangement refers to the rearrangement of Ig or TCR fragments of different lymphocytes during cell differentiation. The gene rearrangement technology is a gold standard for detecting clonal hyperplasia of lymphocytes, has great significance in early diagnosis and differential diagnosis of malignant lymphoma, and particularly has good application and prospect for cases which can not be diagnosed by conventional HE and immunohistochemical detection. The normal lymphocyte is not stimulated at all, the gene rearrangement is random, and the cell shows multiple families and multiple clonality and has the potential of playing various cellular immune roles. In the process of lymphomata occurrence, under the stimulation of tumor specific antibody or tumor associated antigen, one or several TCR or Ig gene families of lymphocytes generate targeted and selective rearrangement, so that TCR or Ig gene is expressed in a monoclonal manner, lymphocytes are enabled to be proliferated in a clonal manner, and 1 or 2 main lymphocyte clones appear in lymph nodes, peripheral blood or bone marrow cells and are in a monoclonal manner.
Minimal Residual Disease (MRD) refers to a state in which a patient is in clinical remission after receiving treatment, has no clinical symptoms, but tumor cells remain in the body. Before that, the recurrence detection of the hematological tumor is performed through traditional morphological evaluation, flow cytometry, PCR, NGS and other methodological stages, and for the hematological tumor, the advantage of the NGS can exactly match with millions or even hundreds of millions of different B/T cell receptor genes in the immune system, so that the MRD can be more accurately quantified. In the prior art, a traditional two-step amplicon library building sequencing method is adopted to detect BCR rearrangement for evaluating MRD level, so that the operation is relatively complicated, external parameters are required to be added for quantification, primer dimer is easy to generate, UMI cannot play a role in removing PCR preference due to double-end exponential amplification, the proportion of effective data is low, and the MRD level detection is inaccurate.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a method for determining the level of minimal residual lesions based on multiple amplification sequencing.
The invention provides a method for determining the level of minimal residual lesions based on multiplex amplification sequencing, which comprises the following steps:
s1: sample treatment: collecting, transporting and extracting nucleic acid;
s2: manufacturing a primer pool: respectively mixing the forward primer and the reverse primer according to an equimolar ratio to obtain a forward primer pool and a reverse primer pool;
the forward primer has the following structures from 5 'to 3': an adaptor sequence P1, an index sequence, a sequencing primer 1 and a target binding primer 1; the 3' end of the forward primer sequence is provided with a blocked modification group C3 for blocking extension; the index sequence is used for distinguishing different samples; the blocking modifying group C3 has RNA base at the upstream; the target binding primer 1 is specifically bound with a sample to be detected.
The structure of the reverse primer is as follows from 5 'to 3': a linker sequence P2, a sequencing primer 2, a molecular tag UMI, a linker sequence, and a target binding primer 2; the molecular tag UMI is used for calculating the number of original template molecules actually participating in amplification, and every 3 random bases are separated by one fixed base; the target binding primer 2 is specifically bound with the sample to be detected.
S3: single ended amplification
(1) Adding a reverse primer pool for single-ended amplification;
(2) when the amplification is finished for 15 cycles, directly adding a reaction system containing a forward primer pool without taking out the PCR tube, and continuously carrying out the amplification reaction for the remaining 20 cycles after uniformly mixing;
s4: quality control
Carrying out electrophoresis detection on the amplified product;
s5: purification of
Magnetic bead purification, and the purified sequencing library is used for carrying out accurate quantification and fragment size analysis;
s6: mixed sequencing
Diluting the library according to the requirements of a sequencing platform, mixing samples according to the data quantity requirements by taking the quantitative result in S5 as a standard, and then sequencing at high throughput;
s7: sequencing data analysis
Filtering the low-quality bases to remove potentially contaminating sequences;
s8: calculating the level of minimal residual lesions
Relative cloning frequency = SL-UMI/SB-UMIX 100 in%; refers to the proportion of cancer cells in healthy B cells in vivo; wherein S isL-UMIIs the UMI number, S, of the cancer cells obtained by sequencingB-UMIIs the number of UMI of B cells obtained by sequencing;
the sequences obtained by sequencing the cancer cells and the healthy B cells are different and can be distinguished; if the sample is healthy, the sample has a corresponding sequencing sequence, and the relative frequency is less than 3%; only a cancer patient sample has cancer cells, a first diagnosis is carried out to obtain a sequence with the relative frequency of more than or equal to 3 percent, and the detection condition of the sequence can be tracked later, namely the level of the tiny residual lesion;
minimal residual lesion level = SL-UMI/C1st/500/0.00653X 100 in%; refers to the proportion of cancer cells in the overall nucleated cells; wherein S isL-UMIThe number of UMIs after the duplication removal; c1stThe number of cycles for the first round of amplification.
The principle of the invention is obviously different from the prior art, the prior art firstly quantifies the content of the B cells in the total cells by adding an external reference substance, and the method directly quantifies the B cells by the UMI number without the intervention and intermediate calculation of the external reference substance.
Further, the length of the index sequence in the S2 is 8-9bp, the molecular label UMI is composed of 9-13 random bases, and the length of the linker sequence is 3-4 bp.
Further, there is RNA base 4bp upstream of the blocking modifier C3 in the S2. A distance of 4 bases is required between the RNA base at this position and the blocked modifier C3 with extension-blocking blocks at the 3' end to assist the enzyme in recognizing this position and performing the enzyme digestion reaction.
Further, the reaction system in step (1) in S3 is:
further, the reaction procedure of S3 is:
further, the reaction system comprising the forward primer pool added in the step (2) in S3 is:
further, the specific steps of magnetic bead purification in S5 are as follows: and purifying the amplified product by using AMPureXP magnetic beads of Beckman & Coulter company, adding 75 mu l of magnetic bead suspension into a reaction system, fully and uniformly blowing, uniformly mixing, and standing at room temperature for 5 min. And (3) sucking the supernatant, discarding, washing twice by using 80% ethanol, standing at room temperature for 5min, airing the magnetic beads, and adding 20mu l of lowTE to elute the magnetic beads to obtain a purified library.
Further, the purified sequencing library was subjected to accurate quantification and fragment size analysis using the qubit3.0 and Agilent2100 in S5.
Further, in the S6, the result of the quantitive quatit 3.0 is used as a standard, and mixed according to the data volume requirement, and Illumina NovaSeq6000 is used for sequencing.
Further, in the S7, an originally off-machine NGS high-throughput sequencing BCR fastq file is obtained, low-quality bases are filtered, the filtered sequences are compared with an IMGT BCR-H/K/L database to determine V/(D)/J genes, a CDR3 clone sequence is established based on the comparison information, and possible polluted sequences are removed according to the cloning frequency.
The present invention also provides an apparatus for determining a minimal residual lesion level based on multiplex amplification sequencing, according to which the minimal residual lesion level is determined, the apparatus comprising:
the sample processing module is used for extracting nucleic acid of a sample;
a single-ended amplification module for performing single-ended amplification using the forward primer pool and the reverse primer pool;
the quality control and purification module is used for quality control and purification of the amplified product;
the hybrid sequencing module is used for high-throughput sequencing and sequencing data analysis;
a minimal residual lesion level calculation module for calculating a minimal residual lesion level, specifically,
relative cloning frequency = SL-UMI/SB-UMIX 100 in%;
wherein S isL-UMIIs the UMI number, S, of the cancer cells obtained by sequencingB-UMIIs the number of UMI of B cells obtained by sequencing;
if the relative cloning frequency is more than or equal to 3 percent, the gene is judged to be a main clone and is a sequence generated by cancer cells, and whether the sequence is detected or not is monitored at the later stage, namely the level of the tiny residual lesion is obtained;
the calculation method of the tiny residual lesion level comprises the following steps:
minimal residual lesion level = SL-UMI/C1st/500/0.00653X 100 in%;
wherein S isL-UMIThe number of UMIs after the duplication removal; c1stCycle number for the first round of amplification.
In summary, compared with the prior art, the invention achieves the following technical effects:
1. the invention belongs to a method for completing amplicon library construction by single-ended PCR, and compared with the traditional library construction and capture, the method has the advantages of simple operation, short time and lower cost.
2. The invention uses single-ended amplification technology, namely, the single-ended one-way amplification is carried out by using the reverse primer firstly, so that each amplified single-stranded product is ensured to obtain a single-stranded linear product by using the input nucleic acid as an amplification template, and the amplification is not like the exponential amplification by using the amplified product as the template during double-ended amplification, thereby more truly reflecting the proportion of the original template.
3. The unique reverse primer structure design of the invention adds 12 random bases as molecular label sequences, ensures that amplified DNA template molecules can be labeled on the premise of proper template input amount, and reduces UMI overlapping.
4. The invention can carry out accurate BCR quantitative determination due to the single-ended primer amplification fidelity and UMI mark duplication elimination, thereby obtaining MRD level, and does not need to rely on adding an external reference object for quantitative reference, thereby reducing cost and simplifying flow.
5. The unique forward primer structure design of the invention increases RNA basic groups and 3' end blocking groups. Only under the condition that the primer is perfectly matched with the template, the enzyme can cut RNA basic groups to release blocking groups to carry out amplification reaction, and the matching of the primer and the primer can not carry out effective amplification due to the existence of the 3' end blocking groups, so that the generation of primer dimers is effectively avoided, and the efficiency of amplifying and obtaining effective sequencing data is improved.
6. The design of the molecular label UMI fixed base adopts three bases, avoids base imbalance caused by using one fixed base, can reduce the formation of UMI dimer and improve the amplification efficiency.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a schematic flow diagram of a single-ended amplification method of the present invention.
FIG. 2 is an electrophoretic detection chart of example 1 of the present invention.
FIG. 3 shows the quality control results of example 2 of the present invention.
FIG. 4 is a graph of a fitting between a measured value and a theoretical value of the MRD level in example 2 of the present invention.
Detailed Description
In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, shall fall within the scope of protection of the present invention.
The method for determining the MRD level based on the multiple amplification sequencing specifically comprises the following steps:
s1: sample treatment:
(1) collecting and transporting: clinical samples of patients are collected, and different collection and transportation modes are adopted according to different sample types.
(2) Nucleic acid extraction: DNA was extracted using the DNA extraction kit developed by Meijie according to the procedures described in the specification. The concentration and purity of the extracted nucleic acid were measured using nanodrop2000/qubit 3.0.
S2: manufacturing a primer pool: and respectively mixing the specific forward primer and the specific reverse primer according to an equimolar ratio to prepare a forward primer pool and a reverse primer pool.
S3: single ended amplification
The invention completes library construction by one-step PCR amplification, the flow is shown in figure 1, and the amplification product is directly purified by magnetic beads, thereby avoiding the possibility of pollution in the operation process.
(1) Adding a reverse primer pool for single-ended amplification. The structure of the reverse primer is as follows from 5 'end to 3' end: linker sequence P2, sequencing primer 2, molecular tag UMI, linker sequence, target binding primer 2. The molecular tag UMI consists of 9-13 random bases N (which can be labeled with 10 theoretically)7Every 3 random bases are divided by a fixed base, the design can reduce the formation of UMI dimer, UMI is used for calculating the number of original template molecules actually participating in amplification, and a linker sequence (3-4 bp) keeps the base GC balance and improves the efficiency of combining the primers with the template.
Amplification PCR reaction (25. mu.l):
the amplification was set up as follows:
(2) when the amplification is completed for 15 cycles, the PCR tube is not taken out, the following reaction system is directly added on a PCR instrument, and the mixture is sucked, beaten and mixed evenly.
And after uniformly mixing, continuing to perform amplification reaction for the remaining 20 cycles, wherein the forward primers sequentially have the following structures from 5 'to 3': linker sequence P1, index sequence, sequencing primer 1, target binding primer 1. The 3' end of the forward primer sequence is provided with a blocked modification group C3 for blocking extension; the index sequence is used for distinguishing different samples (index 8-9 bp), the blocking modification group C3 cannot perform normal PCR reaction, RNA bases are arranged at 4bp upstream of the blocking modification group C3, RNA digestive enzyme can cut the RNA bases, and DNA polymerase can perform extension reaction normally after the blocking group is detached.
S4: quality control
Taking 5-10 μ l of the amplified product to carry out agarose gel electrophoresis detection. The electrophorogram shows that the size of the sample amplified band is consistent with the expected size, and the band is bright and has no non-specific amplified band, namely the quality is qualified.
S5: purification of
(1) And purifying the amplified product by using AMPureXP magnetic beads of Beckman & Coulter company, adding 75 mu l of magnetic bead suspension into the reaction system, fully and uniformly pumping, and standing at room temperature for 5 min. And (3) sucking the supernatant, discarding, washing twice by using 80% ethanol, standing at room temperature for 5min, airing the magnetic beads, and adding 20mu l of lowTE to elute the magnetic beads to obtain a purified library.
(2) The purified sequencing library was subjected to precise quantification and fragment size analysis using qubit3.0 and Agilent 2100.
S6: mixed sequencing
Diluting the library according to the requirement of a sequencing platform, mixing samples according to the data quantity requirement by taking the quantitative result of the Qubit as a standard, and sequencing by adopting Illumina Nova Seq 6000.
S7: sequencing data analysis
The method comprises the steps of sequencing BCR fastq files in original off-line NGS high throughput, filtering low-quality bases, comparing the filtered sequences to an IMGT BCR-H/K/L database to determine V/(D)/J genes, assembling and establishing CDR3 clone sequences based on comparison information, and removing possible pollution sequences according to clone frequency.
S8: calculating the level of minimal residual lesions
Relative cloning Frequency (Frequency) calculation mode: freq = SL-UMI/SB-UMIX 100 in%, wherein SL-UMIIs the UMI number, S, of the cancer cells obtained by sequencingB-UMIIs the number of UMI of B cells obtained by sequencing.
MRD level calculation formula: MRD = SL-UMI/C1stPer 500/0.00653X 100, in%, SL-UMI/C1stI.e. after passing through the weightlessnessThe number of UMI divided by the number of cycles of the first round of amplification was defined as the number of cancer cells, 500/0.00653 was the total number of cells corresponding to 500ng of DNA input, and the total number of cells in the cancer cell ratio was the MRD level.
The recurrence of tumor has many factors and manifestations, whether recurrence is directly related to MRD result, MRD level is only an auxiliary reference means. Clinically, the clinical diagnostic technique of hematological pathology of tumors uses morphology as a gold standard, and morphological examination is performed by bone marrow biopsy, bone marrow smear, and peripheral blood smear. In addition, flow cytometry and genetic methods can be used to assist in the determination. Flow cytometry can perform multi-parameter measurement on blood cells through specific monoclonal antibody marking, and the application of the flow cytometry in blood diseases mainly comprises detection of leukemia/lymphoma immunophenotyping, Paroxysmal Nocturnal Hemoglobinuria (PNH) cloning, minimal residual lesion, myelodysplastic syndrome (MDS) immunophenotype, CD34+ cell counting and the like. Aspects of genetic methods also include karyotyping and Fluorescence In Situ Hybridization (FISH). Therefore, the MRD level, as a form of auxiliary judgment, cannot be directly concluded whether the tumor in the sample is recurrent, and is not a diagnostic method for the disease.
Example 1: plasmid DNA primer amplification test
Target binding primer design and validation: downloading reference sequences of immunoglobulin IgH, IgK and IgL from a public database, screening to obtain homologous conserved regions through sequence comparison analysis, and using the homologous conserved regions as primer designs to design 25 specific primers SEQ ID NO. 1-25:
SEQ ID NO.1（IgHV1）：ACAGYCTACATGGAGCTGAG
SEQ ID NO.2（IgHV2）：GACCAACATGGACCCTGTGGA
SEQ ID NO.3（IgHV3）：GGGCCGRTTCACCATCTCCA
SEQ ID NO.4（IgHV4）：ACAGCCTGAAAACCGAGGACA
SEQ ID NO.5（IgHV5）：CATCTCCAGAGACAATTCCARGAAC
SEQ ID NO.6（IgHV6）：GCTGAACTCTGTGACTCCCGAGG
SEQ ID NO.7（IgHV7）：GACACCTCTGCCAGCACAGCAT
SEQ ID NO.8（IgHJ）：CTCACCTGAGGAGACAGTGACC
SEQ ID NO.9（IgKV1）：GGTTCAGYGGCAGTGGATCT
SEQ ID NO.10（IgKV2）：ACWGATTTYACACTGAAAATCAGC
SEQ ID NO.11（IgKV3）：CAGGCTCCTCATCTATGRTGCATC
SEQ ID NO.12（IgKV4/6）：TGGGACAGATTTCACYCTCACC
SEQ ID NO.13（IgKJ1/2/3/4）：TGATYTCCASCTTGGTCCC
SEQ ID NO.14（IgKJ5）：ACGTTTAATCTCCAGTCGTGTC
SEQ ID NO.15（IgLV1）：CTGGRAGCAGCTCCAACATYGG
SEQ ID NO.16（IgLV2）：CCTGGGCTCTGCTSCTCCTCA
SEQ ID NO.17（IgLV3）：ATTCTCYGGCTCCAGCTCAG
SEQ ID NO.18（IgLV4）：CTACCTCACCWTCTCCARCCTC
SEQ ID NO.19（IgLV5）：GCTCCAGYCTGARGATGAGGCT
SEQ ID NO.20（IgLV6）：CATCGACAGCTCCTCCAACTC
SEQ ID NO.21（IgLV7）：GGTTCTCAGGCTCCCTCCTT
SEQ ID NO.22（IgLV8）：TGTGCTGTATATGGGTAGTGG
SEQ ID NO.23（IgLV9）：GACCATCAAGAACATCCAGG
SEQ ID NO.24（IgLV10）：GAGAGATTCTCTGCATCCAGGTCAGG
SEQ ID NO.25（IgLJ）：TAGGACGGTCAGCTBSGTC
the length of the amplification product is 200-350 bp. And (3) performing a primer amplification specificity test by using the circular plasmid DNA and the digested linear dsDNA as templates. In the following, a pair of primers IgHV3 and IgHJ is used as an example for displaying, and the PCR amplification system is 20. mu.l.
The PCR amplification system is as follows:
the PCR amplification procedure was as follows:
the amplification results were detected with the instrument as follows:
when the template is circular plasmid, the determination concentration is 25.2 ng/mu l, the copy number concentration is about 7.7E +09 copes/mu l, and the dilution condition is 10 times of gradient dilution, 7.7E +05, 7.7E +04, 7.7E +03, 7.7E +02 and 7.7E + 01;
when the template is a linear plasmid, the determination concentration is 1.75 ng/mu l, the copy number concentration is about 3.5E +09 copes/mu l, and the dilution condition is 10 times of gradient dilution, namely 3.5E +05, 3.5E +04, 3.5E +03, 3.5E +02 and 3.5E + 01;
to further verify the specificity of the primers, 8 pUC57 plasmid DNAs containing different inserts were mixed as amplification templates, and single pair primer amplification results showed no non-specific amplification bands, respectively, as shown in FIG. 2.
Example 2: cell line DNA study
In this embodiment, the MRD level detection is first verified by using a cell line known in the public database as the target. The method comprises the following specific steps:
1. screening cell lines:
2. cell line nucleic acid preparation: 6 cell lines were purchased from ATCC, 1mL of cell suspension was extracted with Meijie's whole blood DNA extraction kit according to the instructions, and the extracted nucleic acids were assayed for concentration and purity using Qubit3.0 and Agilent2100 and stored at-20 ℃ for further use.
3. Manufacturing a primer pool: the primer sequences are shown in SEQ ID NO. 26-50, 25 synthesized primers are mixed according to a certain proportion respectively to obtain a forward primer pool and a reverse primer pool, wherein SEQ ID NO. 26-46 is a forward primer (the 3' end is provided with a closed modification group C3), SEQ ID NO. 47-50 is a reverse primer, the number of the forward primer and the reverse primer does not need to be consistent, and the same chain (such as IgH) is subjected to pairing amplification of arrangement and combination. Wherein, individual degenerate bases (R, Y, B, S) are designed for amplification effect, rA, rC, rG, rU are RNA bases, and the primer pools are mixed well on a shaker.
SEQ ID NO.26：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACAGYCTACATGGArGCTGAG-C3
SEQ ID NO.27：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACCAACATGGACCCrUGTGGA-C3
SEQ ID NO.28：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGCCGRTTCACCArUCTCCA-C3
SEQ ID NO.29：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACAGCCTGAAAACCGrAGGACA-C3
SEQ ID NO.30：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCATCTCCAGAGACAATTCCrARGAAC-C3
SEQ ID NO.31：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTGAACTCTGTGACTCrCCGAGG-C3
SEQ ID NO.32：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACACCTCTGCCAGCArCAGCAT-C3
SEQ ID NO.33：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGTTCAGYGGCAGTrGGATCT-C3
SEQ ID NO.34：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTACWGATTTYACACTGAAArATCAGC-C3
SEQ ID NO.35：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGGCTCCTCATCTATGRrUGCATC-C3
SEQ ID NO.36：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGGGACAGATTTCACYrCTCACC-C3
SEQ ID NO.37：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTGGRAGCAGCTCCAArCATYGG-C3
SEQ ID NO.38：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCTGGGCTCTGCTSCrUCCTCA-C3
SEQ ID NO.39：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATTCTCYGGCTCCArGCTCAG-C3
SEQ ID NO.40：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACCTCACCWTCTCCrARCCTC-C3
SEQ ID NO.41：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCTCCAGYCTGARGATrGAGGCT-C3
SEQ ID NO.42：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCATCGACAGCTCCTCrCAACTC-C3
SEQ ID NO.43：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGTTCTCAGGCTCCrCTCCTT-C3
SEQ ID NO.44：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGTGCTGTATATGGGrUAGTGG-C3
SEQ ID NO.45：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACCATCAAGAACATrUCCAGG-C3
SEQ ID NO.46：
CAAGCAGAAGACGGCATACGAGATCTAAGTCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAGAGATTCTCTGCATCCAGrGTCAGG-C3
SEQ ID NO.47：
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNCNNNANNNGNNNTCGACTCACCTGAGGAGACAGTGACC
SEQ ID NO.48：
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNCNNNANNNGNNNTCGATGATYTCCASCTTGGTCCC
SEQ ID NO.49：
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNCNNNANNNGNNNTCGAACGTTTAATCTCCAGTCGTGTC
SEQ ID NO.50：
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNCNNNANNNGNNNTCGATAGGACGGTCAGCTBSGTC
SEQ ID NO.51（P1）：
CAAGCAGAAGACGGCATACGAGAT
SEQ ID NO.52（P2）：
AATGATACGGCGACCACCGAGATC
4. Quantification and dilution: according to 6 cell lines, 500ng of nucleic acid is taken, and then the nucleic acid is sequentially diluted to 10 in a gradient manner-5、10-4、10-3、10-2、10-1And the blank control group template is sterile water.
5. Amplification and sequencing: the amplification conditions and procedure were as follows:
the amplification was set up as follows:
when the amplification is completed for 15 cycles, the PCR tube is not taken out, the following reaction system is directly added on a PCR instrument, and the mixture is sucked, beaten and uniformly mixed.
6. Quality control
Taking 5-10 μ l of the amplified product to carry out agarose gel electrophoresis detection. The electrophorogram shows that the size of the sample amplified band is consistent with the expected size, and the band is bright and has no non-specific amplified band.
7. Purification of
(1) And purifying the amplified product by using AMPureXP magnetic beads of Beckman & Coulter company, adding 75 mu l of magnetic bead suspension into a reaction system, fully and uniformly blowing, uniformly mixing, and standing at room temperature for 5 min. And (3) sucking the supernatant, discarding, washing twice by using 80% ethanol, standing at room temperature for 5min, airing the magnetic beads, and adding 20mu l of lowTE to elute the magnetic beads to obtain a purified library.
(2) The purified sequencing library was subjected to precise quantification and fragment size analysis using qubit3.0 and Agilent 2100. After purification of the amplification product, amplicon library quality inspection was performed on Agilent2100, and the results are shown in fig. 3.
8. Mixed sequencing
Sequencing the library after quality detection on a lllumina NovaSeq6000 platform, wherein the sequencing data volume of the library is more than or equal to 2G.
9. Sequencing data analysis:
sequencing a BCR fastq file by original off-line NGS high throughput, filtering low-quality bases, carrying out UMI duplication on a filtered sequence, then comparing the sequence to an IMGT BCR-H/K/L database to determine V/(D)/J genes, assembling and establishing a CDR3 clone sequence based on comparison information, and removing possible pollution sequences according to clone frequency.
10. Calculating the level of minimal residual lesions
Relative cloning Frequency (Frequency) calculation mode: freq = SL-UMI/SB-UMIX 100 in%, wherein SL-UMIIs the UMI number, S, of the cancer cells obtained by sequencingB-UMIIs the number of UMI of B cells obtained by sequencing.
MRD level calculation formula: MRD = SL-UMI/C1stPer 500/0.00653X 100, in%, SL-UMI/C1stThe number of UMI cells after the passage of the weight was divided by the number of cycles of the first round of amplification was defined as the number of cancer cells, 500/0.00653 was the total number of cells corresponding to 500ng of DNA input, and the total number of cells in the cancer cell ratio was defined as the MRD level.
11. Linear relationship and detection limit
The results show that the MRD level is 10-3~10-5The measured value in the range is linearly related to the theoretical value, R2= 0.98, as shown in table 1 and fig. 4.
TABLE 1
Example 3: clinical sample study
The detection result of the method for determining the level of MRD of the invention is proved to be accurate and effective for the known cell lines in example 2, and the clinical samples are taken as materials for further verification in the example. The method comprises the following specific steps:
1. and (3) collecting clinical samples:
samples of 15 blood tumor patients, each from a cooperative hospital, may have different diseases, and the sample types include bone marrow fluid and peripheral blood, patients between 3-74 years of age, 8 men, and 7 women, see table 2.
TABLE 2
2. Sample treatment:
all 15 samples (bone marrow fluid and peripheral blood) were extracted using the Meijie whole blood DNA extraction kit according to the protocol.
3. Amplification sequencing analysis: the procedure is as in example 2.
4. As a result: the relative cloning frequency results for each sample are shown in Table 3.
TABLE 3
As shown in the results of Table 3, 14 clinical samples of 15 patients detected the primary clones of IgH and IgKL, respectively, and one of them was negative. The relative cloning frequency of the IgH main clone is between 40 and 60 percent, and the relative cloning frequency of the sample is verified by flow cytometry detection.
Example 4: clinical sample MRD level study
1. And (3) collecting clinical samples: 2 IgH chain-containing main clone rearrangement samples are respectively collected from blood tumor patients in a cooperative hospital, and a certain amount of DNA is added into healthy background DNA after standard gradient dilution so that the MRD of the DNA reaches 10-4、10-5、10-6Horizontal, 5 replicates were tested.
2. Sample treatment: 2 samples of the peripherial blood were extracted using the Meijie Whole blood DNA extraction kit according to the instructions.
3. Amplification sequencing analysis: the same as in example 2.
4. The results are shown in Table 4
TABLE 4
As shown in table 4, the different MRD levels of 2 clinical samples (O1375 and O1376) were detected in 5 replicates in total. Therefore, the embodiment proves that the method can measure the MRD level of the clinical sample, and has high sensitivity and accuracy.
In combination with the above embodiments, the present invention discloses a method for determining the level of minimal residual disease based on multiplex amplification sequencing. The method comprises the following steps: processing an S1 sample, preparing an S2 primer pool, performing single-ended amplification on S3, performing quality control on S4, purifying S5, performing mixed sequencing on S6, analyzing sequencing data of S7, and calculating the level of a tiny residual lesion in S8. The determination method of the invention uses simple single-ended amplification, can accurately and quantitatively detect the level of the tiny residual lesion, does not need to add external reference, can avoid generating primer dimer, improves the proportion of effective data, and further improves the accuracy of determining the level of MRD.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
SEQUENCE LISTING
<110> Mejie transformation medical research (Suzhou) Co., Ltd
<120> method for determining tiny residual lesion level based on multiplex amplification sequencing
<130> 20220331
<160> 52
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<400> 1
acagyctaca tggagctgag 20
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
gaccaacatg gaccctgtgg a 21
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
gggccgrttc accatctcca 20
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
acagcctgaa aaccgaggac a 21
<210> 5
<211> 25
<212> DNA
<213> Artificial sequence
<400> 5
catctccaga gacaattcca rgaac 25
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence
<400> 6
gctgaactct gtgactcccg agg 23
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence
<400> 7
gacacctctg ccagcacagc at 22
<210> 8
<211> 22
<212> DNA
<213> Artificial sequence
<400> 8
ctcacctgag gagacagtga cc 22
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
ggttcagygg cagtggatct 20
<210> 10
<211> 24
<212> DNA
<213> Artificial sequence
<400> 10
acwgatttya cactgaaaat cagc 24
<210> 11
<211> 24
<212> DNA
<213> Artificial sequence
<400> 11
caggctcctc atctatgrtg catc 24
<210> 12
<211> 22
<212> DNA
<213> Artificial sequence
<400> 12
tgggacagat ttcacyctca cc 22
<210> 13
<211> 19
<212> DNA
<213> Artificial sequence
<400> 13
tgatytccas cttggtccc 19
<210> 14
<211> 22
<212> DNA
<213> Artificial sequence
<400> 14
acgtttaatc tccagtcgtg tc 22
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence
<400> 15
ctggragcag ctccaacaty gg 22
<210> 16
<211> 21
<212> DNA
<213> Artificial sequence
<400> 16
cctgggctct gctsctcctc a 21
<210> 17
<211> 20
<212> DNA
<213> Artificial sequence
<400> 17
attctcyggc tccagctcag 20
<210> 18
<211> 22
<212> DNA
<213> Artificial sequence
<400> 18
ctacctcacc wtctccarcc tc 22
<210> 19
<211> 22
<212> DNA
<213> Artificial sequence
<400> 19
gctccagyct gargatgagg ct 22
<210> 20
<211> 21
<212> DNA
<213> Artificial sequence
<400> 20
catcgacagc tcctccaact c 21
<210> 21
<211> 20
<212> DNA
<213> Artificial sequence
<400> 21
ggttctcagg ctccctcctt 20
<210> 22
<211> 21
<212> DNA
<213> Artificial sequence
<400> 22
tgtgctgtat atgggtagtg g 21
<210> 23
<211> 20
<212> DNA
<213> Artificial sequence
<400> 23
gaccatcaag aacatccagg 20
<210> 24
<211> 26
<212> DNA
<213> Artificial sequence
<400> 24
gagagattct ctgcatccag gtcagg 26
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence
<400> 25
taggacggtc agctbsgtc 19
<210> 26
<211> 87
<212> DNA
<213> Artificial sequence
<400> 26
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctacag yctacatgga rgctgag 87
<210> 27
<211> 88
<212> DNA
<213> Artificial sequence
<400> 27
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgacc aacatggacc crugtgga 88
<210> 28
<211> 87
<212> DNA
<213> Artificial sequence
<400> 28
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgggc cgrttcacca ructcca 87
<210> 29
<211> 88
<212> DNA
<213> Artificial sequence
<400> 29
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctacag cctgaaaacc graggaca 88
<210> 30
<211> 92
<212> DNA
<213> Artificial sequence
<400> 30
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctcatc tccagagaca attccrarga ac 92
<210> 31
<211> 90
<212> DNA
<213> Artificial sequence
<400> 31
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgctg aactctgtga ctcrccgagg 90
<210> 32
<211> 89
<212> DNA
<213> Artificial sequence
<400> 32
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgaca cctctgccag carcagcat 89
<210> 33
<211> 87
<212> DNA
<213> Artificial sequence
<400> 33
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctggtt cagyggcagt rggatct 87
<210> 34
<211> 91
<212> DNA
<213> Artificial sequence
<400> 34
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctacwg atttyacact gaaaratcag c 91
<210> 35
<211> 91
<212> DNA
<213> Artificial sequence
<400> 35
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctcagg ctcctcatct atgrrugcat c 91
<210> 36
<211> 89
<212> DNA
<213> Artificial sequence
<400> 36
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatcttggg acagatttca cyrctcacc 89
<210> 37
<211> 89
<212> DNA
<213> Artificial sequence
<400> 37
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctctgg ragcagctcc aarcatygg 89
<210> 38
<211> 88
<212> DNA
<213> Artificial sequence
<400> 38
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctcctg ggctctgcts crucctca 88
<210> 39
<211> 87
<212> DNA
<213> Artificial sequence
<400> 39
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctattc tcyggctcca rgctcag 87
<210> 40
<211> 89
<212> DNA
<213> Artificial sequence
<400> 40
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctctac ctcaccwtct ccrarcctc 89
<210> 41
<211> 89
<212> DNA
<213> Artificial sequence
<400> 41
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgctc cagyctgarg atrgaggct 89
<210> 42
<211> 88
<212> DNA
<213> Artificial sequence
<400> 42
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctcatc gacagctcct crcaactc 88
<210> 43
<211> 87
<212> DNA
<213> Artificial sequence
<400> 43
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctggtt ctcaggctcc rctcctt 87
<210> 44
<211> 88
<212> DNA
<213> Artificial sequence
<400> 44
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatcttgtg ctgtatatgg gruagtgg 88
<210> 45
<211> 88
<212> DNA
<213> Artificial sequence
<400> 45
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgacc atcaagaaca truccagg 88
<210> 46
<211> 93
<212> DNA
<213> Artificial sequence
<400> 46
caagcagaag acggcatacg agatctaagt cggtgactgg agttcagacg tgtgctcttc 60
cgatctgaga gattctctgc atccagrgtc agg 93
<210> 47
<211> 99
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (59)..(61)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (63)..(65)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (67)..(69)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (71)..(73)
<223> n is a, c, g, or t
<400> 47
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctnn 60
ncnnnannng nnntcgactc acctgaggag acagtgacc 99
<210> 48
<211> 96
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (59)..(61)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (63)..(65)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (67)..(69)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (71)..(73)
<223> n is a, c, g, or t
<400> 48
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctnn 60
ncnnnannng nnntcgatga tytccasctt ggtccc 96
<210> 49
<211> 99
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (59)..(61)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (63)..(65)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (67)..(69)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (71)..(73)
<223> n is a, c, g, or t
<400> 49
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctnn 60
ncnnnannng nnntcgaacg tttaatctcc agtcgtgtc 99
<210> 50
<211> 96
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (59)..(61)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (63)..(65)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (67)..(69)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (71)..(73)
<223> n is a, c, g, or t
<400> 50
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctnn 60
ncnnnannng nnntcgatag gacggtcagc tbsgtc 96
<210> 51
<211> 24
<212> DNA
<213> Artificial sequence
<400> 51
caagcagaag acggcatacg agat 24
<210> 52
<211> 24
<212> DNA
<213> Artificial sequence
<400> 52
aatgatacgg cgaccaccga gatc 24
Claims (8)
1. A method for determining the level of minimal residual disease for non-diagnostic purposes based on multiplex amplification sequencing, comprising the steps of:
s1: sample treatment: collecting, transporting and extracting nucleic acid;
s2: manufacturing a primer pool: respectively mixing the forward primer and the reverse primer according to an equimolar ratio to obtain a forward primer pool and a reverse primer pool;
the forward primer has the following structures from 5 'to 3': an adaptor sequence P1, an index sequence, a sequencing primer 1 and a target binding primer 1; the 3' end of the forward primer sequence is provided with a blocked modification group C3 for blocking extension; the blocking modifying group C3 has RNA base at the upstream;
the structure of the reverse primer is as follows from 5 'to 3': a linker sequence P2, a sequencing primer 2, a molecular tag UMI, a linker sequence, and a target binding primer 2; every 3 random bases are separated by one fixed base;
s3: single-ended amplification;
(1) adding a reverse primer pool for single-ended amplification;
(2) when the amplification is finished for 15 cycles, directly adding a reaction system containing a forward primer pool without taking out the PCR tube, and continuously carrying out the amplification reaction for the remaining 20 cycles after uniformly mixing;
s4: quality control;
carrying out electrophoresis detection on the amplified product;
s5: purifying;
magnetic bead purification, and the purified sequencing library is used for carrying out accurate quantification and fragment size analysis;
s6: mixed sequencing;
diluting the library according to the requirements of a sequencing platform, mixing samples according to the data quantity requirements by taking the quantitative result in S5 as a standard, and then sequencing at high throughput;
s7: analyzing sequencing data;
filtering the low-quality bases to remove potentially contaminating sequences;
s8: calculating the level of the tiny residual lesion;
relative cloning frequency = SL-UMI/SB-UMIX 100 in%;
wherein S isL-UMIIs the UMI number, S, of the sequenced cancer cellsB-UMIIs the number of UMI of B cells obtained by sequencing;
if the relative cloning frequency is more than or equal to 3 percent, the gene is judged to be a main clone and is a sequence generated by cancer cells, and whether the sequence is detected or not is monitored at the later stage, namely the level of the tiny residual lesion is obtained;
the calculation method of the tiny residual lesion level comprises the following steps:
minimal residual lesion level = SL-UMI/C1st/500/0.00653X 100 in%;
wherein S isL-UMIThe number of UMIs after the duplication removal; c1stThe number of cycles for the first round of amplification.
2. The method according to claim 1, wherein the index sequence in S2 is 8-9bp in length, the molecular tag UMI is composed of 9-13 random bases, and the linker sequence is 3-4bp in length.
3. The method of claim 1, wherein the blocking modification group C3 of S2 has an RNA base 4bp upstream thereof.
4. The method as claimed in claim 1, wherein the reaction system of step (1) in S3 is:
(1) DNA polymerase, the concentration of the DNA polymerase is 40mU, and the dosage of the DNA polymerase is 1 μ l;
(2) the using amount of the 10X buffer solution is 2.5 mu l;
(3) the concentration of the reverse primer pool is 20mu M, and the dosage of the reverse primer pool is 1 mu l;
(4) DNA, the amount of DNA added being >500 ng;
(5) water, make up to 25 μ l.
5. The method according to claim 1, wherein the reaction system comprising the pool of forward primers added in step (2) in S3 is:
(1) DNA polymerase, the concentration of the DNA polymerase is 40mU, and the dosage of the DNA polymerase is 0.8 μ l;
(2) RnaseH2, wherein the concentration of the RnaseH2 is 20mU, and the dosage of the RnaseH2 is 1 mU l;
(3) the using amount of the 10X buffer solution is 2.5 mu l;
(4) the concentration of the forward primer pool is 20mu M, and the dosage of the forward primer pool is 1 mu l;
(5) primer P1, wherein the concentration of the primer P1 is 5 μ M, and the dosage of the primer P1 is 1 μ l;
(6) primer P2, wherein the concentration of the primer P2 is 5 μ M, and the dosage of the primer P2 is 1 μ l;
(7) water, make up to 25 μ l.
6. The method of claim 1, wherein the specific steps of purifying the magnetic beads in S5 are:
purifying the amplified product by using magnetic beads, adding 75 mu l of magnetic bead suspension into a reaction system, fully and uniformly blowing, uniformly mixing, and standing at room temperature for 5 min; and (3) sucking the supernatant, discarding, washing twice by using 80% ethanol, standing at room temperature for 5min, airing the magnetic beads, and adding 20mu l of lowTE to elute the magnetic beads to obtain a purified library.
7. The method of claim 1, wherein the original NGS in S7 is subjected to high throughput sequencing of BCR fastq files, filtering of low quality bases, alignment of the filtered sequences to IMGT BCR-H/K/L database to determine V/(D)/J genes, assembly of CDR3 sequences based on the alignment information, and removal of potentially contaminating sequences based on cloning frequency.
8. An apparatus for determining a minimal residual lesion level based on multiplex amplification sequencing, the method for determining a minimal residual lesion level according to any one of claims 1 to 7, the apparatus comprising:
the sample processing module is used for extracting nucleic acid of a sample;
a single-ended amplification module for performing single-ended amplification using the forward primer pool and the reverse primer pool;
the quality control and purification module is used for quality control and purification of the amplified product;
the hybrid sequencing module is used for high-throughput sequencing and sequencing data analysis;
a minimal residual lesion level calculation module for calculating a minimal residual lesion level, specifically,
relative cloning frequency = SL-UMI/SB-UMIX 100 in%;
wherein S isL-UMIIs the UMI number, S, of the cancer cells obtained by sequencingB-UMIIs the number of UMI of B cells obtained by sequencing;
if the relative cloning frequency is more than or equal to 3 percent, the gene is judged to be a main clone and is a sequence generated by cancer cells, and whether the sequence is detected or not is monitored at the later stage, namely the level of the tiny residual lesion is obtained;
the calculation method of the tiny residual lesion level comprises the following steps:
minimal residual lesion level = SL-UMI/C1st/500/0.00653X 100 in%;
wherein S isL-UMIThe number of UMIs after the duplication removal; c1stThe number of cycles for the first round of amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210337217.6A CN114480659B (en) | 2022-04-01 | 2022-04-01 | Method for determining minimal residual lesion level based on multiplex amplification sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210337217.6A CN114480659B (en) | 2022-04-01 | 2022-04-01 | Method for determining minimal residual lesion level based on multiplex amplification sequencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114480659A true CN114480659A (en) | 2022-05-13 |
| CN114480659B CN114480659B (en) | 2022-07-12 |
Family
ID=81488321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210337217.6A Active CN114480659B (en) | 2022-04-01 | 2022-04-01 | Method for determining minimal residual lesion level based on multiplex amplification sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114480659B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106876A (en) * | 2023-08-29 | 2023-11-24 | 浙江深华生物科技有限公司 | Method for detecting gonomic cancers based on high-throughput sequencing research and development |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838682A (en) * | 2009-03-20 | 2010-09-22 | 江苏迈迪基因生物科技有限公司 | Leukemia fusion gene combined parallel detecting method and diagnostic reagent kit |
| CN109652518A (en) * | 2018-12-18 | 2019-04-19 | 杭州艾沐蒽生物科技有限公司 | A kind of kit detecting minimal residual disease MRD |
| CN109680062A (en) * | 2018-12-18 | 2019-04-26 | 杭州艾沐蒽生物科技有限公司 | A method of detection minimal residual disease MRD |
| CN110249060A (en) * | 2017-01-17 | 2019-09-17 | 生命技术公司 | Composition and method for the sequencing of immune group library |
| CN110734908A (en) * | 2019-11-15 | 2020-01-31 | 福州福瑞医学检验实验室有限公司 | Construction method of high-throughput sequencing library and kit for library construction |
| CN112708619A (en) * | 2020-12-30 | 2021-04-27 | 纳昂达(南京)生物科技有限公司 | Joint for building library of MGI platform, kit and library building method |
| CN113005121A (en) * | 2021-04-25 | 2021-06-22 | 纳昂达(南京)生物科技有限公司 | Linker elements, kits and uses related thereto |
| CN113025761A (en) * | 2021-05-27 | 2021-06-25 | 广州赛哲生物科技股份有限公司 | Multi-amplification matched high-throughput sequencing method and kit for pathogenic microorganism identification |
| CN114107441A (en) * | 2021-11-29 | 2022-03-01 | 深圳泛因医学有限公司 | High-throughput sequencing standard substance and preparation method and application thereof |
-
2022
- 2022-04-01 CN CN202210337217.6A patent/CN114480659B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838682A (en) * | 2009-03-20 | 2010-09-22 | 江苏迈迪基因生物科技有限公司 | Leukemia fusion gene combined parallel detecting method and diagnostic reagent kit |
| CN110249060A (en) * | 2017-01-17 | 2019-09-17 | 生命技术公司 | Composition and method for the sequencing of immune group library |
| CN109652518A (en) * | 2018-12-18 | 2019-04-19 | 杭州艾沐蒽生物科技有限公司 | A kind of kit detecting minimal residual disease MRD |
| CN109680062A (en) * | 2018-12-18 | 2019-04-26 | 杭州艾沐蒽生物科技有限公司 | A method of detection minimal residual disease MRD |
| CN110734908A (en) * | 2019-11-15 | 2020-01-31 | 福州福瑞医学检验实验室有限公司 | Construction method of high-throughput sequencing library and kit for library construction |
| CN112708619A (en) * | 2020-12-30 | 2021-04-27 | 纳昂达(南京)生物科技有限公司 | Joint for building library of MGI platform, kit and library building method |
| CN113005121A (en) * | 2021-04-25 | 2021-06-22 | 纳昂达(南京)生物科技有限公司 | Linker elements, kits and uses related thereto |
| CN113025761A (en) * | 2021-05-27 | 2021-06-25 | 广州赛哲生物科技股份有限公司 | Multi-amplification matched high-throughput sequencing method and kit for pathogenic microorganism identification |
| CN114107441A (en) * | 2021-11-29 | 2022-03-01 | 深圳泛因医学有限公司 | High-throughput sequencing standard substance and preparation method and application thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106876A (en) * | 2023-08-29 | 2023-11-24 | 浙江深华生物科技有限公司 | Method for detecting gonomic cancers based on high-throughput sequencing research and development |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114480659B (en) | 2022-07-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120183969A1 (en) | Immunodiversity Assessment Method and Its Use | |
| CN110246539B (en) | Method and device for evaluating immunity level | |
| CN108004304B (en) | Method for detecting clonality of lymphocyte related gene rearrangement | |
| MX2014014275A (en) | Nano46 genes and methods to predict breast cancer outcome. | |
| WO2004101815A1 (en) | Identification of clonal cells by repeats in (eg.) t-cell receptor v/d/j genes | |
| CN112852936A (en) | Method for analyzing sample lymphocyte or plasma cell by using immune repertoire sequencing method, application and kit thereof | |
| CN110387421A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| CN109825586A (en) | DNA methylation qPCR kit and application method for lung cancer detection | |
| WO2022194042A1 (en) | Peripheral blood tcr marker for acute myeloid leukaemia, and test kit and application thereof | |
| CN109680062A (en) | A method of detection minimal residual disease MRD | |
| CN114480659B (en) | Method for determining minimal residual lesion level based on multiplex amplification sequencing | |
| CN112322716B (en) | Specific lymphocyte content analysis method and device based on TCR/BCR high-throughput sequencing | |
| CN114657254A (en) | Kit and device for BCR/TCR gene rearrangement detection | |
| CN110643721A (en) | Kit for detecting colorectal cancer indicator bacteria | |
| CN114107441A (en) | High-throughput sequencing standard substance and preparation method and application thereof | |
| CN117233400A (en) | KCNN3 gene detection kit for diagnosis and prognosis evaluation of multiple myeloma and application thereof | |
| CN110714066A (en) | DNA library for detecting and diagnosing corneal dystrophy disease-causing gene and application thereof | |
| CN106947818B (en) | Molecular marker for diagnosis and treatment of colon adenocarcinoma | |
| CN115927608A (en) | Biomarkers, methods and diagnostic devices for predicting risk of pancreatic cancer | |
| CN110656169B (en) | Diagnostic markers for atrial fibrillation | |
| CN110317877A (en) | Application of the unstable variation of one group chromosome in preparation diagnosis bladder transitional cell carcinoma, the reagent or kit of assessing prognosis | |
| CN114424291A (en) | Immune repertoire health assessment system and method | |
| CN112442533A (en) | Flora marker for predicting risk of anaphylactoid purpura and kit thereof | |
| CN110257521A (en) | The application of miRNA-30a and its target gene in lung cancer detection | |
| CN115976221B (en) | Internally-doped reference substance for quantitative detection of BCR or TCR rearrangement as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |