CN116790593B

CN116790593B - SgRNA for activating gamma globin expression, CRISPR/Cas9 complex and application thereof

Info

Publication number: CN116790593B
Application number: CN202310769443.6A
Authority: CN
Inventors: 张鹏; 李燕; 何志旭; 范安然; 周艳华
Original assignee: Affiliated Hospital of Guizhou Medical University; Guizhou Medical University
Current assignee: Affiliated Hospital of Guizhou Medical University; Guizhou Medical University
Priority date: 2023-06-28
Filing date: 2023-06-28
Publication date: 2024-05-10
Anticipated expiration: 2043-06-28
Also published as: CN116790593A

Abstract

The invention provides sgRNA for activating gamma globin expression, a CRISPR/Cas9 complex and application thereof, and belongs to the technical field of genetic engineering. The sgRNA comprises sgRNA1 or sgRNA2, and the nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1; the nucleotide sequence of the sgRNA2 is shown as SEQ ID No. 2. According to the invention, by using CRISPR/Cas9 gene editing technology, sgRNA is constructed at the 115bpBCL A binding site of the gamma globin proximal promoter region and 13nt of natural HPFH deletion, so that gamma globin is activated, the content of fetal hemoglobin is increased, and the aim of alleviating the symptoms of medium-heavy beta thalassemia is fulfilled. The sgRNA obtained by selection has high safety performance, and provides experimental basis for successfully treating beta thalassemia.

Description

SgRNA for activating gamma globin expression, CRISPR/Cas9 complex and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to sgRNA for activating gamma globin expression, a CRISPR/Cas9 complex and application thereof.

Background

Hemoglobin is abbreviated HGB or Hb. Hemoglobin is a special protein for transporting oxygen in erythrocytes, is a protein for making blood red, and consists of globin and heme, and the globin part is a tetramer consisting of two pairs of different globin chains (alpha chain and beta chain). Thalassemia (THALASSEMIA) is a group of thalassemia, which is clinically divided mainly into alpha thalassemia and beta thalassemia, with beta thalassemia being one of the most common monogenic genetic diseases in the world. Treatment of beta thalassemia: light and heavy treatment is not needed, the intermediate type and heavy type are treated according to the light and heavy type of clinical symptoms, the main treatment mode at present is long-term high-volume transfusion combined with normative iron removal treatment, but frequent transfusion easily causes heart failure and iron overload, and iron deposition can cause multi-organ functional damage and even multi-organ failure. Allogeneic hematopoietic stem cell transplantation is the only means currently mature to cure beta thalassemia, but less than 30% of the thalassemia patients can obtain proper ligand, and complications after allogeneic hematopoietic stem cell transplantation, such as graft versus host reaction (GVHD), infection, etc., are present. Gene therapy can be used as an effective method for fundamentally treating beta thalassemia, but has a plurality of gene therapy modes, so that a feasible, efficient and low-side-effect gene therapy mode needs to be sought, and the gene therapy mode has great social significance, but the current research situation and advantages of the existing gene therapy method are insufficient, and further optimization is needed.

Human hemoglobin develops, mainly fetal hemoglobin (HbF) in the fetal period, a tetramer consisting of 2 alpha-globin chains and2 gamma-globin chains, which gradually converts to adult hemoglobin after birth. Beta thalassemia is caused by mutations in the beta globin gene. The beta globin gene cluster is positioned on chromosome 11 and consists of five structural genes, namely beta, delta, agamma, ggamma and epsilon genes, and the corresponding coded haemoglobin is HBB, HBD, HBG, HBG2 and HBE. Since gamma globin chains have two subtypes, gγ and aγ, hbF constitutes: α2gγ2 and α2aγ2. Comparing the sequence of gamma globin in HbF with that of beta globin in adulthood, it was found that the sequence homology of these two globin proteins was relatively high, and therefore gamma globin proteins and beta globin proteins were functionally replaced.

The gene therapy strategy for beta thalassemia is mainly focused on: (1) Gene correction strategy: correcting the position of mutation on the beta globin gene by gene editing, but the beta globin gene has various mutation types and is difficult to operate at the level of hematopoietic stem cells; (2) Gene addition strategy: introducing normal beta globin to cells to replace abnormal globin, clinical trials have been carried out internationally; (3) gamma globin activation strategy: the function of mutant beta globin can be replaced in an adult cell, mainly by controlling the deletion of the HBG1 or HBG2 promoter region of a gamma globin regulatory element, e.g. an inhibitory cis regulatory element, or by reducing the expression of a key reaction factor. Gamma globin activation strategies have great potential by activating endogenous gamma globin to replace abnormal beta globin.

The gamma globin is re-activated in the beta thalassemia patient, and is combined with the free alpha globin chain to form HbF capable of carrying oxygen normally, so that the unbalance degree of the alpha globin chain and the beta globin chain is reduced, and the symptoms of the patient can be effectively relieved. The staged expression of gamma globin related to development ensures the physiological conversion of the hemoglobin of the organism, and the mechanism for regulating the physiological conversion process is various and comprises LCR (Locus Control Region, region control region/DNase sensitive site), transcription factors, apparent regulation, miRNA, lncRNA and the like. Deletion of the HBG1 or HBG2 promoter region of the inhibitory cis-regulatory element or reduction of the expression of key reaction factors creates a viable strategy for the clinical treatment of beta thalassemia.

The normal genetic syndrome, called hereditary sustained fetal hemoglobin elevation (HEREDITARY PERSISTENCE FETAL hemoglobin, HPFH), is examined by hematology due to the increased sustained expression of HbF in adulthood caused by various genetic factors, and the carrier is often free of clinical symptoms. HPFH is divided into a deletion type HPFH and a non-deletion type HPFH according to different gene defects, wherein the deletion type HPFH is caused by deletion of a large fragment DNA sequence in a beta globin gene cluster, and the gene of the type is one of main pathological defects which cause clinical more common intermediate thalassemia; non-deletion HPFH is due to the deletion of gamma globin gene promoter region or other modifier gene point mutation or small fragment, and these mutations may affect the regulation of transcription factor binding. In addition, other 4 chromosomes also have HPFH related loci. For example, BCL11A (B-cell lymphoma/leukemia, B lymphomatoid factor) functions by binding directly to TGACCA sequences at the gamma globin gene promoter region-115 site, which affects both the binding of the LOOPS (β globin gene downstream loop regulatory structure) structure to the gene sequence, and interactions with transcription factors such as GATA1, TAL1, etc., as well as nuclear and apparent regulatory factors, and various pathways inhibit HBG expression. The HPFH patient is checked to be normal in hematology, has no clinical symptoms, does not need treatment, breaks through the conversion of a normal globin gene switching mechanism, and constructs a model similar to HPFH by a gene editing mode according to a natural model of HPFH globin gene sequential expression regulation and control, so that the method is another important method for the current beta thalassemia gene therapy.

The treatment of beta thalassemia can not meet the current treatment requirements only by means of traditional treatment modes, and gene therapy has become a research hot spot, so how to activate gamma globin is important for the gene therapy of beta thalassemia.

Disclosure of Invention

In view of the above, the invention aims to provide an sgRNA for activating gamma globin expression, a CRISPR/Cas9 complex and application thereof, wherein the CRISPR/Cas9 complex can effectively activate gamma globin and improve the content of fetal hemoglobin so as to achieve the aim of treating beta thalassemia.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an sgRNA for activating gamma globin expression, which comprises sgRNA1 or sgRNA2;

The nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1;

the nucleotide sequence of the sgRNA2 is shown as SEQ ID No. 2.

The invention also provides a CRISPR/Cas9 complex for activating gamma globin expression, wherein the CRISPR/Cas9 complex comprises the sgRNA.

Preferably, the CRISPR/Cas9 complex further comprises a Cas9 protein.

Preferably, the Cas9 protein is obtained by extracting, purifying and concentrating pET-NLS-Cas9-6 xHis.

Preferably, the step of extracting comprises transferring pET-NLS-Cas9-6xHis into host bacteria to culture to obtain thallus containing Cas9 protein, re-suspending thallus containing Cas9 protein by lysate, crushing, centrifuging and collecting supernatant.

Preferably, the purifying step includes loading the supernatant into a nickel column to obtain a loaded nickel column, washing the nickel column, eluting the washed nickel column, and collecting eluted proteins.

Preferably, the mass ratio of the Cas9 protein to the sgRNA is 2:1-10:1.

The invention also provides application of the sgRNA or CRISPR/Cas9 complex in preparation of products for increasing fetal hemoglobin content.

The invention also provides application of the sgRNA or CRISPR/Cas9 complex in preparing medicines for treating beta thalassemia.

The invention also provides a medicament for treating beta thalassemia, which comprises the sgRNA or CRISPR/Cas9 complex.

Compared with the prior art, the invention has the following beneficial effects:

The invention provides an sgRNA for activating gamma globin expression, a CRISPR/Cas9 complex and application thereof, wherein the sgRNA is constructed at a13 nt position of a 115bpBCL A binding site and a natural HPFH deletion of a gamma globin proximal promoter region by CRISPR/Cas9 gene editing technology, so that gamma globin is activated, the content of fetal hemoglobin is improved, and the aim of alleviating the symptoms of moderate and heavy beta thalassemia is fulfilled. The sgRNA obtained by selecting 2 naturally occurring benign mutation sites has high safety performance, can efficiently activate gamma globin, improves gene editing efficiency and content of fetal gamma globin, and provides experimental basis for successfully treating beta thalassemia.

Drawings

FIG. 1 is a schematic diagram of HBGsgRNA primer design;

FIG. 2A is a graph showing the results of sgRNA purification, and B is a graph showing the results of electrophoresis of purified Cas9 protein, wherein lanes 1 are protein markers, lanes 2-4 are purified Cas9 proteins, and lanes 5-11 are BSA standards of different concentrations (250 ng/. Mu.L, 500 ng/. Mu.L, 750 ng/. Mu.L, 1000 ng/. Mu.L, 1500 ng/. Mu.L, 2000 ng/. Mu.L, 2500 ng/. Mu.L, respectively); c is the result of sgRNA and Cas9 protein activity, lane 1: markerI, lane 2: 500ng of Cas9 protein+sgRNA1500 ng+HBGDNA200ng, lane 3: cas9 protein 1000ng+sgRNA1500ng+HBGDNA200ng, lane 4: cas9 protein 2000ng+sgrna1500 ng+hbgdnan 200ng, lane 5: cas9 protein 500ng+HBG DNA200ng, lane 6: cas9 protein 250ng+sgrna2500 ng+hbgdnan 200ng, lane 7: cas9 protein 500ng+sgrna2500 ng+hbgdnan 200ng, lane 8: cas9 protein 1000ng+sgRNA2500ng+HBGDNA200ng lane 9: cas9 protein 2000ng+sgrna2500 ng+hbgdnan 200ng;

In fig. 3, a is the sequence of mutation of the HBG promoter after electrotransformation of K562 cells with Cas9 protein+sgrna complex; b is the number of bp deletions/insertions of the HBG promoter mutated sequence after electrotransformation of the Cas9 protein+sgrna complex into K562 cells (wherein the abscissa indicates the manner of mutation, the inclusion negative number indicates the deletion, the positive number indicates the insertion, and the ordinate indicates the number of cases of mutation); c is the detection result of the editing efficiency of different processing groups; d is a WesternBlot diagram after extracting protein from K562 cells edited by genes; e is a statistical diagram of the expression level of gamma globin after extracting protein from K562 cells edited by genes; f, extracting mRNA from K562 cells subjected to gene editing, performing reverse transcription to cDNA, and performing HBGmRNA detection result graphs on different treatment groups;

In fig. 4, a is a sequence of HBG promoter mutation after electrotransformation of HSPCs cells with Cas9 protein+sgrna complex; b is the bp number of deletion/insertion of the HBG promoter mutated sequence after the Cas9 protein+sgrna complex electrotransformed HSPCs cells (wherein the abscissa is the way of mutation, the negative number is deletion, the positive number is insertion, and the ordinate is the number of cases of mutation); c is a WesternBlot diagram after extracting proteins from gene edited HSPCs; d is a statistical graph of the expression level of gamma globin of the gene edited HSPCs extracted protein; e is the mRNA extracted from the HSPCs cells subjected to gene editing, reverse transcription is carried out to obtain cDNA and qPCR, and HBGmRNA detection results are carried out on different treatment groups.

Detailed Description

The nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1;

the nucleotide sequence of the sgRNA2 is shown as SEQ ID No. 2.

According to the invention, gene editing is carried out on the near-end promoter region of the HBG2/HBG1, and 2 naturally occurring benign mutation sites are selected, wherein the nucleotide sequence of the HBG1 or HBG2 target sequence is 5 'CTTGCCTTGACAATAGCCTTGACAAGGCAA3' (SEQ ID No. 5), so that sgRNA1 or sgRNA2 is obtained, the gene editing effect is improved, and gamma globin can be efficiently and specifically expressed. The nucleotide sequence of the sgRNA1 is TAATACGACTCACTATAGCAAGGCTATTGGTCAAGGCAGTTTTAGAGCTAG (SEQ ID No. 1); the nucleotide sequence of sgRNA2 is TAATACGACTCACTATAGCTTGACCAATAGCCTTGACAGTTTTAGAGCTAG (SEQ ID No. 2). The sgRNA contains a T7 promoter sequence, HBGsgRNA a target sequence CAAGGCTATTGGTCAAGGCA (SEQ ID No. 3), and HBGsgRNA a target sequence CTTGACCAATAGCCTTGACA (SEQ ID No. 4). The nucleotide sequence of the HBG1 or the HBG2 is CTTCCCCACACTATCTCAATGCAAATATCTGTCTGAAACGGTCCCTGGCTAAACTCCACCCATGGGTTGGCCAGCCTTGCCTTGACCAATAGCCTTGACAAGGCAAACTTGACCAATAGTCTTAGAGTATCCAGTGAGGCCAGGGGCCGGCGGCTGGCTAGGGATGAAGAATAAAAGGAAGCACCCTTCAGCAGTTCCAC(SEQ ID No.6).

The invention also provides a CRISPR/Cas9 complex for activating gamma globin expression, wherein the CRISPR/Cas9 system comprises the sgRNA.

In the present invention, the CRISPR/Cas9 system further comprises a Cas9 protein. As a preferred embodiment, the CRISPR/Cas9 complex of the present invention consists of Cas9 protein and sgRNA, which is sgRNA1 or sgRNA2, i.e. the CRISPR/Cas9 complex of the present invention consists of Cas9 protein and sgRNA1, or consists of Cas9 protein and sgRNA2, wherein the mass ratio of Cas9 protein to sgRNA is preferably 2:1 to 10:1, more preferably 3:1 to 9:1, more preferably 4:1 to 8:1, by which the present invention can significantly increase the expression of gamma globin. Wherein, the Cas9 protein is preferably obtained by enzyme digestion pET-NLS-Cas9-6xHis extraction, purification and concentration. In the invention, the extraction step comprises the steps of transferring the digested pET-NLS-Cas9-6xHis into host bacteria to culture to obtain a thallus containing Cas9 protein, re-suspending the thallus containing Cas9 protein by lysate, crushing, centrifuging and collecting supernatant. The host bacterium is preferably BL21 E.coli. The disruption may be performed by high pressure disruption, such as a Constant high pressure disruptor, at a pressure of 1.43 kbar. In the present invention, the purification step preferably comprises loading the collected supernatant into a nickel column for purification to obtain a purified protein. The nickel column was a bio-rad nickel column purchased from the Shanghai Limited of Berle Life medicine products. In the present invention, the nickel column was washed before purification after loading the nickel column, the washing was performed using BufferA washes, and the BufferA consisted of Tris20mM, imidazole 30mM, naCl500mM, 1mM PMSF, pH8.0. After washing, elution was performed with BufferA and BufferB, which was Tris20mM, imidazole 500mM, naCl500mM, 1mM PMSF, pH8.0. The elution adopts gradient concentration elution, the elution mode is preferably that Buffer A is used for eluting 15-20 mL at the speed of 1-2 mL/min, buffer B is added at the speed of 1-2 mL/min, cas9 protein is collected when the volume fraction of Buffer B is 25% -35%, and collection of 6-9 mL Cas9 protein is finished. Concentrating after collecting the eluted protein, wherein the concentration adopts a centrifugal concentration mode. The extracted and purified Cas9 protein has good digestion activity, and provides a basis for subsequent gene editing.

In the present invention, the product includes a reagent, a kit or a medicine.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

In the following examples Buffer A was Tris 20mM, imidazole 30mM, naCl 500mM, 1mM phenylmethanesulfonyl fluoride (PMSF), pH8.0; buffer B is Tris 20mM, imidazole 500mM, naCl 500mM, 1mM phenylmethanesulfonyl fluoride (PMSF), pH8.0.

Example 1

1. In vitro synthesis of HBG sgrnas and Cas9 purification

1.1HBG sgRNA primer design

HBG sgRNA1:

Upstream primer 5' -TAATACGACTCACTATAGCAAGGCTATTGGTCAAGG

CAGTTTTAGAGCTAG-3'(SEQ ID No.1)

HBG sgRNA2:

Upstream primer 5' -TAATACGACTCACTATAGCTTGACCAATAGCCTTGA

CAGTTTTAGAGCTAG-3'(SEQ ID No.2)

Downstream universal primer: 5'-AAAAAAGCACCGACTCGGT-3' (SEQ ID No. 7)

1.2PCR amplification

(1) Designing and synthesizing upstream and downstream primers according to target fragments to be amplified, diluting the primers to 10 mu M, and using the primers;

(2) The ice box is prepared, the experiment operation is carried out by wearing gloves, the 0.2mL PCR tube is prepared, and different reagents are different, so that gun heads are kept in mind. Sample addition was followed: the amount is large to small, enzymes are added at last, and the enzymes are taken out again during sample addition;

(3) The PCR parameters and system were as follows (the system was scaled up for experimental purposes):

The PCR reaction procedure was:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s, annealing at 50℃for 30s, extension at 72℃for 30s for 35 cycles; and then the extension is carried out for 5min at 72 ℃. Temporary storage is carried out at 4 ℃ for 10min.

The PCR reaction system is shown in Table 1: (TaqDNA polymerase)

TABLE 1 PCR reaction system

1.3 Purification of PCR products (Thermo Scientific)

(1) Bingding buffer which is 1:1 volume of the PCR product is added and evenly mixed;

(2) Adding equal volume of isopropanol when the fragment is less than 500bp to obtain a PCR product solution;

(3) Transferring the PCR product solution to an adsorption column marked in advance, centrifuging at 12000rpm for 1min with each tube not exceeding 800 mu L, and discarding the filtrate to obtain precipitate 1;

(4) To precipitate 1, 700. Mu.L Washbuffer (45 mL absolute ethanol was added for the first use), was added, centrifuged at 12000rpm for 1min, and the filtrate was discarded to obtain precipitate 2;

(5) Idling the precipitate 2, centrifuging at 12000rpm for 1min, discarding the filtrate, transferring the column into a new EPP tube marked in advance, and air-drying for 5min to obtain dried precipitate 3;

(6) Adding 30 mu LRFH ₂ O into the precipitate 3, carrying out metal bath at 55 ℃ for 5min, centrifuging at 12000rpm for 2min, and collecting the liquid to obtain a DNA sample;

(7) And measuring the concentration of the DNA sample to obtain a PCR purified product.

1.4T7 in vitro transcription

Samples were taken at room temperature in the following order of Table 2.

TABLE 2T7 in vitro transcription System

Then culturing for 6-10 hours at 37 ℃ to obtain RNA products.

1.5RNA purification

(1) Adding the T7 in-vitro transcription system into the eluent, and gently mixing the eluent with the total volume of 100 mu L;

(2) Adding 350 mu L of the binding solution into the RNA product, and gently blowing, sucking and uniformly mixing;

(3) Adding 250 mu L of absolute ethyl alcohol into the RNA product, and gently blowing, sucking and uniformly mixing to obtain an RNA mixture;

(4) Placing the adsorption column into a collecting pipe, adding the RNA mixture into the adsorption column, centrifuging at 12000rpm for 1min, and discarding the waste liquid to obtain a precipitate a;

(5) Adding 500 mu L of cleaning solution into the adsorption column, and adding 500 mu LWashSolution after the liquid passes through;

(6) Adding 500 mu LWashSolution, centrifuging at 12000rpm for 1min, and discarding the waste liquid;

(7) Adding 50 mu LRNASEFREE to 10min of incubation at 65 to 70 ℃ into an adsorption column, centrifuging at 12000rpm for 1min, adding the obtained liquid into the adsorption column again, centrifuging at 12000rpm for 1min, and obtaining the liquid which is the purified RNA;

(8) 1. Mu.L of the sample was used for concentration measurement.

As shown in FIG. 2A, purified sgRNA was found at about 100bp in HBGsgRNA (lane 2) and HBGsgRNA (lane 3).

1.6Cas9 protein purification

(1) PET-NLS-Cas9-6xHis (purchased from vast ling organism P0748) plasmid is transferred into DH5 alpha competent cells to transform and is selected to be monoclonal in LB culture medium for culture;

(2) Plasmid extraction and enzyme digestion identification

TABLE 3 Table 3

After loading according to Table 3, the centrifuge tube was flash-detached, and subjected to a metal bath overnight at 37℃to obtain the digested pET-NLS-Cas9-6XHis plasmid, which was then identified.

(3) The pET-NLS-Cas9-6xHis plasmid with correct enzyme digestion verification is transferred into BL21 competent cells, coated with plates and placed in a 37 ℃ incubator for overnight culture.

(4) The bacterial liquid cultured overnight is turbid, and the bacterial liquid shaking culture time is longer than 16 hours. The bacterial solution was stored with sterilized glycerol at a concentration of 10% (100. Mu.L of sterilized glycerol was added to 1.5mLEp tube, and then 900. Mu.L of the bacterial solution was added thereto), and the solution was stored at-20 ℃.

(5) Taking pET-NLS-Cas9-6xHis bacterial liquid stored in glycerol according to the volume ratio of 1:2000 inoculating in 2TY culture medium containing antibiotics, and culturing at 37 deg.C and 180r/min overnight;

(6) Inoculating all the bacterial liquid cultured overnight into a culture medium containing antibiotics, continuously carrying out shaking culture until the OD value is 0.5-0.6, adding IPTG for induction, carrying out shaking culture for 20h at 20 ℃ and 100rpm at a final concentration of 1mM, centrifuging for 12min at 4000rpm, discarding the supernatant, and collecting bacterial cells;

(7) High-pressure crushing: adding a lysate to resuspend thalli, sequentially washing with 70% ethanol and 20% ethanol, balancing a high-pressure breaker by using the lysate, adding the cell suspension into a Constant high-pressure breaker, breaking the cells under the pressure of 1.43kbar, and collecting the broken suspension; low temperature centrifugation: subjecting the lysate to low-temperature centrifugation: 10000rpm,4 ℃, for 30min, and collecting the supernatant.

(8) Protein purification:

Preparing a system: the protein purifier was started and the internal passages were purged with 70% ethanol, 20% ethanol and ultrapure water, respectively, until no impurities were eluted. Installing bio-rad pre-packed nickel column (5 mL); column balance: the nickel column was washed with 70% ethanol, 20% ethanol, and BufferA, respectively. Buffer1 was added in 6 volumes (volume refers to the volume of the nickel column) and passed through the passage to equilibrate the nickel column.

Protein loading: and (3) pressing the protein sample (namely, the supernatant after centrifugation in the step (7)) into a pre-packed column by using a loading pump to obtain a loaded nickel column.

Washing the nickel column: washing with BufferA to obtain washed nickel column.

Protein elution: eluting the washed nickel column by using BufferB and BufferA, eluting by using BufferA at the speed of 1.5mL/min for 18mL, adding BufferB at the speed of 1.5mL/min, and collecting Cas9 protein when the volume fraction of BufferB is 30% until the collection of 8mLCas protein is finished, thus obtaining Cas9 protein.

(9) Protein concentration

① Collecting 7mLCas protein as 1 tube, centrifuging in ultra-high speed centrifuge at 13000rpm and 4deg.C for 15min, and collecting the supernatant;

② Placing the centrifuged supernatant into a ultrafilter tube at 4000rpm and 4 ℃ for 60min, and discarding the filtered liquid;

③ Supplementing liquid in ultrafiltration tube with preservation Buffer (20 mM Tris,200mM KCl,10mM MgCl ₂, 10mM DTT,1mM PMSF,10% glycerol), centrifuging at 4000rpm for 4 deg.C for 45min, and collecting supernatant to obtain concentrated Cas9 protein;

BSA standard was the reference assay concentration:

BSA standard preparation: 50 ng/. Mu.L, 100 ng/. Mu.L, 250 ng/. Mu.L, 500 ng/. Mu.L, 750 ng/. Mu.L, 1000 ng/. Mu.L, 1500 ng/. Mu.L, 2000 ng/. Mu.L, 200. Mu.L per tube, diluted with PBS;

150 mu LPiercr660nmProteinAssay was added to the 96-well plate, then 10 mu L of BSA and each well of the sample were added, mixed well, allowed to stand for 3min, and the concentration was measured.

Subpackaging, and storing at-80deg.C.

As shown in FIG. 2B, the purified Cas9 protein with the size of 150KD is successfully obtained.

(6) Cas9 protein and sgRNA in vitro validation

Cas9 proteins (500 ng, 1000ng, 2000 ng), 500ngsgRNA1 and 200ngHBG DNA were added in different amounts, or Cas9 proteins (250 ng, 500ng, 1000ng, 2000 ng), 500ngsgRNA2 and 200ngHBGDNA were added in different amounts, with 500ngCas protein and 200ngHBGDNA added as controls to verify Cas9 protein and sgRNA activity. Taking 500ngCas protein, 500ngsgRNA1 and 200ngHBGDNA as examples, the experimental method is as follows:

the samples were applied on ice in the order indicated in Table 4.

TABLE 4 Table 4

After the sample was added, electrophoresis was performed at 37℃for 60min and at 60℃for 5 min.

As shown in FIG. 2C, a band of 200 ⁺ bp and a band of 100 ⁺ bp can be cut at 2000ng Cas9 protein, 500ng sgRNA1 or sgRNA2, and 200ng HBGDNA.

2. CRISPR/Cas9 complex cotransfection is carried out in erythroleukemia cell K562, and gamma globin expression condition is detected

2.1CRISPR/Cas9 Complex electrotransfer K562 cells

Grouping: experimental group: the CRISPR/Cas9 complex, cas9+ HBGsgRNA1 group 1 or Cas9+hbg sgRNA2 group, was transfected.

Experimental control group: only Cas9 proteins, i.e., cas9 groups, were transfected.

Blank control group: untreated K562, mock group.

An electric rotating body system: cas9 protein 100pmol, sgRNA1 or sgRNA2100pmol, PBS make up 20. Mu.L.

Incubating for 15-20 min at room temperature, and carrying out electrotransformation parameters: 390V,30ms, and then 1X 10 ⁵ K562 cells were cultured for 3 to 5 days.

2.2 Verification of DNA editing efficiency

2.2.1 Extraction of genomic DNA

(1) Cells were collected, washed 2 times with PBS, centrifuged at 2000rpm for 5min, and the supernatant was discarded;

(2) Add Lysisbuffer. Mu.L+proteinase K (20 mg/mL) 6. Mu.L, mix well, overnight at 55deg.C;

(3) Extracting DNA with phenol and chloroform, namely adding 750 mu L of DNA extraction reagent (lower layer of suction), mixing the mixture evenly, centrifuging the mixture at 12000rpm for 10min, and taking 750 mu L of supernatant into a new EP tube (the gun head can be cut flat);

(4) Precipitation of gDNA: adding 750 μl of isopropyl alcohol precooled on equal volume of ice and 1/10 volume of 3MNaAc of 75 μl, mixing, standing upside down, and centrifuging at 12000rpm for 10min to obtain white bulk precipitate, and discarding supernatant;

(5) Washing the DNA precipitate: 1mL of 75% ethanol is added for washing, the mixture is centrifuged at 12000rpm for 5min, and the supernatant is discarded;

(6) Repeating the step (5) once;

(7) Airing;

(8) Dissolving DNA: adding 30 mu LRNASEFREEH ₂ O, and dissolving at 37deg.C for 20 min;

(9) And (5) measuring the concentration.

2.2.2HBGProm terPCR amplification

PCR reaction procedure:

Pre-denaturation at 95℃for 3min; denaturation at 95℃for 30sec, annealing at 50℃for 30sec, elongation at 72℃for 30s for 35 cycles; and then the mixture is further extended for 75 minutes at 72 ℃. Temporary storage is carried out for about 10min at 4 ℃.

The PCR reaction system is shown in Table 5: (TaqDNA polymerase)

TABLE 5

Wherein the upstream primer in table 5: 5 'CTGGTATTCTCTATGGTGGGA 3' (SEQ ID No. 8)

A downstream primer: 5'TGGAACTGCTGAAGGGTG3' (SEQ ID No. 9).

2.2.3PCR purification of the product (rubber cutting recovery Thermo Scientific)

(1) Weighing empty EPP pipes, cutting rubber to obtain rubber weight, adding Bingding buffer in a ratio of 1:1 into each EPP pipe filled with rubber, melting the rubber in a metal bath at 55 ℃ for 10min, and uniformly mixing;

(2) Adding equal volume of isopropanol when the fragment is less than 500bp to obtain a PCR product a solution;

(3) Transferring the obtained PCR product a solution into an adsorption column marked in advance, centrifuging at 12000rpm for 1min with each tube not more than 800 μl, and discarding the filtrate to obtain precipitate A;

(4) 700. Mu.L of Wash buffer (45 mL of absolute ethyl alcohol is needed to be added for the first time) is added into the obtained precipitate A, the mixture is centrifuged at 12000rpm for 1min, and the filtrate is discarded to obtain precipitate B;

(5) Idling the precipitate B, centrifuging at 12000rpm for 1min, discarding the filtrate, transferring the column into a new EPP tube marked in advance, and air-drying for 5min to obtain dried precipitate C;

(6) Adding 30ulRF H ₂ O into the dried precipitate C, carrying out metal bath at 55 ℃ for 5min, centrifuging at 12000rpm for 2min, and collecting liquid to obtain a DNA sample;

(7) Measuring the concentration, and recovering the rubber tapping to obtain a rubber tapping recovered product.

2.2.4T Carrier ligation

TABLE 6

After the sample addition according to Table 6, the T-carrier ligation product was obtained at 16℃for 30 min.

2.2.5 Conversion

(1) Taking out 1 competent DH5 alpha and 2T carrier connection products, and melting on ice;

(2) Adding the 5 mu L T carrier ligation products into 50 mu L competence respectively, and standing on ice for 30min;

(3) Heat shock: heat shock at 42 ℃ for 90 seconds;

(4) Immediately placing on ice and standing for 5min;

(5) Resuscitating: 150. Mu.L of LB non-resistant liquid medium is added, and the culture is carried out for 1h at 37 ℃ and 160 rpm;

(6) Blue and white spot screening and coating plate: each of the inverted plates was uniformly coated with LBAmp + resistant solid dishes with 40. Mu. L X-gal (20 mg/mL) and 3.4. Mu.L IPTG (1M) using sterilized glass rods, and allowed to air dry;

(7) Taking out resuscitating bacterial solutions, respectively taking 50 mu L of bacterial solutions, coating the bacterial solutions in LB Amp+ resistant solid culture dishes coated with X-gal and IPTG through a glass rod, and standing for 10min;

(8) The culture was inverted overnight at 37 ℃.

2.2.6T PCR amplification of vector ligation products

PCR reaction procedure:

Pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30sec, annealing at 55℃for 30sec, elongation at 72℃for 30s for 30 cycles; further extension was carried out at 72℃for 40s. Temporary storage is carried out for about 10min at 4 ℃.

The PCR reaction system is shown in Table 7: (Taq DNA polymerase)

TABLE 7

In table 7, the upstream primer: 5 'TAGACTCGTACGCGCGG 3' (SEQ ID No. 10)

A downstream primer: 5 'CAAGTTTGCACGCTGCCGT 3' (SEQ ID No. 11).

And (3) sequencing the PCR products, and analyzing mutation conditions of the target sequence according to sequencing results to detect editing efficiency.

Wherein, the sequence of the mutation of the promoter of the outgoing DNA sequencing HBG is shown as A in FIG. 3, the condition of gene deletion or insertion is shown as B in FIG. 3, the editing efficiency of the Cas9 protein+sgRNA 1 complex treatment group is 81%, and the editing efficiency of the Cas9 protein+sgRNA 2 complex treatment group is 85% (see C in FIG. 3).

2.3 Protein level identification

2.3.1 Extraction of proteins:

(1) The cells were collected, about 1×10 ⁶ cells per group, washed once with PBS;

(2) Adding a proper amount of lysate (80 mu L of cell lysate+0.8mu L of 100 mMPMSF), mixing, placing in an ice box for 10min, vibrating on a vortex oscillator, placing back into the ice box again, and repeating for 3 times;

(3) Adding protein loading buffer solution (SDS-PAGEloadingbuffer), and metal bath at 100deg.C for 12min to denature protein;

(4) Preserving at-80 ℃.

2.3.2WesternBlot

(1) And (3) glue preparation: preparing a 12% lower layer glue 1 block and a 5% upper layer glue 1 block (Bio-Rad 12%);

(2) Electrophoresis: loading: marker 5. Mu.L, sample 5. Mu.L (about 5X 10 ⁴ cells), 30mA for 45min;

(3) And (3) rotating a die: 250mA for 25min;

(4) Ponceau dyeing;

(5) Closing: blocking solution (skimmed milk powder 2.5g+PBST for 50 ml) for 1h;

(6) Incubation resistance: hemoglobin gamma (Santa) 1:500; beta actin1:10000 at room temperature for 3h or overnight at 4 ℃;

(7) PBST is washed for 3 times, each time for 10min;

(8) Secondary antibody incubation: incubating sheep anti-mice for 1h at room temperature of 1:1000;

(9) PBST is washed for 3 times, each time for 10min;

(10) And (5) exposing.

As can be seen from D in fig. 3, the WesternBlot, cas9 protein+sgrna 1 complex treated group and Cas9 protein+sgrna 2 complex treated group increased the expression of gamma globin after protein extraction from K562 cells subjected to gene editing.

2.4 Identification of mRNA levels

2.4.1Trizol method for extracting RNA

(1) Removing the cells added with 1mLTrizol from the temperature of-80 ℃ until the cells are melted;

(2) Adding 0.2mL of chloroform (5:1) into each 1mLTrizol, shaking vigorously for 15s, standing at room temperature for 2-3 min, and centrifuging at 12000g for 15min at 4 ℃;

(3) Phase shifting water to a new EPP tube, adding isopropanol, adding 0.5mL isopropanol (2:1) per 1mLTrizol, standing at room temperature for 10min, centrifuging 12000g at 4deg.C for 10min;

(4) Taking the supernatant, adding 75% ethanol for washing for 2 times, adding at least 1mL of 75% ethanol every 1mLTRIZOL, uniformly mixing, and centrifuging at 7500g at 4 ℃ for 5min, and repeating the steps;

(5) Sucking the supernatant, airing the RNA, and not completely airing the RNA so as not to affect the dissolution of the RNA, wherein if more sediment exists, about 20 mu LRNASEFREEH ₂ O is added, and if less sediment exists;

(6) And (5) measuring the concentration.

2.4.2 Reverse transcription into cDNA (reverse transcription kit: thermo: REVERTAIDFIRSTSTRANDCDNA SYNTHESISKIT # K1621)

TABLE 8

Instantaneous separation, wherein the metal bath is carried out at 42 ℃ for 60min; presynthesis is carried out at 25 ℃ for 5min; stopping the reaction at 70 ℃ for 5min; preserving at-80 ℃.

3)qPCR(TaKaRa TB Green Premix Ex Taq II)

1 Mu L of cDNA is added with 83 mu L RNASE FREE H ₂ O and evenly mixed

QPCR system is shown in table 9:

TABLE 9

And (3) selecting a primer: HBG, beta actin

HBG upstream primer: 5'TGGATGATCTCAAGGGCAC3' (SEQ ID No. 12)

A downstream primer: 5 'TCAGTGGGTATCTGGGAGGACA3' (SEQ ID No. 13)

Beta actin upstream primer: 5 'GCCGGGACCTGACTGACTACC 3' (SEQ ID No. 14)

A downstream primer: 5 'TTCTCTTAATGTCACGACGAT 3' (SEQ ID No. 15)

QPCR reaction procedure:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 30s and annealing/extension at 60℃for 30s for 39 cycles.

MRNA was extracted from the K562 cells subjected to gene editing, reverse transcribed into cDNA, and HBGmRNA was performed.

As can be seen from E in fig. 3, the Cas9 protein+sgrna 1 complex treated group and the Cas9 protein+sgrna 2 complex treated group significantly improved the expression of gamma globin compared to the Mock group.

3. CRISPR/Cas9 complex cotransfection in human umbilical cord blood hematopoietic stem cells (HSPCs) to understand the expression of gamma globin

3.1 Cord blood sorting CD34 ⁺ HSPCs

(1) About 100mL of cord blood (containing anticoagulant) was taken at a hospital and placed on ice (note that ice and cord blood are separated by a foam box);

(2) Sieving umbilical cord blood with a 70 μm cell filter to obtain a sample;

(3) Preparing PBS containing 2% Fetal Bovine Serum (FBS) and 1mM EDTA, and mixing the sample with PBS containing 2% FBS and 1mM EDTA in equal volume to obtain an equal volume mixed sample;

(4) Preheating lymphocyte separation liquid to room temperature, reversing and uniformly mixing, reversing a bottle by using a syringe, extracting 15 mL/tube and placing the 15 mL/tube into a 50mL centrifuge tube;

(5) Spreading an equal volume of the mixed sample in a centrifuge tube to which lymphocyte separation liquid has been added (with gentle handling, no mixing with the separation liquid);

(6) Centrifuging at room temperature of 1200g for 30min (resisting the rising of 5 to 0);

(7) Sucking the white membrane layer into a new 50ml centrifuge tube, and avoiding sucking the upper and lower layers of liquid as much as possible;

(8) Washing the enriched cells: washing once with PBS containing 2% FBS+1mM EDTA, centrifuging at 300g for 10min (low brake rise 9-5), and discarding the supernatant;

(9) Preparation of rosetteep ^TM samples: 1mL of PBS containing 2% FBS+1mM EDTA;

(10) Adding Selection Cocktail:100 μl, mixing and incubating: and the room temperature is 10min.

(11) Vortex RAPIDSPHERES ^TM: 30s (note: particles should be uniformly dispersed);

(12) RAPIDSPHERES ^TM to the cell suspension: 50 μl), mixing and incubating: room temperature for 1min;

(13) Transferring the cell suspension into a flow tube, adding PBS containing 2% FBS+1mM EDTA to 2.5mL, gently blowing up and down with a pipette for 2-3 times, and incubating at room temperature for 3min (injection: placing the flow tube (without cover) into a magnet for incubation);

(14) The magnet is taken up, the magnet and the flow tube are reversed together, the supernatant is poured out, and the flow tube is taken out;

(15) Repeating the step (13) and the step (14) for 4 times;

(16) The flow tube was removed from the magnet, PBS containing 2% FBS+1mM EDTA was added to 2.5mL,300g centrifuged for 10min (low brake lift 9, 5), carefully aspirated and the supernatant discarded;

(17) Cell counts cells were cultured in SFEM II medium containing 1% CC110+1% PS.

3.2CRISPR/Cas9 Complex electrotransport CD34 ⁺ HSPCs

Grouping: experimental group: the CRISPR/Cas9 complex, i.e., cas9+hbg sgRNA group 1 or Cas9+hbg sgRNA group 2, is transfected.

Blank control group: untreated HSPCs are the Mock group.

An electric rotating body system: cas9 protein 100pmol,sgRNA 100pmol,PBS complements 20 μl.

HSPCs incubated with SFEM II broth containing 1% CC110+1% PS were incubated for 24-48 h and then cell counted, 1X 10 ⁵ per group.

Incubating for 15-20 min at room temperature.

Electric conversion parameters: 430v,30ms.

HSPCs cells of CD34 ⁺ after electrotransformation are cultured for 3-5 days.

3.3 Verification of DNA editing efficiency

3.3.1 Extraction of genomic DNA

(2) Adding Lysis buffer 750 μl+proteinase K (20 mg/mL) 6 μl, mixing well, and standing overnight at 55deg.C;

(6) Repeating the step (5) once;

(7) Airing;

(8) Dissolving DNA: adding 30 mu L RNASE FREE H ₂ O, and dissolving at 37deg.C for 20 min;

(9) And (5) measuring the concentration.

3.3.2HBG Promoter PCR amplification

PCR reaction procedure:

pre-denaturation at 95℃for 3min; denaturation at 95℃for 30sec, annealing at 50℃for 30sec, elongation at 72℃for 30s for 35 cycles; and then the extension is carried out for 5min at 72 ℃. Temporary storage at 4deg.C for about 10min

The PCR reaction system is shown in Table 10: (Taq DNA polymerase)

Table 10

In Table 10, the nucleotide sequence of the upstream primer is shown as SEQ ID No.8, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 9.

3.3.3PCR purification of the product (rubber cutting recovery Thermo Scientific)

(2) Adding equal volume of isopropanol when the fragment is less than 500bp to obtain a PCR product solution s;

(3) Transferring the obtained PCR product solution s to an adsorption column marked in advance, centrifuging at 12000rpm for 1min with each tube not exceeding 800 mu L, and discarding the filtrate to obtain a precipitate s1;

(4) 700. Mu.L of Wash buffer (45 mL of absolute ethyl alcohol is added for the first time) is added into the sediment s1, the sediment s2 is obtained by centrifuging for 1min at 12000rpm and discarding the filtrate;

(5) Idling the precipitate s, centrifuging at 12000rpm for 1min, discarding the filtrate, transferring the column to a new EPP tube marked in advance, and air-drying for 5min to obtain dried precipitate s3;

(6) Adding 30 mu L RNASE FREE H ₂ O into the dried precipitate s3, carrying out metal bath at 55 ℃ for 5min, centrifuging at 12000rpm for 2min, and collecting liquid to obtain a DNA sample;

(7) Measuring the concentration, recovering rubber tapping, and obtaining rubber tapping recovered product a

3.3.4T Carrier ligation

TABLE 11

After the sample was added in the order shown in Table 11, the T-carrier ligation product a was obtained at 16℃for 30 min.

3.3.5 Conversion

(1) Taking out 1 competent DH5 alpha and 2T vector connection products a, and melting on ice;

(2) Adding 5 mu L T of carrier connection product a into 50 mu L of competence respectively, and standing on ice for 30min;

(3) Heat shock: heat shock at 42 ℃ for 90 seconds;

(4) Immediately placing on ice and standing for 5min;

(6) Blue and white spot screening and coating plate: 40 mu L X-gal (20 mg/mL) and 3.4 mu L IPTG (1M) were added to each of the LB Amp+ resistant solid dishes of the inverted plates, and the plates were spread evenly with sterilized glass rods, and left to soak and air dry;

(8) The culture was inverted overnight at 37 ℃.

3.3.6T PCR amplification of vector ligation products

PCR reaction procedure:

The PCR reaction system is shown in Table 12: (Taq DNA polymerase)

Table 12

In Table 12, the nucleotide sequence of the upstream primer is shown as SEQ ID No.10, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 11.

And (3) carrying out electrophoresis on the PCR product, sequencing the PCR product with the size of the target fragment, and detecting the editing efficiency according to the result.

The sequence of the mutation of the promoter of the outgoing DNA sequencing HBG is shown as A in fig. 4, the condition of gene deletion or insertion is shown as B in fig. 4, the editing efficiency of the Cas9 protein+sgRNA 1 complex treatment group is 85%, and the editing efficiency of the Cas9 protein+sgRNA 2 complex treatment group is 88%.

3.4 Protein level identification

3.4.1 Extraction of proteins:

(4) Preserving at-80 ℃.

3.4.2WesternBlot

(3) And (3) rotating a die: 250mA for 25min;

(4) Ponceau dyeing;

(7) PBST is washed for 3 times, each time for 10min;

(9) PBST is washed for 3 times, each time for 10min;

(10) And (5) exposing.

As can be seen from C in fig. 4, the WesternBlot, cas9 protein+sgrna 1 complex treatment group and Cas9 protein+sgrna 2 complex treatment group increased the expression of gamma globin after protein extraction by HSPCs cells subjected to gene editing.

3.5 Identification of mRNA levels

3.5.1Trizol method for extracting RNA

(2) Adding 0.2ml chloroform (5:1) into each 1mLTrizol, shaking vigorously for 15s, standing at room temperature for 2-3 min, centrifuging at 12000g at 4 ℃ for 15min;

(6) And (5) measuring the concentration.

3.5.2 Reverse transcription into cDNA (reverse transcription kit: thermo: REVERTAIDFIRSTSTRANDCDNA SYNTHESISKIT # K1621)

TABLE 13

After the sample is added according to Table 13, the sample is instantaneously separated and subjected to metal bath at 42 ℃ for 60min; presynthesis is carried out at 25 ℃ for 5min, the reaction is stopped at 70 ℃ for 5min, and cDNA is synthesized. Preserving at-80 ℃.

3.5.3qPCR(TaKaRaTBGreenPremixExTaqII)

1 Mu L of cDNA is added with 83 mu LRNASEFREEH ₂ O and evenly mixed

The qPCR reaction system is shown in table 14:

TABLE 14

And (3) selecting a primer: HBG, beta actin

In Table 14, the nucleotide sequence of the upstream primer of the HBG is shown as SEQ ID No.12, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 13.

The nucleotide sequence of the upstream primer of beta actin is shown as SEQ ID No.14, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 15.

QPCR reaction procedure:

Extracting mRNA from the HSPCs cells subjected to gene editing, performing reverse transcription to cDNA and qPCR, and performing HBGmRNA detection. As can be seen from D in fig. 4, the Cas9 protein+sgrna 1 complex treated group and the Cas9 protein+sgrna 2 complex treated group significantly improved the expression of gamma globin compared to the Mock group.

In conclusion, the Cas9 protein+sgRNA complex (also called CRISPR/Cas9 complex) can promote the expression of gamma globin, so that the expression of fetal hemoglobin is increased, and in beta thalassemia, the expression quantity of fetal hemoglobin is increased, so that the function of mutant beta globin (adult hemoglobin) is replaced, and the aim of treating beta thalassemia is fulfilled.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims

1. An sgRNA that activates gamma globin expression, comprising sgRNA1 or sgRNA2;

The nucleotide sequence of the sgRNA1 is shown as SEQ ID No. 1;

the nucleotide sequence of the sgRNA2 is shown as SEQ ID No. 2.

2. A CRISPR/Cas9 complex that activates gamma globin expression, wherein the CRISPR/Cas9 complex comprises the sgRNA of claim 1.

3. The CRISPR/Cas9 complex of claim 2, wherein said CRISPR/Cas9 complex further comprises a Cas9 protein.

4. The CRISPR/Cas9 complex according to claim 3, characterized in that the Cas9 protein is obtained by pET-NLS-Cas9-6xHis extraction, purification, concentration.

5. The CRISPR/Cas9 complex according to claim 4, wherein the step of extracting comprises transferring pET-NLS-Cas9-6xHis into host bacteria to culture to obtain a cell containing Cas9 protein, re-suspending the cell containing Cas9 protein with lysate, crushing, and centrifuging to collect supernatant.

6. The CRISPR/Cas9 complex of claim 4, wherein said step of purifying comprises loading the supernatant of claim 5 into a nickel column for purification to obtain a purified protein.

7. The CRISPR/Cas9 complex according to claim 3, characterized in that the mass ratio of Cas9 protein to sgRNA is 2:1 to 10:1.

8. Use of the sgRNA of claim 1 or the CRISPR/Cas9 complex of any one of claims 2 to 7 for the preparation of a product for increasing fetal hemoglobin content.

9. Use of an sgRNA according to claim 1 or a CRISPR/Cas9 complex according to any one of claims 2 to 7 for the preparation of a medicament for the treatment of β thalassemia.

10. A medicament for treating β thalassemia, comprising the sgRNA of claim 1 or the CRISPR/Cas9 complex of any one of claims 2 to 7.