CN112029764B - A method for extracting latent virus genomes - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to an extraction method of a latent virus genome, which utilizes the isoelectric point difference of plant virus capsid protein and plant cell protein, the characteristics of pathogenic genetic materials and the requirements of different plant viruses on PEG concentration. The PEG-coated magnetic core is adopted to successfully separate the latent virus genome from mulberry leaves infected with 4 pathogens, and the obtained genome has higher purity and higher concentration through semi-quantitative and quantitative PCR, thus being applicable to PCR experiments and high-throughput sequencing. Solves the problems of low content of the latent virus pathogen in woody plants, few indicated plants and difficult purification.

Description

A method for extracting latent virus genomes

Technical field

The invention belongs to the field of biotechnology, and specifically relates to a method for extracting latent virus genome.

Background technique

Viruses often cause huge harm to humans, and there are numerous examples of agricultural and forestry plants suffering heavy losses due to viruses, such as rice donglu virus, potato virus Y, wheat yellow dwarf virus, etc.

Viruses are non-cellular organisms with small shapes and simple structures that cannot be observed under a light microscope. Therefore, the classification and purification of viruses is particularly important for the study of viruses. Viruses cannot be cultured through selective media like other microorganisms, nor can they be propagated, expanded and purified on media like bacteria, so the virus must be extracted from the host's tissues. Because viruses stimulate plants to attract vectors such as insects, virus-infected samples collected in the field are often mixed with several viruses. For example, the mixed infection rate of potato Y virus and S virus is more than 80%. This also makes purification of plant viruses difficult.

At present, there are mainly the following methods for virus isolation:

Centrifugation is the earliest method used by people. It mainly takes advantage of the density difference between virus particles and cell fragments. However, the purified virus has many impurities. Only after the advent of high-speed and ultra-high-speed centrifuges did people obtain more satisfactory purification results. On this basis, differential centrifugation and density gradient centrifugation were developed. However, these large-scale equipment are very expensive and require high virus concentration. The concentration of 5-10 mg/kg is the minimum limit for purification by this method, and often requires It took multiple experiments to obtain the purified virus.

The precipitation method mainly uses PEG to precipitate viruses under a certain particle concentration. However, the PEG concentrations required for different virus types vary greatly. For example, 4% PEG can precipitate tobacco mosaic virus, and 11% PEG can precipitate viruses. Precipitate potato S virus. Moreover, PEG can also precipitate some non-viral substances, causing the purified virus to contain more impurities. Moreover, the PEG precipitation method must be combined with low-speed centrifugation, causing the virus particles to easily aggregate and cannot precipitate, so they are lost by centrifugation. At the same time, this method requires the use of organic clarifiers, which can easily cause harm to operators.

With the charge method, virus particles can be directly adsorbed to the surface of polyethylene or polystyrene, and polyethylene centrifuge tubes can be used to directly capture virus particles. However, the non-specificity of this method is too poor, and the types and amounts of genomes obtained are too small.

Immunization method, this method utilizes the specific combination of antigen and antibody. It uses antibody-coated magnetic beads or other easy-to-separate media as carriers. Through the reaction between the antibody and the antigen, an antigen-antibody-media complex is formed. This complex Under the external force of a magnetic field or other separation medium, directional movement occurs to achieve the purpose of separation. The purity of the virus obtained is relatively high, but this method must know the capsid protein of the virus and prepare polyclonal antibodies, which requires a long cycle. .

The filtration method uses the molecular weight of the virus coat protein to centrifuge and precipitate the virus particles, and then dialyze using a dialysis bag with a cutoff of 3KDa. However, the main purpose of this method is to obtain the protein, and the operation cycle is long. Dialysis alone requires 3d, the genome of the virus is severely degraded.

In summary, the problems with the existing technology are that the extracted latent virus genome contains many impurities, the extraction amount is insufficient, or the extraction cycle is long.

Contents of the invention

In order to solve the above technical problems, the present invention provides a method for extracting latent virus genome.

The purpose of the present invention is to provide a method for extracting latent virus genome, including:

Step 1. Sample pretreatment

Collect the mulberry leaves infected with the latent virus and freeze them for 7-15 days. Then mix the mulberry leaves and PBS buffer at a ratio of 1g:5-15mL and grind them into a slurry to obtain a sample solution;

Step 2. Concentration of virus

The sample solution is centrifuged at 3000-10000r to remove the precipitate, and the supernatant is taken to obtain the virus extract;

Step 3. Magnetic bead activation

Place the magnetic bead liquid to be activated on a magnetic stand for 2-3 minutes and remove the supernatant; the resulting precipitate is activated by PBS buffer containing pH 8.0, pH 7.6, pH 7.2, pH 7.2 and containing 0.25-0.35mM sodium chloride. , finally remove the supernatant to obtain activated magnetic beads;

Step 4. Combination of magnetic beads and virus extract

Mix the activated magnetic beads with the virus extract, shake and incubate, remove the supernatant after adsorption on the magnetic stand; add PBS buffer with pH 7.2 and containing 0.25-0.35mM sodium chloride to the precipitate, mix well and place on the magnetic stand for 2-3 minutes , remove the supernatant, and the final collected precipitate is the magnetic bead-virus complex;

Step 5. Elution of latent virus genome

Use buffer E containing Tris-HCl, EDTA, 1-mercaptoglycerol, and SDS to elute the magnetic bead-virus complex to obtain the virus eluate;

Step 6. DNase digestion

Use DNASE enzyme I to digest the virus eluate in step 5 to obtain the latent virus genome.

Preferably, in step one of the extraction method of latent virus genome, the freezing temperature is -28~-18°C.

Preferably, in step one of the extraction method of latent virus genome, the concentration of PBS buffer is 0.1M and the pH is 7.2.

Preferably, in step three of the extraction method of latent virus genome, the magnetic beads are -PEG2000 magnetic beads.

Preferably, for the extraction method of latent virus genome, the specific steps of PBS buffer activation in step three are:

Add pH 8.0 PBS buffer to the pellet, mix well, place on a magnetic stand for 2-3 minutes, and remove the supernatant; add pH 7.6 PBS buffer to the pellet, mix well, place on a magnetic stand for 2-3 minutes, and remove the supernatant; Add pH 7.2 PBS buffer to the pellet, mix well and place on the magnetic stand for 2-3 minutes, remove the supernatant; add pH 7.2 PBS buffer containing 0.3mM sodium chloride to the pellet, mix well and place on the magnetic stand 2 -3min, remove the supernatant, and obtain activated magnetic beads for later use.

Preferably, in the extraction method of latent virus genome, in step 5, the composition of buffer E is: 5mM Tris-HCl, 0.5mM EDTA, 1mL/1000mL 1-mercaptoglycerol, 1g/100mL SDS, the solvent is ddH2O, pH 8.5 .

Preferably, the extraction method of latent virus genome and the specific steps for elution of latent virus genome are:

Add buffer E to the magnetic bead-virus complex, place it in a 70°C water bath for 5 minutes, then place it on a magnetic stand for 5 minutes, absorb the supernatant into a new centrifuge tube, and add 2-3 times the volume of isopropyl to the supernatant. alcohol and 10-20 μL of 5M sodium chloride solution, freeze for 1 hour, and then centrifuge at 4°C and 14,000 r for 10 min. The precipitate is washed with ethanol solution with a volume fraction of 70-75%, and finally dissolved in 100 μL of enzyme-free water to obtain the virus eluate.

Preferably, the sixth step of the extraction method of latent virus genome is as follows:

Use DNASE enzyme I to digest the virus eluate in step 5, and inactivate DNASE enzyme I at 70°C; add 2-3 times the volume of isopropyl alcohol and 10-20 μL 5M sodium chloride solution equivalent to the digestion solution, freeze for 1 hour at 4°C , centrifuge at 14000r for 10 minutes, wash the precipitate with ethanol with a volume fraction of 70-75%, and finally dissolve it with 50 μL of enzyme-free water to obtain the latent virus genome.

Preferably, the method for extracting latent virus genome also includes a PCR detection step:

Carry out reverse transcription on the latent virus genome obtained in step 6, and then use the PARTF668/PARTR975 pair to perform PCR detection on the reverse transcription product. The random primer sequence is 5’-NNNNNN-3’;

PARTF668：5’-ACATCGTCTTGGCGATCCTAA-3’

PARTR975: 5’-TCTGTATTCGGCAGAACCGTAA-3’.

Preferably, the extraction method of latent virus genome also includes a quantitative PCR step:

The quantitative PCR primers are as follows:

YJH CV1 F：5’-GAGTACGAACACACTTGGCC-3’

YJH CV1 R: 5’-AGTCTTGGTGTGCAGGGAAT-3’.

Compared with the existing technology, the extraction method of latent virus genome provided by the present invention has the following beneficial effects:

1. The present invention is based on the difference in isoelectric points between plant virus capsid proteins and plant cell proteins, the characteristics of pathogenic genetic materials, and the needs of different plant viruses for PEG concentration. For the first time, non-specific magnetic beads combined with PEG were used to precipitate and bind virus particles. Using PEG-coated magnetic nuclei, the latent virus genome was successfully isolated from complex mulberry leaves infected with four pathogens. This was confirmed by semi-quantitative and quantitative PCR. The obtained genome has high purity and large concentration, which solves the problems of low pathogen content, few indicator plants and difficult purification in woody plants. The obtained genome has high concentration and proportion and can be used for PCR experiments and high-throughput Sequencing.

2. In order to accelerate the research on the biological characteristics of mulberry latent virus, the present invention successfully purified the mulberry latent virus genome from a mulberry leaf containing four kinds of pathogens. The adsorption specificities of -OH magnetic beads, -COOH magnetic beads, Si-HA magnetic beads, polyelectrolyte layer magnetic beads, -PEG 2000 magnetic beads, Tosylactivated magnetic beads and pure magnetic nuclei for different viruses were compared, and the pH and salt of PBS were optimized. concentration; secondly, non-ultra-low temperature freezing (-28 to -18°C) was used to reduce the impact of host RNA, DNASE enzyme I was used to remove DNA impurities, and boiling and precipitation were used to remove proteins, and a higher purity mulberry latent virus genome was obtained. The best conditions proposed by the present invention are: freeze the sample at -28°C for 10 days, grind 1g sample with 10mL PBS; centrifuge at 5000 rpm for 10 minutes to remove precipitation; the pH of PBS is reduced from 8.0 to 7.2 three times to reduce the impact of the magnetic bead preservation solution on subsequent potential Cryptovirus genome and electrophoresis experiments, etc., and can be effectively activated with -PEG2000 magnetic beads.

Description of drawings

Figure 1 shows electrophoresis patterns of latent virus genomes extracted after infection with different viruses;

Among them, lane 1, latent virus; lane 2, mulberry nematode-borne polyhedral virus (nematode 6309); lane 3, mulberry geminivirus; lane 4, mulberry 356 small RNA; lane 5, mulberry actin gene; lane 6, mulberry TUB gene ; Lane 7, negative control for latent virus, distilled water; Lane M, DL2000;

Figure 2 shows the electrophoresis pattern of latent virus genomes extracted after infection with different magnetic beads and different viruses;

Among them, A, mulberry geminivirus; B, mulberry actin gene; C, mulberry TUB gene; D, mulberry 356 small RNA; E, mulberry nematode-borne polyhedral virus; F, latent virus;

Lane M, DL2000; Lane 1, -OH hydroxyl magnetic beads; Lane 2, -COOH carboxyl magnetic beads; Lane 3, Tosylactivated magnetic beads; Lane 4, -PEG 2000 magnetic beads; Lane 5, Si-HA magnetic beads; Lane 6 , pure magnetic nuclei; lane 7, polyelectrolyte layer magnetic beads; lane 8, positive control. The positive control is the product obtained by directly extracting RNA from mulberry leaves using the sample solution of Example 1, and then reverse transcribing.

Detailed ways

In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention will be further described below with reference to specific embodiments and drawings.

Reagents and methods not specifically noted in the present invention adopt existing technology.

Example 1

A method for extracting latent virus genomes includes the following steps:

The concentration of PBS buffer used in Example 1 was 0.1M.

Step 1. Sample pretreatment

Mulberry leaves infected by four pathogens simultaneously were used and identified by reverse transcription PCR. The four pathogens are mulberry geminivirus (NCBI gene accession number KP303687.1), mulberry nematode-borne polyhedral virus (NCBI gene accession number NC_038767.1), and a mulberry picornavirus (Mulberry 356 small RNA, NCBI Gene accession number KJ532933), mulberry latent virus (NCBI gene accession number MH282498).

Collect mulberry leaves infected with latent virus and freeze them in a -28°C freezer for 10 days. Then put 1g of leaves into a clean mortar, add 10 mL of pH 7.2 PBS buffer and grind evenly to obtain a sample solution.

Step 2. Concentration of virus

The sample solution is centrifuged at 5000r for 10 minutes to remove part of the cell nuclei, chloroplasts and other precipitates. The supernatant is taken as the virus extract and placed on ice or in a 4°C refrigerator for later use.

Step 3. Magnetic bead activation

The types of magnetic beads used in this step are: -OH magnetic beads (Premag, PMC001), -carboxy magnetic beads (Premag, PMC002), Si-HA magnetic beads (Premag, PMCSIHA), polyelectrolyte layer magnetic beads (Adem-tech, 07010), -PEG2000 magnetic beads (Premage, PMC003), Tosylactivated magnetic beads (Thermo Fisher, M280), and pure magnetic cores (Premage, PMC007). The magnetic stand used in the following steps is Omega, MSD03.

Place the magnetic bead liquid to be activated on a magnetic stand for 2 minutes and remove the supernatant; the resulting precipitate is activated by PBS buffer at pH 8.0, pH 7.6, pH 7.2, pH 7.2 and containing 0.3mM sodium chloride, and finally the supernatant is removed. Clean to obtain activated magnetic beads and set aside. The specific activation method is as follows:

Take 100 μL of magnetic bead solution with a concentration of 10 mg/mL, put it into a 1.5 mL centrifuge tube, place it on a magnetic stand for 2 minutes, and remove the supernatant; add 1 mL of pH 8.0 PBS buffer to the precipitate, mix well, and place it on a magnetic stand for 2 minutes before removing it. Supernatant; add 1 mL of pH 7.6 PBS buffer to the pellet, mix well, place on a magnetic stand for 2 minutes, and remove the supernatant; add 1 mL of pH 7.2 PBS buffer to the pellet, mix well, and place on a magnetic stand for 2 minutes, remove the supernatant; Add 1 mL of pH 7.2 PBS buffer containing 0.3 mM sodium chloride to the precipitation, mix well, and place on a magnetic stand for 2 minutes. Remove the supernatant to obtain activated magnetic beads for later use.

Step 4. Combination of magnetic beads and virus extract:

(1) Add 1 mL of virus extract solution to a 1.5 mL magnetic bead centrifuge tube, and incubate with shaking at 25°C and 600 r for 2 hours. Remove the supernatant after adsorption on the magnetic stand for 5 minutes;

(2) Add 1 mL of pH 7.2 PBS buffer containing 0.5 mM sodium chloride to the precipitate, mix well, and place on a magnetic stand for 2-3 minutes. Remove the supernatant and repeat step (2) 4 times to wash away impurities that are not tightly bound. , the final collected precipitate is the magnetic bead-virus complex.

Step 5. Elution of latent virus genome:

Add 100 μL of buffer E to the magnetic bead-virus complex in step 4, mix well, replace the centrifuge tube, place it in a 70°C water bath for 5 minutes, then place it on a magnetic stand for 5 minutes, carefully absorb the supernatant into a new 1.5 mL centrifuge tube In the tube, add 2-3 times the volume of isopropyl alcohol and 10-20 μL of 5M sodium chloride solution, freeze for 1 hour and then centrifuge at 4°C and 14000r for 10 minutes. The precipitate is washed twice with 70-75% ethanol solution and then washed with 100 μL of ethanol solution. Dissolve in enzyme-free water to obtain virus eluate.

The composition of buffer E is: 5mM Tris-HCl, 0.5mM EDTA, 1mL/1000mL 1-mercaptoglycerol, 1g/100mL SDS, the solvent is ddH ₂ O, pH 8.5.

Step 6. DNase digestion:

Use commercial DNASE enzyme I to digest the virus eluate in step 5, and inactivate DNASE enzyme I at 70°C for 5 minutes; add 2-3 times the volume of isopropyl alcohol and 10-20 μL of 5M sodium chloride solution, freeze for 1 hour at 4°C , centrifuge at 14000 r for 10 min, wash the pellet twice with ethanol with a volume fraction of 70-75%, and then dissolve it with 50 μL of enzyme-free water (DNASE, RNASE, PROTEASE) to obtain a sample rich in latent virus genomes.

The temperature of DNASE enzyme I digestion is 37°C, the time is 30 minutes, and the system is: 125 μL. Contains 15U of DNase I, 1×buffer (Promega, M610A).

Step 7. Qualitative PCR detection:

The latent virus genome obtained in step 6 was reverse transcribed using a reverse transcription kit (Promega, A5001). The primers used were random 6 random primers. The reverse transcription system was carried out according to the instructions (RNA template 4 μL; MgCl ₂ 3 μL; Others are fixed addition amounts specified in the kit instructions).

Reverse transcription conditions were: 70°C, 5min; 25°C, 5min; 42°C, 60min; 70°C, 5min. Finish.

Use specific primers to perform PCR detection on the reverse transcription products (genomes of each virus and mulberry tree). See Table 1 for the primer sequences. The random 6 random primer sequence is 5’-NNNNNN-3’. PCR conditions were: 94°C, 3min; 30 cycles (94°C, 30s; 52°C, 35s; 72, 1min); 72°C, 5min; stored at 12°C.

Table 1 Genome primers for each virus and mulberry tree

Figure 1 is the electrophoresis results of different extracted genomes. It can be seen from Figure 1 that the method of the present invention can be used to extract mulberry latent virus genomes with high purity from mulberry samples infected with four pathogens. Figure 2 shows the electrophoresis pattern of latent virus genomes extracted after infection with different magnetic beads and different viruses; the results show that -PEG2000 magnetic beads have the best effect. Although the pure magnetic nuclei in lane 6 of Figure 2F can also amplify the band, this Pure magnetic nuclei are finely dispersed and difficult to recover during the extraction process. The results are unstable, so they are discarded.

Step 8. Quantitative analysis:

Utilize the BIO-RAD CFX Connect ^TM fluorescence quantitative PCR detection system. Use Reagent Power Green PCR Master Mix(Applied/> Cat: 4367659) Perform quantitative PCR analysis on different genomes in the reverse transcription product obtained in step seven.

The primers used in quantitative PCR are listed in Table 2.

Table 2 Quantitative primers for different genomes

The quantitative PCR reaction system is as follows:

Power Green PCR Master Mix 12.5 μL, upstream primer 1 μL, downstream primer 1 μL, internal reference primer 1 μL, template 2 μL, and distilled water to make up 25 μL.

The program used in the quantitative PCR experiment is:

1)95.0℃for 3min

2)95.0℃for 10s

3)55.0℃for 20s

4)72.0℃for 20s

5)75.0℃for 5s

+Plate Read

6)GOTO 2,40more times

7)Melt Curve 65.0to 95.0℃,increment 0.5℃,

0:05+Plate Read

8)End

We maintained the latent virus content before and after treatment (as an internal reference for quantitative PCR, assuming that the fluorescence value of the latent virus remained unchanged), and tested the mulberry nematode-borne polyhedral virus, mulberry geminivirus, mulberry 356 picornavirus, The fluorescence values of mulberry Actin and mulberry TUB before and after treatment were statistically calculated. The results are shown in Table 3.

After processing: refers to the sample rich in latent virus genomes obtained after being processed according to steps 1 to 7 of Example 1.

Before processing: refers to performing sample pretreatment according to the method in Step 1 of Example 1, extracting the RNA of the obtained sample solution using an RNA kit, and then using a reverse transcription kit to obtain a genome sample.

It can be seen from the results in Table 3 that the impurities of mulberry nematode-borne polyhedral virus, mulberry geminivirus, mulberry 356 picornavirus, mulberry Actin, and mulberry TUB in the samples extracted by the method of Example 1 of the present invention were significantly reduced, combined with qualitative PCR detection Analysis shows that the method of Example 1 ensures the amount of latent virus extraction.

Table 3 Quantitative PCR results

It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. Since the steps and methods used are the same as those in the embodiment, in order to avoid redundancy , the present invention describes preferred embodiments. Although the preferred embodiments of the invention have been described, those skilled in the art will be able to make additional changes and modifications to these embodiments once the basic inventive concepts are apparent. Therefore, it is intended that the appended claims be construed to include the preferred embodiments and all changes and modifications that fall within the scope of the invention.

Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the invention. In this way, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and equivalent technologies, the present invention is also intended to include these modifications and variations.

sequence list

<110> Ankang College

<120> A method for extracting latent virus genomes

<160> 24

<170>PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

cctcactgaa gctcctctca ac 22

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

acaatttccc gttcagcagt gg 22

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

gatccacgcc atggtcgtta cc 22

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

gtaccagtgc aagaaagcct tg 22

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence

<400> 5

acatcgtctt ggcgatccta a 21

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

tctgtattcg gcagaaccgt aa 22

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<400> 7

cattgtcagg ctgtggat 18

<210> 8

<211> 21

<212> DNA

<213> Artificial sequence

<400> 8

ccagaatcct cgtgattata c 21

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

agaggtatga tggccacgca 20

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence

<400> 10

gattcattcg cttctgtaca ag 22

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

agaccgccgg agcctcaaat c 21

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence

<400> 12

gaacgaaatt gactgtagag aac 23

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

cattcaagcc gttctttctc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

catcaagtgg tcggtgagat 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

ccaataatgt gaagtctagc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

tgaactgctc gctgaccctc 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

gagtacgaacacacttggcc 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

agtcttggtg tgcagggaat 20

<210> 19

<211> 19

<212> DNA

<213> Artificial sequence

<400> 19

agttgcctca gagcttgca 19

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

tccactgaag tctcgaaccc 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

tccctggcac gcaagtggta 20

<210> 22

<211> 21

<212> DNA

<213> Artificial sequence

<400> 22

gtacactatg gaccctggca c 21

<210> 23

<211> 20

<212> DNA

<213> Artificial sequence

<400> 23

atccacaatt aaccgccagc 20

<210> 24

<211> 21

<212> DNA

<213> Artificial sequence

<400> 24

tgaccgtact catgcctaac a 21

Claims (7)

1. A method for extracting latent virus genome, which is characterized by including: Step 1. Sample pretreatment Collect mulberry leaves infected with latent virus and freeze them for 7-15 days. Then mix and grind the mulberry leaves and PBS buffer into a slurry according to 1g:5-15mL to obtain a sample solution; Step 2. Concentration of virus The sample solution is centrifuged at 3000-10000r to remove the precipitate, and the supernatant is taken to obtain the virus extract; Step 3. Magnetic bead activation Place the magnetic bead solution to be activated on a magnetic stand for 2-3 minutes and remove the supernatant; the resulting precipitate is activated by PBS buffer at pH 8.0, pH 7.6, pH 7.2, pH 7.2 and containing 0.25-0.35mM sodium chloride. Finally, remove the supernatant to obtain activated magnetic beads; Step 4. Combination of magnetic beads and virus extract The magnetic beads are PEG2000 magnetic beads; Mix the activated magnetic beads with the virus extract, incubate with shaking, remove the supernatant after adsorption on the magnetic stand; add PBS buffer with pH 7.2 and containing 0.25-0.35mM sodium chloride to the precipitate, mix well and place on the magnetic stand 2- After 3 minutes, remove the supernatant, and the final collected precipitate is the magnetic bead-virus complex; Step 5. Elution of latent virus genome Add buffer E to the magnetic bead-virus complex, place it in a 70°C water bath for 5 minutes, then place it on a magnetic stand for 5 minutes, absorb the supernatant into a new centrifuge tube, and add 2-3 times the volume of isopropyl to the supernatant. Alcohol and 10-20 μL of 5M sodium chloride solution, freeze for 1 hour, centrifuge at 4°C and 14000r for 10 minutes, wash the precipitate with ethanol solution with a volume fraction of 70-75%, and finally dissolve it with 100 μL of enzyme-free water to obtain the virus eluate; Step 6. DNase digestion Use DNASE enzyme I to digest the virus eluate in step 5, and inactivate DNASE enzyme I at 70°C; add 2-3 times the volume of isopropyl alcohol and 10-20 μL 5M sodium chloride solution equivalent to the digestion solution, freeze for 1 hour at 4°C , centrifuge at 14000r for 10 minutes, wash the precipitate with ethanol with a volume fraction of 70-75%, and finally dissolve it with 50 μL of enzyme-free water to obtain the latent virus genome. 2. The method for extracting latent virus genome according to claim 1, characterized in that in step one, the freezing temperature is -28 ~ -18°C. 3. The method for extracting latent virus genome according to claim 2, characterized in that in step one, the concentration of PBS buffer is 0.1M and the pH is 7.2. 4. The extraction method of latent virus genome according to claim 1, characterized in that the specific steps of PBS buffer activation in step three are: Add pH 8.0 PBS buffer to the pellet, mix well, place on a magnetic stand for 2-3 minutes, and remove the supernatant; add pH 7.6 PBS buffer to the pellet, mix well, place on a magnetic stand for 2-3 minutes, and remove the supernatant; Add pH 7.2 PBS buffer to the pellet, mix well and place it on a magnetic stand for 2-3 minutes, remove the supernatant; add pH 7.2 PBS buffer containing 0.25-0.35mM sodium chloride to the pellet, mix well and place it on a magnetic stand. Stand for 2-3 minutes, remove the supernatant, and obtain activated magnetic beads for later use. 5. The extraction method of latent virus genome according to claim 1, characterized in that, in step five, the composition of buffer E is: 5mM Tris-HCl, 0.5mM EDTA, 1mL/1000mL 1-mercaptoglycerol, 1g /100mL SDS, the solvent is ddH ₂ O, pH 8.5. 6. The method for extracting latent virus genome according to claim 1, further comprising a PCR detection step: Carry out reverse transcription of the latent virus genome obtained in step 6, and then use PARTF668/ PARTR975 to perform PCR detection on the reverse transcription product. The random primer sequence is 5’-NNNNNN-3’; PARTF668：5’-ACATCGTCTTGGCGATCCTAA-3’ PARTR975: 5’-TCTGTATTCGGCAGAACCGTAA-3’. 7. The method for extracting latent virus genome according to claim 1, further comprising a quantitative PCR step: The quantitative PCR primers are as follows: YJH CV1 F：5’-GAGTACGAACACACTTGGCC-3’ YJH CV1 R: 5’-AGTCTTGGTGTGCAGGGAAT-3’.