CN116769760A

CN116769760A - Complex enzyme, engineering strain, biological material and application for producing resveratrol

Info

Publication number: CN116769760A
Application number: CN202310293958.3A
Authority: CN
Inventors: 王会艳; 刘腾飞; 陈彤彤; 张晓芬; 陶文文; 王瑞妍
Original assignee: Beijing Huaxi Rongxi Biotechnology Research Co ltd
Current assignee: Beijing Huaxi Rongxi Biotechnology Research Co ltd
Priority date: 2023-03-23
Filing date: 2023-03-23
Publication date: 2023-09-19

Abstract

The application provides a complex enzyme for producing resveratrol, belonging to the technical field of genetic engineering. Comprising the following steps: tyrosine ammonia lyase FjTAL derived from Flavobacterium johnsonii (Flavobacterium johnsoniae), 4-coumaroyl-CoA ligase At4CL derived from Arabidopsis thaliana (Arabidopsis thaliana), resveratrol synthase PcSTS derived from Polygonum cuspidatum (Polygonum cuspidatum) and/or malonyl-CoA synthase AtAAE13 derived from Arabidopsis thaliana (Arabidopsis thaliana). According to the technical scheme provided by the application, the GAL80 gene of the yeast strain is knocked out and the galactose-inducible promoter is combined, so that decoupling of yeast body production and resveratrol synthesis is realized, and the resveratrol synthesis related enzyme with higher activity is introduced, so that the metabolic pressure of a target pathway on engineering bacteria is reduced, and the efficient and rapid growth of resveratrol is realized.

Description

Complex enzyme, engineering strain, biological material and application for producing resveratrol

Technical Field

The application belongs to the technical field of genetic engineering, and particularly relates to a complex enzyme for producing resveratrol, an engineering strain, a biological material, a production method and application of the complex enzyme in producing resveratrol.

Background

Resveratrol (Res) is a non-flavonoid natural polyphenol substance with a stilbene structure in various plants, and is a plant secondary metabolite produced by plants under stress or non-stress conditions such as ultraviolet rays, fungal infection, injury and the like. At present, resveratrol is found in 72 plants of 21 families such as Vitaceae, leguminosae, arachis, cassia, rhizoma Polygoni Cuspidati, polygoni Multiflori radix, pine and Mori fructus, and its maximum content in rhizoma Polygoni Cuspidati is only 0.2%. Research shows that resveratrol has physiological and pharmacological effects of resisting oxidation, resisting cancer, resisting bacteria, resisting inflammation, protecting cardiovascular system, regulating blood lipid, treating diabetes, etc.

The supply of resveratrol in the market at present mainly depends on plant extraction, however, the complexity of the extraction process and the extremely low content in plant tissues lead to extremely low process yield and productivity. The chemical synthesis is complicated in engineering and cannot meet the requirements of green production. With the increasing development of synthetic biology, more and more natural products have achieved production and synthesis in microorganisms. Therefore, the use of microorganisms as a cell factory for the production of resveratrol is a new option.

The synthesis of resveratrol by using saccharomycetes as a chassis has two main approaches reported at present. One is to produce trans-cinnamic acid from phenylalanine by phenylalanine ammonia lyase (phenylalanine ammonia-lyase, PAL), and then to form a source of coumaric acid by cinnamic acid 4-hydroxylase (C4H). Then coumaric acid is converted into coumaric acid acyl-coa by 4-coumarate (4-coumarate: counase alignment, 4 CL), and the last molecule of coumarate acyl-coa is combined with 3 molecules of malonyl-coa under the catalysis of resveratrol synthase (resveratrol synthase, RS) to generate resveratrol; the second is that intracellular tyrosine forms coumaric acid under the action of tyrosine ammonia lyase (tyrosine ammonialyase, TAL), followed by the catalytic formation of resveratrol via 4CL and RS. Thus, both 4CL and RS enzymes are required to participate in the formation of resveratrol, whether phenylalanine or tyrosine is used as a substrate. While the metabolic flux of the target product can be improved through a series of metabolic pathway optimization at present, the resveratrol yield in the existing stage still cannot meet the industrial production requirement.

At present, resveratrol is produced inefficiently mainly because of a plurality of speed limiting steps in the biosynthesis pathway, and two key speed limiting steps are completed by 4CL and STS catalysis (shown in figure 1). These two key enzymes are not high in activity, resulting in low yield of resveratrol as the target product in microorganisms. Therefore, research hotspots for heterologous synthesis of resveratrol by taking microorganisms as a chassis mainly focus on digging genes of high-activity coded 4-coumaroyl-CoA ligase and resveratrol synthase from natural environment, or modifying the genes of the existing speed limiting step to improve the catalytic efficiency, replace the chassis which is more beneficial to the production of resveratrol, and the like.

At present, 4CL genes derived from plants such as Arabidopsis, tobacco, parsley and the like and STS genes derived from sources such as grape, giant knotweed, peanut and the like have been mined for the construction of resveratrol synthesis pathways. However, the most widely used and most effective combination of At4CL from arabidopsis and VvSTS of grape is currently used. For example, patent CN114317306a integrates At4CL from arabidopsis thaliana and VvSTS of saccharomyces cerevisiae in rhodovorula yeast for resveratrol production. In the patent CN108117588A, error-prone PCR is carried out on the At4CL gene derived from Arabidopsis thaliana to mutate the gene, so that a mutant with improved catalytic activity is obtained. Patents CN106032525A, CN110628657A, CN111733179a and CN114317306a employ escherichia coli, saccharomyces cerevisiae, yarrowia lipolytica, and rhodosporidium toruloides as production chassis for resveratrol, respectively.

However, from the current patents and production situation, the low precursor supply and key enzyme 4CL and STS enzyme activities are still bottlenecks that limit the production of resveratrol in the microbial chassis.

Disclosure of Invention

The application aims to design a fusion protein strategy capable of improving the yield of resveratrol, construct an expression vector capable of efficiently expressing key enzymes in a synthesis path for synthesizing resveratrol by adopting microorganisms, lighten the metabolic pressure of the target path on engineering bacteria, and prepare engineering strains capable of producing resveratrol in high quantity.

In one aspect, the present application provides a complex enzyme for producing resveratrol, comprising tyrosine ammonia lyase FjTAL derived from Flavobacterium johnsonii (Flavobacterium johnsoniae), 4-coumaroyl-CoA ligase At4CL derived from Arabidopsis thaliana (Arabidopsis thaliana), resveratrol synthase PcSTS derived from Polygonum cuspidatum (Polygonum cuspidatum), and/or malonyl-CoA synthase AtAAE13 derived from Arabidopsis thaliana (Arabidopsis thaliana).

In one embodiment, the complex enzyme comprises any two of the above enzymes; preferably, at least any one of FjTAL, at4CL and PcSTS and AtAAE13 are included; more preferably, the complex enzyme includes FjTAL, at4CL, pcSTS and AtAAE13.

In one embodiment, a tyrosine ammonia lyase FjTAL derived from flavobacterium johnsonii (Flavobacterium johnsoniae) having an amino acid sequence as shown in SEQ ID No.2 or having at least 90% sequence identity with SEQ ID No. 2;

an arabidopsis thaliana (Arabidopsis thaliana) -derived 4-coumaroyl-coa ligase At4CL having an amino acid sequence as shown in SEQ ID No.6 or having At least 90% sequence identity to SEQ ID No. 6;

resveratrol synthase PcSTS derived from rhizoma Polygoni Cuspidati (Polygonum cuspidatum) has amino acid sequence shown in SEQ ID NO.14 or at least 90% sequence identity with SEQ ID NO. 14;

an arabidopsis thaliana (Arabidopsis thaliana) -derived malonyl-coa synthase AtAAE13, the amino acid sequence of which is shown in SEQ ID No.20 or has at least 90% sequence identity to SEQ ID No. 20.

In another aspect, the present application provides an engineered strain for producing resveratrol, the enzyme expressed by the engineered strain comprising:

a tyrosine ammonia lyase FjTAL derived from flavobacterium johnsonii (Flavobacterium johnsoniae) having an amino acid sequence as shown in SEQ ID No.2 or having at least 90% sequence identity with SEQ ID No. 2;

Resveratrol synthase PcSTS derived from rhizoma Polygoni Cuspidati (Polygonum cuspidatum) has amino acid sequence shown in SEQ ID NO.14 or at least 90% sequence identity with SEQ ID NO. 14.

Alternatively, the amino acid sequences of the above enzymes may each have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with the corresponding sequences shown.

In one embodiment, the enzyme expressed by the engineering strain further comprises,

an arabidopsis thaliana (Arabidopsis thaliana) -derived malonyl-coa synthase AtAAE13 having an amino acid sequence as shown in SEQ ID No.20 or having at least 90% sequence identity to SEQ ID No. 20;

or (b)

A malonyl-coa synthase CsAAE derived from flax (Camelina sativa) having an amino acid sequence as shown in SEQ ID No.22 or having at least 90% sequence identity to SEQ ID No. 22.

Preferably, the engineering strain is capable of simultaneously expressing FjTAL, at4CL, pcSTS and AtAAE13, or the engineering strain is capable of simultaneously expressing FjTAL, at4CL, pcSTS and CsAAE, more preferably the former.

In one embodiment, the flavobacterium johnsonii (Flavobacterium johnsoniae) -derived tyrosine ammonia lyase FjTAL has a nucleotide sequence as shown in SEQ ID No.1 or has at least 90% sequence identity with SEQ ID No. 1;

the nucleotide sequence of the 4-coumaroyl-CoA ligase At4CL derived from arabidopsis thaliana (Arabidopsis thaliana) is shown as SEQ ID NO.5 or has At least 90% sequence identity with SEQ ID NO. 5;

the resveratrol synthase PcSTS from the giant knotweed (Polygonum cuspidatum) has a nucleotide sequence shown in SEQ ID NO.13 or has at least 90% sequence identity with SEQ ID NO. 13;

the nucleotide sequence of the malonyl-coenzyme A synthase AtAAE13 from arabidopsis thaliana (Arabidopsis thaliana) is shown as SEQ ID NO.19 or has at least 90% sequence identity with SEQ ID NO. 19;

the malonyl-CoA synthase CsAAE derived from flax (Camellia sativa) has a nucleotide sequence as shown in SEQ ID No.21 or has at least 90% sequence identity with SEQ ID No. 21.

The nucleotide sequences for encoding FjTAL, at4CL, pcSTS, atAAE and CsAAE enzymes are nucleotide sequences after codon optimization, and the nucleotide sequences before optimization are shown in SEQ ID NO. 23-SEQ ID NO. 27.

In another aspect, the present application also provides a biomaterial, the biomaterial comprising any one of the following A1) to A5):

a1 A nucleic acid molecule which is a polynucleotide encoding any one of the amino acid sequences shown in SEQ ID NO.2, SEQ ID NO.6, SEQ ID NO.14, SEQ ID NO.20, SEQ ID NO. 22;

a2 A transformant containing the nucleic acid molecule of A1);

a3 An expression vector comprising A1) the nucleic acid molecule;

a4 A recombinant microorganism comprising A1) the nucleic acid molecule, A2) the transformant and/or A3) the expression vector;

a5 A recombinant cell comprising A1) the nucleic acid molecule, A2) the transformant and/or A3) the expression vector;

a6 A whole cell catalyst comprising A4) said recombinant microorganism.

In one embodiment, the nucleotide sequence of the nucleic acid molecule is any one of SEQ ID NO.1, SEQ ID NO.5, SEQ ID NO.13, SEQ ID NO.19, SEQ ID NO.21, or has at least 90% sequence identity with any one of SEQ ID NO.1, SEQ ID NO.5, SEQ ID NO.13, SEQ ID NO.19, SEQ ID NO. 21.

Alternatively, the nucleotide sequences of the above enzymes may each have a sequence identity of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with the corresponding sequences shown.

The "microorganism" as used herein may be a bacterium, fungus, actinomycete, protozoa, algae or virus. Wherein the bacteria may be derived from Escherichia sp, erwinia sp, agrobacterium sp, flavobacterium sp, alcaligenes sp, pseudomonas sp, bacillus sp, etc., but are not limited thereto, and for example, the bacteria may be Escherichia coli, corynebacterium glutamicum Corynebacterium glutamicum, brevibacterium lactofermentum, brevibacterium flavum brevibacterium flavum, brevibacterium Beijing Corynebacterium pekinense, brevibacterium ammonia-phaga, corynebacterium blunt, pantoea, etc. The fungus may be a yeast, which may be from the genera Saccharomyces (e.g., saccharomyces cerevisiae Saccharomyces cerevisiae), kluyveromyces (e.g., kluyveromyces lactis Kluyveromyces lactis), pichia (e.g., pichia pastoris), schizosaccharomyces (e.g., schizosaccharomyces pombe Schizosaccharomyces pombe), hansenula (e.g., hansenula polymorpha Hansenula polymorpha), etc., but is not limited thereto. The fungus may also be from fusarium (fusarium sp.), rhizoctonia (Rhizoctonia sp.), verticillium sp.), penicillium sp, aspergillus sp, cephalosporium sp, and the like, but is not limited thereto. The actinomycetes may be derived from Streptomyces sp, nocardia sp, micromonospora sp, neurospora sp, actinoplanes sp, thermoactinomyces sp, etc., but are not limited thereto. The algae may be from, but not limited to, fucus sp, aspergillus sp, coccoli sp, amphizora sp, double-eyebrow sp, cellulomella sp, astronella sp, boekelovia sp, etc. The virus may be rotavirus, herpes virus, influenza virus, adenovirus, etc., but is not limited thereto. In one embodiment, the chassis cells of the engineering strain are selected from one or more of yeasts, E.coli, B.subtilis and C.glutamicum.

Preferably, the chassis cell is a yeast.

More preferably, the yeast is pichia or saccharomyces cerevisiae.

More preferably, the yeast is Saccharomyces cerevisiae.

On the other hand, the application also provides application of the complex enzyme, the engineering strain or the biological material in preparing resveratrol.

In another aspect, the application also provides application of the complex enzyme, the engineering strain or the biological material in preparation of medicines, foods or cosmetics containing resveratrol.

In another aspect, the present application also provides a method for producing resveratrol, comprising the step of obtaining resveratrol using the engineering strain, or the biological material.

Preferably, the production method comprises the following steps:

obtaining recombinant biological cells containing the engineering strain or the biological material, and culturing the recombinant biological cells to obtain resveratrol.

Preferably, the culturing includes fermentation culturing.

More preferably, the engineering strain is a yeast engineering strain, and the step of obtaining resveratrol by fermenting the yeast engineering strain comprises the following steps: inoculating the yeast engineering bacteria into a culture medium, fermenting and culturing for 10-20 hours at the temperature of 25-35 ℃ and the rpm of 200-300, transferring into a culture medium with the concentration of 1-5% glucose for continuous culturing for 20-30 hours, adding galactose with the concentration of 1-5%, and continuously fermenting and culturing for 40-60 hours at the temperature of 25-35 ℃ and the rpm of 200-300.

Alternatively, the fermentation temperature may be 25 ℃, 26 ℃, 27 ℃, 28 ℃, 29 ℃, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃, 35 ℃; the glucose concentration can be 1%, 2%, 3%, 4%, 5%; the final concentration of galactose may be 1%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%.

On the other hand, the application also provides application of the malonyl-CoA synthase AtAAE13 from Arabidopsis thaliana (Arabidopsis thaliana) or the malonyl-CoA synthase CsAAE from flax (Camellia sativa) in preparation of resveratrol.

Preferably, the amino acid sequence of the malonyl-coa synthase AtAAE13 derived from arabidopsis thaliana (Arabidopsis thaliana) is shown in SEQ ID No.20 or has at least 90% sequence identity with SEQ ID No. 20;

the amino acid sequence of the malonyl-CoA synthase CsAAE derived from flax (Camellia sativa) is shown as SEQ ID NO.22 or has at least 90% sequence identity with SEQ ID NO. 22.

The technical scheme provided by the application has at least the following beneficial effects:

1. according to the technical scheme provided by the application, the GAL80 gene of the yeast strain is knocked out and the galactose-inducible promoter is combined, so that the decoupling of the yeast body production and the resveratrol synthesis is realized, the metabolic pressure of a target pathway on engineering bacteria is reduced, and the efficient and rapid growth of resveratrol is realized;

2. according to the technical scheme provided by the application, the design of the tyrosine ammonia lyase (FjTAL) derived from Flavobacterium johnsonii (Flavobacterium johnsoniae), the 4-coumaroyl-CoA ligase (At 4 CL) derived from Arabidopsis thaliana (Arabidopsis thaliana) and the resveratrol synthase (PcSTS) derived from polygonum cuspidatum (Polygonum cuspidatum) is introduced into a synthesis path from tyrosine to resveratrol, and the amino acid sequence is optimized, so that higher enzyme activity is displayed, and the production efficiency of resveratrol is improved;

3. according to the technical scheme provided by the application, malonyl-CoA from arabidopsis thaliana (Arabidopsis thaliana) or malonyl-CoA from flax (Camelina sativa) is also introduced into the recombinant vector, so that the supply of malonyl-CoA which is a precursor for resveratrol synthesis is increased, and the nucleotide sequence is optimized, so that metabolic flow is further caused to flow to the synthesis of target product resveratrol;

4. According to the technical scheme provided by the application, the yeast engineering strain capable of expressing FjTAL, at4CL, pcSTS and AtAAE13 or expressing FjTAL, at4CL, pcSTS and CsAAE is successfully obtained, the yield of resveratrol produced by shake flask fermentation of the yeast engineering strain can reach more than 70mg/L and can reach 114mg/L At most, and the economic benefit of the fermentation production of resveratrol is remarkably improved.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and together with the description serve to explain the application and do not constitute a limitation on the application. In the drawings:

FIG. 1 is a route pattern of resveratrol biosynthesis pathway;

FIG. 2 is a graph showing the liquid phase curve of the extracted product after the fermentation of engineering strain RES is completed, compared with the liquid phase curve of the p-coumaric acid and resveratrol standard.

Detailed Description

In order to more clearly illustrate the general idea of the application, the following detailed description is given by way of example with reference to the accompanying drawings. In the following description, numerous specific details are set forth in order to provide a more thorough understanding of the present application. It will be apparent, however, to one skilled in the art that the application may be practiced without one or more of these details. In other instances, well-known features have not been described in detail in order to avoid obscuring the application.

The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer.

In the following embodiments, unless specified otherwise, the reagents or apparatus used are conventional products available commercially without reference to the manufacturer.

The plasmids, endonucleases, PCR enzymes, column type DNA extraction kits, DNA gel recovery kits and the like used in the following examples are commercially available products, and specific operations are performed according to the kit instructions.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed in the present application are all performed according to Molecular Cloning: ALaboratory Manual (fourths Edition) using molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA techniques, and conventional techniques in the relevant arts, which are conventional in the art.

The plasmids, endonucleases, PCR enzymes, DNA extraction kits, DNA gel recovery kits and the like used in the following examples are commercially available products, and specific operations are performed according to the kit instructions.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein are all accomplished using techniques conventional or known in the art.

EXAMPLE 1 construction of recombinant plasmid containing the Gene of interest

1. The experimental reagents used in this example and the preparation method thereof are as follows:

1) LB medium

The composition of the LB medium used in this example is shown in Table 1:

table 1 LB Medium formulation

Component (A)	Content (g/L)
		Tryptone	10
Yeast extract	5
		Sodium chloride	10

The preparation method comprises the following steps: after the formulation in Table 1 was completed, distilled water was used to fix the volume to 1L and sterilized at 121℃for 20 minutes. The prepared antibiotics (Amp with the final concentration of 100 mug/mL) can be added in advance for use after being uniformly mixed. To prepare a solid LB culture medium, 20g/L agar powder is added.

2) YPD Medium

The composition of the YPD medium used in this example is shown in Table 2:

TABLE 2 YPD Medium formulation

Component (A)	Content (g/L)
		Peptone	20
Yeast extract	10

The preparation method comprises the following steps: after the formulation in Table 2 was completed, distilled water was used to determine the volume to 950mL and sterilized at 121℃for 20 minutes. When in use, 40% galactose or 40% glucose prepared in advance is added for uniform mixing (the final concentration is 2%). To prepare a solid YPD medium, 20g/L agar powder was added.

3) SD-LEU screening medium

The composition of the SD-LEU screening medium used in this example is shown in Table 3:

table 3 SD-LEU screening Medium formulations

Component (A)	Content of
		YENB	6.7g/L
Amino acid supplements	1.394g/L
		Ura	76mg/L
His	76mg/L
		Trp	76mg/L

The preparation method comprises the following steps: after the formulation in Table 3 was completed, distilled water was used to determine the volume to 950mL, the pH of the medium was adjusted to 6.5, and the medium was sterilized at 121℃for 20 minutes. When in use, 40 percent galactose or 40 percent glucose prepared in advance is added for uniform mixing for use (the final concentration is 2 percent). To prepare a solid SD-LEU screening medium, 20g/L agar powder is added.

4) 40% dextrose solution: 40g of glucose was weighed and dissolved in distilled water to a volume of 100mL. Sterilizing at 115 deg.C for 15 min, and sealing for storage.

5) 40% galactose solution: 40g galactose was weighed and dissolved in distilled water to a constant volume of 100mL. Filtering, sterilizing, and sealing for storage.

6) LiAC solution of 1M: weighing 6.6g of LiAC, dissolving in 100mL of water, sterilizing at 121 ℃, and preserving in a room temperature environment;

7) 50% peg3350 solution: dissolving 50mg of PEG3350 in distilled water, adding water to a volume of 100mL, filtering, sterilizing, and preserving to normal temperature.

8) 20mg/mL p-coumaric acid solution: 20mg of p-coumaric acid was weighed and dissolved in 1mL of sterile water, and after filtration through a 0.22 μm sterile filter membrane, the solution was stored at 4 ℃.

2. The names and sources of the strains and plasmids used in this example are as follows:

strains: saccharomyces cerevisiae CEN-PK was purchased from North Nanoea (cat. No. 361357); coli DH 5. Alpha. Was purchased from Nanjinopran Biotechnology Co., ltd (cat. No. C502-02).

Plasmid: the expression vector pESC-LEU was purchased from Ubbelopsis (cat# VT 1771); plasmids pESC-URA and pESC-TRP were purchased from Ubbelopsis (cat. Nos. VT1773 and VT 1772).

In this example Saccharomyces cerevisiae CEN-PK was used as the chassis, but in practice the microorganism chassis used includes but is not limited to Saccharomyces cerevisiae, and common yeast chassis are applicable.

3. The sequence of the enzyme used in this example and construction of the recombinant plasmid:

the plant or microorganism derived enzymes required for the resveratrol synthesis pathway used in this example were identified from different plant sources by the national center for biological information NCBI (https:// www.ncbi.nlm.nih.gov /) and literature search and found the corresponding amino acid sequence or gene sequence.

The obtained gene sequence is synthesized by the Kirschner Biotechnology Co., ltd, and codon optimization is carried out according to the corresponding yeast host, and the specific sequence after optimization is as follows:

the nucleic acid molecule of the tyrosine ammonia lyase FjTAL derived from Flavobacterium johnsonii (Flavobacterium johnsoniae) is shown as SEQ ID NO.1 in the sequence table, and the amino acid molecule of the tyrosine ammonia lyase FjTAL is shown as SEQ ID NO.2 in the sequence table;

the nucleotide molecule of the tyrosine lyase HaTAL derived from the Xylaria aurantiaca (Herpetosiphon aurantiacus) is shown as SEQ ID NO.3 in a sequence table, and the amino acid molecule of the tyrosine lyase HaTAL is shown as SEQ ID NO.4 in the sequence table;

the nucleic acid molecule of the 4-coumaroyl-CoA ligase At4CL from arabidopsis thaliana (Arabidopsis thaliana) is shown as SEQ ID NO.5 in a sequence table, and the amino acid molecule of the nucleic acid molecule is shown as SEQ ID NO.6 in the sequence table;

the nucleic acid molecule of the 4-coumaroyl-CoA ligase Ma4CL derived from mulberry (Morus alba L) is shown as SEQ ID NO.7, and the amino acid molecule is shown as SEQ ID NO. 8;

the sunflower (Helianthus annuus) source 4-coumaroyl-CoA ligase Ha4CL2 nucleic acid molecule is shown as SEQ ID NO.9, and the amino acid molecule is shown as SEQ ID NO. 10;

the nucleic acid molecule of resveratrol synthetase VvSTS derived from grape (Vitis vinifera) is shown in SEQ ID NO.11 in the sequence table, and the amino acid molecule is shown in SEQ ID NO.12 in the sequence table;

The nucleic acid molecule of resveratrol synthetase PcSTS derived from rhizoma Polygoni Cuspidati (Polygonum cuspidatum) is shown in SEQ ID NO.13 in the sequence table, and the amino acid molecule is shown in SEQ ID NO.14 in the sequence table;

the resveratrol synthase MaSTS3 nucleic acid molecule derived from mulberry (Morus alba L) is shown in SEQ ID NO.15, and the amino acid molecule is shown in SEQ ID NO. 16;

the resveratrol synthase FmSTS nucleic acid molecule derived from Polygoni Multiflori radix (Fallopia multiflora) is shown in SEQ ID NO.17, and the amino acid molecule is shown in SEQ ID NO. 18;

the nucleic acid molecule of the malonyl-CoA synthase AtAAE13 from Arabidopsis thaliana (Arabidopsis thaliana) is shown as SEQ ID NO.19, and the amino acid molecule is shown as SEQ ID NO. 20;

the nucleic acid molecule of malonyl-CoA synthase CsAAE derived from flax (Camellia sativa) is shown as SEQ ID NO.21, and the amino acid molecule is shown as SEQ ID NO. 22;

the nucleotide sequences of the genes FjTAL (marked as FjTAL '), at4CL1 (marked as At4CL1 '), pcSTS (marked as PcSTS '), atAAE13 (marked as AtAAE13 ') and CsAAE (marked as CsAAE ') which are not subjected to codon optimization are respectively shown in SEQ ID NO. 23-SEQ ID NO.27, and the nucleotide sequences or the amino acid sequences are shown in the sequence table of the annex.

The above gene fragment was directly synthesized on a universal plasmid pESC series having a galactose promoter (pGAL 1 or pGAL 10) to obtain a recombinant plasmid containing the target gene, as shown in table 4.

TABLE 4 list of recombinant plasmids used in the invention

Plasmid(s)	Genotype of the type
		pESC-LEU-FjTAL	2μ；LEU2；AmpR；GAL1p-FjTAL-ADH1t
pESC-LEU-FjTAL’	2μ；LEU2；AmpR；GAL1p-FjTAL’-ADH1t
		pESC-LEU-HaTAL	2μ；LEU2；AmpR；GAL1p-HaTAL-ADH1t
pESC-URA-At4CL-PcSTS	2μ；URA3；AmpR；GAL1p-At4CL-CYC1t；GAL10p-PcSTS-ADH1t
		pESC-URA-At4CL’-PcSTS’	2μ；URA3；AmpR；GAL1p-At4CL‘-CYC1t；GAL10p-PcSTS’-ADH1t
pESC-URA-At4CL-VvSTS	2μ；URA3；AmpR；GAL1p-At4CL-CYC1t；GAL10p-VvSTS-ADH1t
		pESC-URA-At4CL-MaSTS3	2μ；URA3；AmpR；GAL1p-At4CL-CYC1t；GAL10p-MaSTS3-ADH1t
pESC-URA-At4CL-FmSTS	2μ；URA3；AmpR；GAL1p-At4CL-CYC1t；GAL10p-FmSTS-ADH1t
		pESC-URA-Ma4CL-PcSTS	2μ；URA3；AmpR；GAL1p-Ma4CL-CYC1t；GAL10p-PcSTS-ADH1t
pESC-URA-Ha4CL2-PcSTS	2μ；URA3；AmpR；GAL1p-Ha4CL2-CYC1t；GAL10p-PcSTS-ADH1t
		pESC-TRP-AtAAE13	2μ；TRP1；AmpR；GAL1p-AtAAE13-ADH1t
pESC-TRP-AtAAE13’	2μ；TRP1；AmpR；GAL1p-AtAAE13‘-ADH1t
		pESC-TRP-CsAAE	2μ；TRP1；AmpR；GAL1p-CsAAE-ADH1t
pESC-TRP-CsAAE’	2μ；TRP1；AmpR；GAL1p-CsAAE‘-ADH1t

EXAMPLE 2 construction of engineering bacteria

1. The experimental materials involved in this example are as follows:

primer 1-F:

CAAGGAGAAAAAACCCCGGATCCATGGCTCCACAAGAACAAGCTG

primer 1-R:

CTAGCCGCGGTACCAAGCTTACTCGAGTCAAAGACCGTTAGCCAACT TAG

primer 2-F:

GTGCGGCCGCCCTTTAGTGAGGTCAGATGATTGGGACAGAACGC

primer 2-R:

GAATTTTTGAAAATTCGAATTCAACATGGCTGCTTCTACCGAAGAA primer 3-F:

GTTGAATTCGAATTTTCAAAAATTCTTAC

primer 3-R:

GGATCCGGGGTTTTTTCTCCTTGACGTTAAA

primer 4-F:

GAATTGTTAATTAAGAGCTCTCAGTTAGTAACAGTAGGAACAGAG

primer 4-R:

CAACCCTCACTAAAGGGCGGCCGCATGGCTTCTGTCGAAGAATTCC primer 5-F:

GGTGGTTCCGGTGGTTCTGGTATGGCTACTTCCGTTCAAGAAATC

primer 5-R:

CGCGGTACCAAGCTTACTCGAGTTACTCGAGGTTGATTGGCAAAGA primer 6-F:

CAAGGAGAAAAAACCCCGGATCCATGGCTGCTTCTGCAACAGTCCT primer 6-R:

CTTAGCTAGCCGCGGTACCAAGCTTACTCGAGAAAGATTGGAACTG primer 7-F:

CAAGGAGAAAAAACCCCGGATCCATGGACGTTCCACATCACCACCA primer 7-R:

CGTGGACAGATGGGGTCATGGACATACCTGAACCACCGGAACCTC primer 8-F:

TCAAGGAGAAAAAACCCCGGATCCATGGCGCCAGAAAAGGAAATC primer 8-R:

CTTAGCTAGCCGCGGTACCAAGCTTACTCGAGTGGAACACCAGCAG primer 9-F:

CAAGGAGAAAAAACCCCGGATCCATGGCGCCACAAGAACAAGCAG primer 9-R:

CTTAGCTAGCCGCGGTACCAAGCTCACAATCCATTTGCTAGTTTTGCC primer 10-F:

CAAGGAGAAAAAACCCCGGATCCATGGCAGCTTCAACTGAAGAGAT primer 10-R:

CTTAGCTAGCCGCGGTACCAAGCTTAAATGATGGGCACACTTCGTAG primer 11-F:

CTGACACTGGTGACTCTTTG

primer 11-R:

CCGAACGACCGAGCGCAGCG

TABLE 5 pharmaceutical products and reagents

Codon optimization and synthesis of the gene sequence were performed by Nanjing Jinsrui company and sequencing was performed by Suzhou Jin Weizhi company.

2. Experimental method

1. Construction of pESC-At4CL1-PcSTS recombinant plasmid

1) Construction of vector fragments

The vector pESC was treated with the enzymes NotI and BamHI, both purchased from NEB, in accordance with the cleavage system shown in Table 6, and the prepared cleavage system was allowed to stand in a water bath at 37℃for 1 hour. And (3) performing DNA purification and recovery on the Backbone and the promoter after enzyme digestion by using a gel recovery kit purchased from the Siemens technology company to obtain a purified Backbone1 fragment and a Gal1-Gal10 double-promoter fragment.

TABLE 6 enzyme digestion system

Component (A)	Volume of
		NotI/BamHI	1μL
pESC vector	1μg
		10×NEB Buffer	1μL
ddH ₂ O	Supplement to 10. Mu.L

The vector pESC was treated with BamHI, an endonuclease available from NEB, in accordance with the cleavage system shown in Table 6, and the prepared cleavage system was allowed to stand in a water bath at 37℃for 1 hour. And (3) purifying and recovering DNA of the Backbone after enzyme digestion by using a gel recovery kit purchased from the Siemens technology company, and purifying to obtain the Backbone2 fragment.

2) Amplification and recovery of target Gene

TABLE 7 PCR reaction system (2 x Phanta Flash Master Mix)

Component (A)	Volume of
		Genomic DNA template/plasmid template	1μL
Forward primer	2μL
		Reverse primer	2μL
2x Phanta Flash Master Mix	25μL
		ddH ₂ O	Supplement to 50. Mu.L

TABLE 8 PCR reaction program (2 x Phanta Flash Master Mix)

Gene cloning was performed using 2x Phanta Flash Master Mix available from Nanjinozan Biotechnology Co., ltd as an amplification enzyme, and the genes At4CL1, pcSTS and Gal1-Gal10 promoters using primer 1-F, primer 1-R, primer 2-F, primer 2-R and primer 3-F, and primer 3-R, respectively, and the PCR reaction system and reaction procedure were as shown in tables 7 and 8. The amplified genes At4CL1, pcSTS and Gal1-Gal10 were subjected to DNA purification and recovery using a gel recovery kit purchased from the Semer Feiche technologies company.

3) In vitro multi-fragment ligation by SOE-PCR

TABLE 9 SOE-PCR reaction system (2 x Phanta Flash Master Mix)

Component (A)	Volume of
		At4CL1 gene fragment	1μL
Gal1-Gal10 gene fragment	1μL
		PcSTS gene fragment	1μL
Forward primer	2μL
		Reverse primer	2μL
2x Phanta Flash Master Mix	25μL
		ddH ₂ O	Supplement to 50. Mu.L

The purified At4CL1, pcSTS and Gal1-Gal10 promoter fragments were subjected to ligation amplification by using SOE-PCR. PCR was performed using the obtained At4CL1, pcSTS and Gal1-Gal10 promoter fragments as templates, using 2x Phanta Flash Master Mix purchased from Nanjinozan Biotechnology Co., ltd. As an amplification enzyme, and using primers 1-F and 2-R, respectively, with a PCR reaction system shown in Table 9 and a PCR reaction program shown in Table 8. The gene At4CL1-Gal1-Gal10-PcSTS obtained by ligation amplification was subjected to DNA purification and recovery using a gel recovery kit purchased from the company Simer Feishi technologies.

4) Gibson connection

The At4CL1-Gal1-Gal10-PcSTS fragment and the Backbone1 fragment are connected by a Gibson connection method to construct a recombinant plasmid pESC-At4CL1-PcSTS; used in the process ofHiFi DNA Assembly Master Mix is from NEB company, the ligation reaction is shown in Table 10, wherein the ratio of vector to inserted gene is 1:2. the prepared connection system is put into a water bath kettle with the temperature of 50 ℃, and after 60 minutes, the connection product is taken out to be transformed into escherichia coli DH5 alpha.

Table 10 Gibson connection System

/>

5) Chemical transformation of E.coli

E.coli competent cells DH5 alpha are taken out from an ultra-low temperature refrigerator and placed on ice for standing and melting. mu.L of Gibson ligation was added to the thawed competent cells, flicked, mixed well and ice-bathed for 30 minutes. And (5) carrying out heat shock for 90s in a water bath kettle at 42 ℃, and taking out the water bath kettle and carrying out ice bath for 2min. 200. Mu.L of LB liquid medium was added thereto, and the mixture was cultured at 37℃and 220rpm for 60 minutes. A proper amount of bacterial liquid is taken out in an ultra clean bench and is coated into LB solid medium containing ampicillin (100 mg/L), and the culture is carried out in an inverted overnight in a constant temperature incubator at 37 ℃.

6) Sequencing verification

After single bacterial colonies grow on the plate, screening and identifying the recombinant plasmids by using a colony PCR method. 2x Rapid Taq Master Mix from Nanjinozan Biotechnology Co., ltd was selected as the amplification enzyme, and the colony PCR reaction system was shown in Table 11, using primers 11-F and 11-R. After preparation, 10. Mu.L of sterile water of a single colony of Escherichia coli is picked up by a sterile gun head in an ultra clean bench, 1. Mu.L of sterile water is taken as a template after complete dissolution, and the template is added into a colony PCR reaction system to carry out gene amplification according to the reaction program of Table 12.

TABLE 11 PCR reaction system (2 x Rapid Taq Master Mix)

Component (A)	Volume of
		Template	1μL
Forward primer	0.5μL
		Reverse primer	0.5μL
2x Rapid Taq Master Mix	10μL
		ddH ₂ O	Supplement to 20. Mu.L

TABLE 12 PCR reaction program (2 x Rapid Taq Master Mix)

The PCR products were verified by agarose gel electrophoresis, single colonies containing the band of interest were selected, inoculated into LB medium containing ampicillin (100 mg/L), and cultured overnight at 37℃and 220 rpm. The corresponding plasmid was extracted using plasmid miniprep kit purchased from Tiangen Biochemical technologies (Beijing) limited and delivered to the Suzhou Jin Weizhi company for gene sequencing verification.

2. Construction of other recombinant plasmids:

the construction method of pESC-At4CL1-VvSTS recombinant pelletization is the same as the step 1) in the construction of the above pESC-At4CL1-PcSTS recombinant plasmid, and the gene VvSTS is cloned by using primers 4-F and 4-R, and the PCR reaction system and the reaction program are shown in tables 7 and 8.

The construction method of recombinant pelletization of pESC-At4CL1-MaSTS3 and pESC-At4CL1-FmSTS was the same as that of step 1) in the construction of the above-described pESC-At4CL1-PcSTS recombinant plasmid, and gene cloning was performed on the genes MaSTS3 and FmSTS using primers 5-F and 5-R,6-F and 6-R, respectively, and the PCR reaction system and reaction procedure were as shown in tables 7 and 8.

The construction method of pESC-Ma4CL-PcSTS and pESC-Ha4CL2-PcSTS recombinant pelletization was the same as that of step 1) in the construction of the above-described pESC-At4CL1-PcSTS recombinant plasmid, and cloning of the genes Ma4CL and Ha4CL2 was performed using primers 7-F and 7-R,8-F and 8-R, respectively, and the PCR reaction system and reaction procedure were as shown in tables 7 and 8.

The method for constructing the recombinant plasmid pESC-At4CL1'-PcSTS' is the same as the step 1) in constructing the recombinant plasmid pESC-At4CL 1-PcSTS. And the non-codon optimized genes At4CL1 'and PcSTS' were cloned using primers 9-F and 9-R, 10-F and 10-R, respectively, using the PCR procedure and reaction procedure shown in tables 7-8.

3. Construction of resveratrol fermentation strains:

the linearized gene fragments for yeast genome integration in the resveratrol pathway (reaction system and procedure are shown in tables 7 and 8) were amplified by PCR method using the integration plasmid in table 4 as template, and primers are shown in table 13. The desired gene fragment containing the homology arm of the integration site was obtained by agarose gel electrophoresis and gel recovery, followed by yeast transformation according to the method described in application example 1.

The homologous arms of 40bp on the whole locus on the genome are obtained on the target fragment by a PCR method, homologous recombination can be carried out with the chassis host genome, and an expression cassette containing the target gene is integrated at the target locus of the yeast chassis genome, wherein:

FjTAL is integrated into the GAL80 position of Saccharomyces cerevisiae and is marked as CEN.PK2-delta GAL80, wherein FjTAL is named as RES1;

HaTAL is integrated into the GAL80 position of Saccharomyces cerevisiae and is marked as CEN.PK2-delta GAL80, wherein HaTAL and yeast are named as RES2;

Integrating the At4CL1 and the VvSTS into LOXP sites on the basis of the chassis bacteria RES1, and marking the sites as RES3-LOXP, wherein the At4CL1-VvSTS and the yeast are named as RES3;

integrating At4CL1 and PcSTS to LOXP sites on the basis of chassis bacteria RES1, and marking the sites as RES4-LOXP, wherein At4CL1-PcSTS and yeast are named as RES4;

integrating genes FjTAL ', at4CL1' and VvSTS ' which are not subjected to codon optimization into Saccharomyces cerevisiae GAL80 and LOXP sites respectively, and marking as RES4' -delta GAL80: fjTAL '; loxp: at4CL1' -VvSTS ', yeast designated RES4';

on the basis of chassis bacteria RES1, integrating At4CL1 and MaSTS3 into LOXP locus, and marking as RES5-LOXP, wherein At4CL1-MaSTS3 and yeast are named as RES5;

integrating At4CL1 and FmSTS to LOXP sites on the basis of chassis bacteria RES1, and marking as RES6-LOXP, wherein At4CL1-FmSTS and yeast are named as RES6;

based on chassis bacteria RES1, integrating Ha4CL2 and PcSTS into LOXP locus, and marking as RES7-LOXP, wherein Ha4CL2-PcSTS and yeast are named as RES7;

integrating Ma4CL and PcSTS to LOXP sites on the basis of chassis bacteria RES1, and marking as RES8-LOXP, wherein Ma4CL-PcSTS and yeast are named as RES8;

integrating AtAAE13 to HIS3 sites on the basis of chassis bacteria RES4, wherein the sites are expressed as RES 9-delta HIS3, and the yeast is expressed as RES9;

integrating an AtAAE13 'gene which is not subjected to codon optimization to an HIS3 locus on the basis of chassis bacteria RES4', wherein the gene is expressed as RES9 '-delta HIS3, and the yeast is named as RES9';

CsAAE was integrated into the HIS3 site on the basis of the Chassis strain RES4, and the site was designated as RES 10-. DELTA.HIS3:CsAAE, and the yeast was designated as RES10.

The gene CsAAE 'which is not subjected to codon optimization is integrated to the HIS3 locus on the basis of the Chassis bacteria RES4', and is marked as RES10 '-delta HIS3, wherein the yeast is named as RES10'.

TABLE 13 primers for genomic integration of genes of interest

Primer name	Primer sequences (5 'to 3')
		GAL80--F	ttgtacaactgtgctaaacagacttaaattagttgttaattaaatgatcc
GAL80--R	ctattggagtgatcaaaaaaaacttcaatatgaacaccattaacgaata
		LOXP--F	acactcgcgagaaccaaaacaaggatccccgagcgacctcatgctatacctgag
LOXP--R	aagcgatccgtagtcctatccgggtaacactcttccagcgtcccaaaaccttc
		HIS3--F	tcgtgttcatgcagatagataacaatctatatgttgataa gagcgacctcatgctatac
HIS3--R	cataaaagaccgtgtgatggcttggcatggcgatttcatt cttcgagcgtcccaaaacc

(2) Chemical conversion of Yeast

1) Preparation of Saccharomyces cerevisiae competent cells

A single colony of Saccharomyces cerevisiae on YPD solid medium was picked up, inoculated into YPD liquid medium and cultured overnight at 30℃and 220 rpm. The seed solution of Saccharomyces cerevisiae overnight culture was inoculated into fresh YPD medium at an inoculum size of 1%, and cultured at 30℃and 220rpm until OD600 was about 0.6. Subpackaging the bacterial liquid into 50mL sterile centrifuge tubes prepared in advance in a super clean bench, centrifuging at 6000rpm for 2min, discarding the supernatant in the super clean bench, washing the bacterial cells twice with equal volume sterile distilled water, re-suspending the bacterial cells with a proper volume of 0.1M LiAC solution after the second centrifugation is finished, standing for 1-2 min, centrifuging at 6000rpm for 2min, and discarding the supernatant.

2) LiAC conversion of Saccharomyces cerevisiae

The recombinant plasmid 1 and the fusion plasmid 2-5 are respectively transformed into saccharomyces cerevisiae competent cells by using a LiAC method, and the specific experimental steps are as follows:

a. Adding 240 mu L of 50% PEG3350 solution into the Saccharomyces cerevisiae competent cells prepared in the first step, and re-suspending the thalli by using a sterile gun head;

b. 36. Mu.L of 1M LiAC, 1. Mu.g of recombinant plasmid, 10. Mu.L of 10mg/mL salmon sperm DNA were added sequentially to the tube, and finally water was added to fill up to 360. Mu.L, and the mixture was gently blown and mixed with a sterile gun head. It should be noted that salmon sperm DNA should be heated in a metal bath at 100deg.C for 5 minutes in advance, and stored on ice immediately after heating;

c. placing the mixture in a water bath kettle at 42 ℃ for incubation for 1 hour;

d. after the incubation was completed, the supernatant was discarded after centrifugation at 6000rpm for 2 minutes, the cells were resuspended in sterile distilled water, plated on solid plates of SD-LEU, and incubated at 30℃for 2-3 days until single colonies were grown on the plates.

(3) PCR verification of Yeast transformants

Single colonies grown on solid plates were picked and inoculated into SC-LEU liquid medium and incubated overnight at 30℃and 220 rpm. A small amount of bacterial liquid was taken, and the genomic DNA was extracted using a genomic extraction kit, and the bacterial liquid was used as a template for colony PCR verification, and the primers in Table 14 were used for verification (the reaction system and the reaction program are shown in Table 7 and Table 8). And verifying the integration condition of the target gene by using a PCR method, and then performing sequencing verification on the PCR product to prove that the target gene is successfully integrated into the genome.

TABLE 14 primers for genome integration verification

Primer name	Primer sequences (5 'to 3')
		Con-GAL-F	aaagctacatataaggaacgtgct
Con-GAL-R	caggctgggaagcatatttgag
		Con-LOXP-F	ttcatttaccggcgcactctcgcc
Con-LOXP-R	taaataagaacacccgcatgcac
		Con-HIS3-F	agagcagaaagccctagtaaagc
Con-HIS3-R	aacatcgttggtaccattgggc

Example 3 method for producing resveratrol by engineering bacteria fermentation

13 s.cerevisiae engineering bacteria RES1 to RES10' prepared in the example 2 are subjected to shaking flask fermentation under the same culture conditions, and the specific fermentation method is as follows:

single colonies were first streaked on YPD plates, inoculated into 50mL of YPD medium, cultured at 30℃and 250rpm for 12-16 hours, and after transferring the strain RES1 to RES10' to a fresh liquid medium containing 20mL of YPD (2% glucose concentration) at an initial OD600 of about 0.2, and further culturing was continued for 24 hours, galactose was added to a final concentration of 2%. The fermentation culture was continued at 30℃and 250rpm for 48 hours.

After the fermentation is finished, resveratrol in the fermentation liquid is extracted, and the specific method is as follows:

adding 1mL of fermentation liquor into an equal volume of methanol, vibrating for 5 minutes on a vortex oscillator, centrifuging for 10 minutes at 12000rpm after the vibration is finished, sucking the supernatant by a 1mL syringe, filtering by a 0.22 mu m filter membrane, sucking 200 mu L of filtered sample, adding into a liquid phase small bottle, screwing a cover, preserving at a low temperature, and detecting by using liquid chromatography.

The content of resveratrol in the fermentation product is detected by liquid chromatography, and resveratrol standard substance solutions with different concentrations are prepared for making a standard curve of resveratrol. This standard curve is used to quantify the desired product in the fermentation broth. Detection was performed using Shimadzu high performance liquid chromatography (LC 20-ADXR) equipped with a C18 reverse phase column (Welch Ultimate AQ-C18, 4.6X105 mm,5 μm). The detection wavelength of resveratrol is 330nm. The mobile phase consisted of water (A: 0.1% formic acid) and acetonitrile (B) at a flow rate of 0.8mL/min and the elution procedure is shown in Table 15.

TABLE 15 gradient elution procedure

Time	Solvent A	Solvent B
			0min	73％	27％
10min	73％	27％
			20min	65％	35％
22min	5％	95％
			25min	73％	27％
30min	73％	27％

And detecting resveratrol which is a fermentation product by using liquid chromatography after the fermentation of the five recombinant strains is finished. The results after quantification with resveratrol markers (as shown in fig. 2) are shown in table 16.

TABLE 16 fermentation results of recombinant strains RES1-RES10

From the data in Table 16, it can be seen that:

after the fermentation of the recombinant strain RES1 is finished, 1.3mg/L p-coumaric acid is detected in cells, and resveratrol is not detected;

after the fermentation of the recombinant strain RES2 is finished, 0.1mg/L p-coumaric acid is detected in cells, and resveratrol is not detected temporarily;

after the fermentation of the recombinant strain RES3 is finished, the content of resveratrol detected in cells is 11.0mg/L, and the content of p-coumaric acid is 1.1mg/L;

After the fermentation of the recombinant strain RES4 is finished, 72.0mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES4', only 9.0mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES5 is finished, 8.1mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES6 is finished, 5.0mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES7 is finished, 26.0mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES8 is finished, 38.0mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES9 is finished, 114.2mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

after the fermentation of the recombinant strain RES9', 12.1mg/L resveratrol is detected in cells, and p-coumaric acid is not detected;

the content of resveratrol in the recombinant strain RES10 is 83.0mg/L, and p-coumaric acid is not detected;

the content of resveratrol in the recombinant strain RES10' was 10.7mg/L, and p-coumaric acid was not detected.

From the above, it is known that a small amount of resveratrol is produced in the cells of the chassis after the combination of At4CL and VvSTS, and a larger amount of p-coumaric acid is converted into resveratrol by using the strain RES4 of At4CL and PcSTS, thereby promoting the metabolic flow to the target product. After the AtAAE13 gene is introduced, the yield of the target product in RES10 is improved by about 2 times, which shows that the introduction of the AtAAE13 increases the synthesis of the precursor malonyl-CoA, thereby promoting the synthesis of the target product. As can be seen from the fermentation results of the recombinant strains RES4', RES9' and RES10', the same genes show higher activity and resveratrol production capacity in the chassis after codon optimization.

The foregoing is merely exemplary of the present application and is not intended to limit the present application. Various modifications and variations of the present application will be apparent to those skilled in the art. Any modification, equivalent replacement, improvement, etc. which come within the spirit and principles of the application are to be included in the scope of the claims of the present application.

Claims

1. A complex enzyme for the production of resveratrol comprising tyrosine ammonia lyase FjTAL derived from flavobacterium johnsonii (Flavobacterium johnsoniae), 4-coumaroyl-coa ligase At4CL derived from arabidopsis thaliana (Arabidopsis thaliana), resveratrol synthase PcSTS derived from polygonum cuspidatum (Polygonum cuspidatum) and/or malonyl-coa synthase AtAAE13 derived from arabidopsis thaliana (Arabidopsis thaliana).

2. The complex enzyme according to claim 1, wherein the amino acid sequence of the tyrosine ammonia lyase FjTAL derived from flavobacterium johnsonii (Flavobacterium johnsoniae) is as shown in SEQ ID No.2 or has at least 90% sequence identity with SEQ ID No. 2;

3. An engineered strain for producing resveratrol, wherein an enzyme expressed by the engineered strain comprises:

4. The engineered strain of claim 3, wherein the enzyme expressed by the engineered strain further comprises,

or (b)

5. The engineered strain of claim 4,

the tyrosine ammonia lyase FjTAL derived from Flavobacterium johnsonii (Flavobacterium johnsoniae) has a nucleotide sequence shown in SEQ ID NO.1 or has at least 90% sequence identity with SEQ ID NO. 1;

6. The engineered strain of any one of claims 3-5, wherein the chassis cells of the engineered strain are selected from one or more of yeast, escherichia coli, bacillus subtilis, corynebacterium glutamicum;

preferably, the chassis cell is a yeast;

more preferably, the yeast is pichia pastoris or saccharomyces cerevisiae;

more preferably, the yeast is Saccharomyces cerevisiae.

7. A biomaterial characterized in that the biomaterial is any one of the following A1) to A5):

a2 A transformant containing the nucleic acid molecule of A1);

a3 An expression vector comprising A1) the nucleic acid molecule;

a6 A whole cell catalyst comprising A4) the recombinant microorganism or A5) the recombinant cell;

preferably, the nucleotide sequence of the nucleic acid molecule is any one of SEQ ID NO.1, SEQ ID NO.5, SEQ ID NO.13, SEQ ID NO.19, SEQ ID NO.21, or has at least 90% sequence identity with any one of SEQ ID NO.1, SEQ ID NO.5, SEQ ID NO.13, SEQ ID NO.19, SEQ ID NO. 21.

8. Use of a complex enzyme according to any one of claims 1-2, or an engineered strain according to any one of claims 3-6, or a biomaterial according to claim 7, for the preparation of resveratrol, or a pharmaceutical, food or cosmetic product containing resveratrol.

9. A method for producing resveratrol, characterized by comprising the step of obtaining resveratrol by using the complex enzyme according to any of claims 1-2, the engineered strain according to any of claims 3-6, or the biomaterial according to claim 7.

10. The application of malonyl-CoA synthase AtAAE13 from Arabidopsis thaliana (Arabidopsis thaliana) or malonyl-CoA synthase CsAAE from flax (Camellia sativa) in the preparation of resveratrol,

Preferably, the method comprises the steps of,

the amino acid sequence of the malonyl-CoA synthase AtAAE13 from arabidopsis thaliana (Arabidopsis thaliana) is shown as SEQ ID NO.20 or has at least 90% sequence identity with SEQ ID NO. 20;