CN116716350A

CN116716350A - SINV vector for expressing IL-12 and application thereof in preparation of antitumor drugs

Info

Publication number: CN116716350A
Application number: CN202310060473.XA
Authority: CN
Inventors: 贾凡; 孙康怡欣; 徐富强
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2023-01-18
Filing date: 2023-01-18
Publication date: 2023-09-08
Also published as: WO2024152862A1

Abstract

The invention discloses an SINV vector for expressing IL-12 and application thereof in preparing antitumor drugs, wherein the SINV vector takes pSINV as a framework vector, and the framework vector is connected with IL-12. The invention provides a Sindbis virus infectious vector for stably expressing an IL-12 gene, and Sindbis virus particles prepared by the Sindbis virus infectious vector can increase the number of T cells, CD8+ T cells and NK cells in solid tumor cells of a U87-MG cell immunodeficiency mouse model, can play an obvious role in killing tumors on the solid tumor of the U87-MG cell immunodeficiency mouse model, and has important practical significance and wide application value for application research and basic research such as oncolytic treatment of malignant glioma.

Description

SINV vector for expressing IL-12 and application thereof in preparation of antitumor drugs

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an SINV vector for expressing IL-12 and application thereof in preparation of antitumor drugs.

Background

Gliomas are called "brain killers" and represent nearly 80% of all malignant tumors of the central nervous system. Gliomas were classified into four classes according to the WHO classification of 2016: i to IV. In adults, the most common glioblastoma subtype is grade IV glioma, where Glioblastoma (GBM) is a common glioblastoma of the cranium, which is divided into two on a genetic molecular level diagnosis, an IDH wild-type and an IDH mutant, i.e., an isocitrate dehydrogenase mutation, which is one of the most important genetic changes found in such tumors. The survival rate of gliomas is not ideal in terms of overall survival rate. The overall 10 year survival rates for glioblastoma and glioblastoma in the united states are 44.6% and 2.9%, respectively.

Sindbis virus (SINV) is a member of the Alphavirus genus and an oncolytic virus with significant oncolytic activity. Sindbis virus vectors have several advantages that make them good candidates for cancer treatment. Sindbis virus has a positive single stranded RNA genome of about 12kb in length, encoding a total of 5 structural proteins (capsid, E3, E2, 6K and E1) and 4 non-structural proteins (NSP 1, NSP2, NSP3 and NSP 4). The vector is made safer than DNA-based oncolytic viruses because the vector cannot integrate its genome into the DNA of the host. In humans, sindbis infection is considered asymptomatic, and although not common, it can lead to mild fever, rashes, and joint pain, which resolve rapidly.

Interleukin-12 (IL-12) is a powerful primary regulator of anti-tumor immune response, as a heterodimeric cytokine, which produces a variety of anti-tumor effects, including stimulation of Natural Killer (NK) cell and T cell (CD4+ and CD8+) growth and cytotoxic activity, induction of CD4+ T cell differentiation toward the Th1 phenotype, increased IFN-gamma production by NK and T cells, and inhibition of tumor angiogenesis.

Oncolytic Virus (Oncolytic Virus) immunotherapy has been an emerging therapeutic approach to treat cancer in the last decades. Talimogene laherparepvec (T-Vec) was the first oncolytic virus approved by the U.S. Food and Drug Administration (FDA) in 2015. Oncolytic Viruses (OVs) are organisms capable of recognizing, infecting and lysing different cells in a tumor environment, with the aim of stabilizing and reducing tumor progression. They may exhibit natural chemotaxis to cancer cells or recognize specific targets through genetic targeting. Some OVs are being investigated as potential treatments for cancer in clinical trials.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a SINV infectious vector for stably expressing IL-12, a virus particle and application thereof, and the influence of the virus particle on tumor microenvironment and the effect in a malignant glioma U87-MG mouse subcutaneous tumor model are evaluated. The invention successfully prepares sindbis virus particles capable of stably expressing IL-12 by transfecting cells with sindbis virus infectious vectors, and is successfully applied to oncolytic treatment of a glioblastoma U87-MG mouse model.

The invention provides an SINV infectious vector for stably expressing IL-12, wherein the SINV infectious vector takes pSINV as a framework vector, and IL-12 is connected to the framework vector; the SINV infectious vector is connected with a UBC promoter, a 5'UTR, a nucleotide sequence of an NSP1 gene, a nucleotide sequence of an NSP2 gene, a nucleotide sequence of an NSP3 gene, a nucleotide sequence of an NSP4 gene, a 26s promoter, a nucleotide sequence of a CAP gene, a nucleotide sequence of an E3 gene, a nucleotide sequence of an E2 gene, a nucleotide sequence of a 6K gene, a nucleotide sequence of an E1 gene, a 26s promoter, a nucleotide sequence of an IL-12 gene and a 3' UTR.

Further, the nucleotide sequence of the SINV infectious vector is shown as SEQ ID NO. 7.

The total length of the sequence SEQ ID NO.7 is 16707bp, and the base at 15941-16707 positions thereof is as follows:

gtggccgccgggccgctcggtgggacggaagcgtgtggagagaccgccaagggctgtagtctgggtccgcgagcaaggttgccctgaactgggggttggggggagcgcagcaaaatggcggctgttcccgagtcttgaatggaagacgcttgtgaggcgggctgtgaggtcgttgaaacaaggtggggggcatggtgggcggcaagaacccaaggtcttgaggccttcgctaatgcgggaaagctcttattcgggtgagatgggctggggcaccatctggggaccctgacgtgaagtttgtcactgactggagaactcggtttgtcgtctgttgcgggggcggcagttatggcggtgccgttgggcagtgcacccgtacctttgggagcgcgcgccctcgtcgtgtcgtgacgtcacccgttctgttggcttataatgcagggtggggccacctgccggtaggtgtgcggtaggcttttctccgtcgcaggacgcagggttcgggcctagggtaggctctcctgaatcgacaggcgccggacctctggtgaggggagggataagtgaggcgtcagtttctttggtcggttttatgtacctatcttcttaagtagctgaagctccggttttgaactatgcgctcggggttggcgagtgtgttttgtgaagttttttaggcaccttttgaaatgtaatcatttgggtcaatatgtaattttcagtgttagactagtaaattgtccgctaaattctggccgtttttggcttttttgttagacttaattaa。

the invention also provides a preparation method of the sindbis virus particle carrying IL-12, and cells are transfected by using the SINV infectious vector.

Further, the cell is a BHK cell.

The invention also provides a sindbis virus particle carrying IL-12, which is prepared by transfecting cells with the SINV infectious vector.

The invention also provides application of the Sindbis virus particle carrying IL-12 in preparing a medicine for improving tumor microenvironment.

The invention also provides application of the Sindbis virus particle carrying IL-12 in preparing medicines for treating glioblastoma.

Compared with the prior art, the invention achieves the following technical effects:

(1) The invention provides a sindbis virus infectious vector for stably expressing IL-12 genes, which is capable of directly transfecting cells by the sindbis virus infectious vector without the steps of in vitro transcription and RNA transfection, thereby saving time and operation steps. The SINV infectious vector can stably express the inserted exogenous gene, and is beneficial to developing the research related to the sindbis virus infectious vector serving as a novel oncolytic virus.

(2) The invention has important value for researching the application prospect of sindbis virus as a novel oncolytic virus, and has important practical significance and wide application value for application research such as oncolytic treatment of malignant glioma and basic research (such as killing mechanism of virus in tumor cells, change of immune cells in tumor and the like).

(3) The Sindbis virus particle prepared by the invention can increase the number of T cells, CD8+ T cells and NK cells in solid tumor cells of a U87-MG cell immunodeficiency mouse model within 5 days.

(4) The Sindbis virus particle prepared by the invention can play an obvious role in killing tumors on solid tumors of a U87-MG cell immunodeficiency mouse model within 7 days.

(5) Oncolytic virus therapy utilizes genetic engineering means to modify oncolytic viruses so as to ensure that the oncolytic viruses retain the replication capacity of the viruses, and the oncolytic viruses are delivered to tumor cells in a targeted manner to kill the tumor cells, thereby achieving the aim of treatment. The SINV virus particles of the invention can replicate in malignant glioma U87-MG cells, selectively infect tumor cells, and realize the killing effect on tumors in an immunodeficiency mouse model.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram (A) of the construction of the Sindbis virus infectious vector expressing IL-12 and a schematic diagram (B) of the structure of pSINV IL-12 in example 1 of the present invention, wherein NSP 1-4, CAP, E3, E2, 6K and E1 are Sindbis virus proteins.

FIG. 2 shows a one-step growth curve (A) of the Sindbis virus infectious vector carrying IL-12 gene of example 2 of the present invention after infection of BHK cells with 0.01MOI, and the expression of IL-12 protein at cellular level at various time points after infection of BHK cells with virus with 0.01MOI (B).

FIG. 3 shows the effect of Sindbis virus particles carrying IL-12 gene of example 3 on cell viability after infection of BHK cells (A) and U87-MG cells (B) with different MOI.

FIG. 4 shows the oncolytic treatment of solid tumors of the immunodeficiency mouse model of example 4 carrying IL-12 gene of the present invention, using Sindbis virus particles subcutaneously planted in U87-MG cells; wherein A is an immunodeficiency mouse model subcutaneously planted by U87-MG cells and the administration flow, and B is the tumor volume change condition of the mice in the experimental group and the control group within 14 days after the beginning of the administration.

FIG. 5 shows the numbers of intratumoral T cells (A), CD8+ T cells (B) and NK cells (C) in experimental group (SINV IL-12) and control group (PBS) after 4 days of application of the Sindbis virus particle carrying IL-12 gene of example 5 to solid tumors of immunodeficiency mouse model subcutaneously planted with U87-MG cells.

Detailed Description

In order that those skilled in the art will better understand the present invention, a technical solution in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in which it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, shall fall within the scope of the invention.

The technical scheme of the invention is conventional in the art unless specifically stated otherwise.

The cells used in the examples were purchased from American Type Culture Collection (ATCC) and the mice used were purchased from Hunan Stokes Lemonda laboratory animals Co., ltd.

Example 1

The SINV infectious vector for stably expressing IL-12 is prepared by the following steps:

pSINV IL-12 initiates transcription and translation of viral structural and non-structural proteins by the UBC promoter. The primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 are used for respectively amplifying the fragments shown in IL-12 gene and SEQ ID NO.5, and then fused into the fragment shown in SEQ ID NO. 6;

the PCR reaction system was 50. Mu.l: 5 x Reaction Buffer:10 μl,10mM dNTPs:1 μl,10 μM Forward Primer:2.5 μl,10 μM Reverse Primer:2.5 μl, template DNA:0.5 μl, DNA Polymerase:0.5 μl, nuclear-Free Water:33 μl; the amplification conditions were: 98 ℃ 60s,98 ℃ 10s,55 ℃ 15s,72 ℃ 90s,72 ℃ 10min,16 ℃ 10min,30 cycles;

the fragment shown in SEQ ID No.6 was inserted into pSINV-EGFP using ApaI and NotI digestion of pSINV-EGFP (plasmid pSINV-EGFP has been disclosed in the Chinese patent application "CN202111117573.9 Sindbis virus vector and its viral particles and application in nerve loops"), then the recombinant product was transformed into competent HB101 using Vazyme homologous recombination kit, the clone identified as positive by PCR was cultured and plasmid was extracted for sequencing, the correctly sequenced clone was named pSINV IL-12, the nucleotide sequence of which is shown in SEQ ID No. 7.

Example 2

The one-step growth curve of the SINV infectious vector for stably expressing IL-12 after the SINV infectious vector is used for infecting cells, and the expression condition of IL-12 protein at the cellular level after the Sindbis virus is used for infecting cells:

after the pSINV IL-12 plasmid prepared in example 1 was extracted using a plasmid extraction kit, 2. Mu.g of the pSINV IL-12 plasmid was transfected into BHK cells using 4. Mu.l of lipofectamine 2000 (Thermo Fisher), 37℃and 5% (v/v) CO ₂ The resulting virus was cultured in an incubator to infect BHK cells at a dose of 0.01MOI, and the cell status was observed by an inverted fluorescence microscope at various time points, and the cells appeared to have significant cytopathic effects after 48 hours. After a part of the virus supernatant collected at different time points is split-charged, a part of the virus supernatant collected at different time points is detected by a double-layer plaque method, and a one-step growth curve of infectious clone is drawn, wherein the one-step growth curve of infectious clone is shown as A in figure 2. And subpackaging the virus supernatant collected at the time point of 48 hours of infection, and preserving at-80 ℃ for later use in subsequent experiments. Through the infection of this example, SINV IL-12 infectious vector-produced SINV IL-12 gene-carrying sindbis virus particles were obtained. By one-step growthThe long curve can obtain the incubation period and the cracking amount of the Sindbis virus carrying the IL-12 gene and the titer of the virus at different time points so as to further know the growth characteristics of the modified virus.

Cell samples were collected 24 hours, 48 hours and 72 hours after infection of BHK with Sindbis virus particles carrying the IL-12 gene at 0.01MOI, and were treated with YEASEN's 1xSDS-PAGE buffer. The samples were then denatured by heating them in a metal bath at 95℃for 5 minutes, after which the samples were separated in a 10% SDS-PAGE gel, after which the proteins were transferred to PVDF membrane, blocked with 5% skimmed milk for 1 hour at room temperature and incubated overnight with Abcam's Anti-IL-12 Anti-antibody (cat# ab 9992) in a 4℃refrigerator. The next day the PVDF membrane was washed with 1XTBST buffer, incubated with Proteintech HRP-conjugated Affinipure Goat Anti-Rabbit IgG secondary antibody for 2 hours at room temperature, and after washing the PVDF membrane again with 1XTBST buffer, imaging of protein bands was performed, the results are shown in FIG. 2B. The appearance of protein bands suggests that sindbis virus vectors carrying the IL-12 gene are capable of successfully expressing IL-12 protein in cells.

Example 3

Infection of BHK and U87-MG cells with the IL-12 Gene-carrying Sindbis virus particles of the present invention, and Effect on BHK and U87-MG cell viability:

fresh BHK and U87-MG cells were infected with the virus supernatant stored for later use in example 2 at 1MOI, 0.1MOI and 0.01MOI, respectively, after 24 hours, the supernatant was discarded, and dead living cells were identified with the Calcein/PI cell viability assay kit of Beyotime, wherein the living cells were stained with Calcein and displayed green fluorescence, and the red fluorescent label was PI-stained dead cells. Viable cells were counted in each well and cell viability was calculated for different MOI infections, the results are shown in figure 3. The viability is an important indicator reflecting the state of the cells, and the results of the cell viability test further demonstrate that sindbis virus particles carrying the IL-12 gene are more sensitive to U87-MG cells and cause more cell killing.

Example 4

The Sindbis virus particle carrying the IL-12 gene is applied to the oncolytic treatment condition of the solid tumor of the immunodeficiency mouse model which is subcutaneously planted by U87-MG cells:

after resuspension of U87-MG cells with PBS, 100. Mu.l of the cells were taken containing 5X 10 ⁶ Cell suspensions of individual U87-MG cells were prepared by subcutaneous injection Nu at 10 weeks of age 3-4 Nu female nude mice. On day 7 after tumor implantation, 10 mice were randomly divided into two groups, one group as the experimental group, and 100 microliters of 1x 10-containing mice were injected on day 7, day 9, and day 11 after tumor implantation, respectively ⁶ SINV IL-12 virus supernatant from each viral particle (collected during the transfection experiment of example 2) was injected as a control with 100 microliters of PBS on days 7, 9 and 11, respectively, after tumor implantation, and the experimental procedure is shown as A in FIG. 4.

Tumor volume of model mice was calculated by measuring the length and width of tumor of mice daily before and after administration, tumor volume=1/2×length (mm) ×width (mm). The results of the change of the tumor volumes of the mice in the experimental group and the control group after the administration (the average tumor volume of 5 mice in each group) are shown as B in fig. 4, and the tumor-bearing volume of the mice in the control group is obviously larger than the tumor volume of the mice in the experimental group after 14 days of the administration, which shows that the Sindbis virus particles carrying the IL-12 gene have obvious effect of killing tumors when applied to the immunodeficiency mouse model solid tumors planted under the U87-MG cell.

Example 5

The Sindbis virus particle carrying the IL-12 gene is applied to the solid tumor of an immunodeficiency mouse model which is subcutaneously planted by U87-MG cells, and the number of T cells, CD8+ T cells and NK cells in the tumor is as follows:

after resuspension of U87-MG cells with PBS, 100. Mu.l of the cells were taken containing 5X 10 ⁶ Cell suspensions of individual U87-MG cells were prepared by subcutaneous injection Nu at 6 weeks of age 3-4 Nu female nude mice. On day 7 after tumor implantation, 6 mice were randomly divided into two groups, one group was injected as an experimental group with 100 microliters of 1x10 ⁶ SINV IL-12 virus supernatant from each viral particle (collected during the transfection experiment of example 2) was used as a control for injection of 100 microliters of PBS.

After 4 days of virus supernatant injection, tumor tissues of 6 mice in total of the control group and the experimental group were taken in 100 mm dishes, respectively. The tumor tissue of each mouse was treated with the following: tumor tissue was first minced with scissors after rinsing with 1x HBSS from Gibco and transferred to a 15 ml centrifuge tube, 5 ml of enzyme cocktail (1 g collagenase IV, 100 mg hyaluronidase and 20,000 units dnase in 100 ml HBSS solution, filtered through a 0.22um filter, sub-packaged and stored at-20 ℃) was added to the centrifuge tube and digested overnight at room temperature. Digestion was then stopped by adding Gibco RPMI 1640 medium containing serum and centrifuging for 5 min at 300g, then washing the pellet with PBS to remove the medium, re-suspending the pellet in 100. Mu.l PBS after two repeated washes with PBS to make a cell suspension, adding FITC-anti-mouse CD4, APC anti-mouse CD3, PE anti-mouse CD49b, APC/Cyanine7 anti-mouse CD8a antibodies purchased from Biolegend, incubating for 20 min on ice in the absence of light, and then analyzing with a flow cytometer, the results obtained were analyzed using Flowjo software, as shown in FIG. 5. As can be seen from FIG. 5, the number of T cells, CD8+ T cells and NK cells in mice treated with SINV IL-12 was much greater than that of the control group, demonstrating that Sindbis virus particles carrying IL-12 gene effectively changed the intratumoral microenvironment and improved infiltration of immune cells into solid tumors.

By combining the above examples, the invention provides a Sindbis virus infectious vector for stably expressing IL-12, and the infectious vector has obvious tumor killing effect when applied to glioma cells and malignant glioma subcutaneous models; the method has wide application value in the aspects of establishment of a drug screening platform, establishment of an animal model, analysis of action mechanisms of drug killing glioma cells, analysis of mechanisms of viruses for stimulating immune responses in solid tumors, and the like.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims

1. An SINV infectious vector for stably expressing IL-12, which is characterized in that the SINV infectious vector takes pSINV as a framework vector, and IL-12 is connected to the framework vector;

the SINV infectious vector is connected with a UBC promoter, a 5'UTR, a nucleotide sequence of an NSP1 gene, a nucleotide sequence of an NSP2 gene, a nucleotide sequence of an NSP3 gene, a nucleotide sequence of an NSP4 gene, a 26s promoter, a nucleotide sequence of a CAP gene, a nucleotide sequence of an E3 gene, a nucleotide sequence of an E2 gene, a nucleotide sequence of a 6K gene, a nucleotide sequence of an E1 gene, a 26s promoter, a nucleotide sequence of an IL-12 gene and a 3' UTR.

2. The SINV infectious vector for stably expressing IL-12 of claim 1 wherein the nucleotide sequence of the SINV infectious vector is set forth in SEQ ID No. 7.

3. A method for preparing SINV-carrying virus particles of IL-12, characterized in that cells are transfected with the SINV-infectious vector of claim 1.

4. The method for producing sindbis virus particles carrying IL-12 according to claim 3, wherein the cells are BHK cells.

5. An IL-12-bearing sindbis virus particle prepared by the method of claim 3.

6. Use of the sindbis virus particle carrying IL-12 of claim 5 in the preparation of a medicament for ameliorating a tumor microenvironment.

7. Use of the sindbis virus particle carrying IL-12 of claim 5 in the manufacture of a medicament for the treatment of glioblastoma.