RU2580220C2 - RECOMBINANT PLASMID pCpG-CytDA/upp FOR EXPRESSION OF FUSION PROTEIN CYTOSINE DEAMINASE-URASILPHOSPHORIBOSYL TRANSFERASE, RECOMBINANT PLASMID pCpG-CytDA/upp/VP22 FOR EXPRESSION OF FUSION PROTEIN CYTOSINE DEAMINASE-URASILPHOSPHORIBOSYL TRANSFERASE-VP22, THERAPEUTIC COMPOSITION FOR THERAPY OF CANCEROUS DISEASES AND METHOD FOR USE THEREOF - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: disclosed is recombinant plasmid pCpG-CytDA/upp with nucleotide sequence SEQ ID NO: 1, providing expression of hybrid protein citozindezaminaze E.coli-uracilphosforybozyl transferase. Disclosed is recombinant plasmid pCpG-CytDA/upp/VP22 with nucleotide sequence SEQ ID NO: 2, providing expression of hybrid protein citozindezaminaze e.coli-uracilphosforybozyl transferase-protein VP22 of individual. Also disclosed is composition containing mesenchymal stem/stromal cells, in which there is one of above plasmids.

EFFECT: group of inventions provides higher efficiency and safety of using mesenchymal stem/stromal cells expressing citozindezaminaze for therapy of tumours of various etiologies.

7 cl, 4 dwg, 2 tbl, 5 ex

Description

State of the art

Despite the constant progress in the development of new anti-cancer drugs and technologies for their use, there are a number of oncological diseases, the effectiveness of the treatment of which using existing methods remains extremely low, in particular, cancer of the lung, pancreas, esophagus, as well as glioma. For example, lung cancer is the leading cause of death among men and women due to cancer. Along with the improvement of classical approaches to anti-cancer therapy, there is an urgent need to search and test the effectiveness of fundamentally new methods of treating cancer. In experimental gene therapy of cancer, one of the most commonly used approaches is the so-called "suicidal gene therapy." It is based on the use of genes encoding enzymes that convert substrates that are relatively non-toxic to body cells into products that are highly toxic, including to cancer cells. These genes include thymidine kinase, cytosine deaminase, and several others. If therapeutic structures expressing these genes get into the cancer cells and the corresponding substrate is simultaneously introduced, the cells carrying these structures die. It is important that in this case also neighboring cells die (the so-called “neighborhood effect” (bystander effect)).

Several years ago, a new important property of the somatic stem cells of an adult organism (hereinafter referred to as SC) was discovered - selective tropism, i.e. directed migration, to malignant neoplasms and accumulation in them (Aboody KS, Brown A., Rainov NG et al. Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas. Proc. Natl. Acad. Sci. USA. 2000 23: 12846-12851; Nakamizo A, Marini F, Amano T, et al. Human bone marrow-derived mesenchymal stem cells in the treatment of gliomas. Cancer Res. 2005 65 (8): 3307-18; Nakamizo A, Marini F, Amano T, Khan et al. Human bone marrow-derived mesenchymal stem cells in the treatment of gliomas. Cancer Res. 2005 65 (8): 3307-18). This property opens up prospects for creating a new anti-cancer therapy strategy based on the use of SC as a means of delivering therapeutic molecules.

The literature describes the use of stem cells with introduced genetic constructs expressing cytosine deaminase in them for experimental treatment of tumors. Although much of this work has been done using neural stem cells (Aboody KS, Brown A., Rainov NG et al. Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas. Proc. Natl. Acad. Sci. USA . 2000 23: 12846-12851), from the point of view of use in practical medicine, mesenchymal stem / stromal cells (MSCs) are a much more promising tool, since they, unlike neural stem cells, are quite easily obtained from patients, for example, from bone marrow and adipose tissue, which makes possible the use of autotranspl tation. In addition, in culture, these cells multiply well, which allows them to be produced in large quantities sufficient for their use as a means of delivery of cytosine deaminase or other proteins with anticancer activity in the tumor. The International Society of Cell Therapy has recommended a number of features that define human MSCs (Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006 8: 315- 317.). Several works in the literature describe the use of MSCs expressing cytosine deaminase for experimental treatment of tumors (Cavarretta IT, Altanerova V, Matuskova M et al. Adipose tissue-derived mesenchymal stem cells expressing prodrug-converting enzyme inhibit human prostate tumor growth. Mol Ther. 2010 18 (1): 223-31). In these studies, integrating retroviral or lentiviral constructs were used to express cytosine deaminase. Serious drawbacks of these viral constructs, however, are, firstly, the technological complexity of obtaining infectious drugs, secondly, the risks of cell transformation associated with the integration of these constructs into the genome, and thirdly, the possibility of an immune response against viral components, seriously limiting the possibility of reuse of MSC preparations bearing such constructs for therapy. There are examples in the literature of the use of cytosine deaminase fused with the VP22 human herpes virus protein, for which a property has been described to promote the spread of proteins fused with it between cells for gene therapy of tumors (Lee KC, Hamstra DA, Bullarayasamudram S, et al. Gene Ther. 2006 13 (2): 127-37), however, not a single case of using MSCs expressing cytosine deaminase-VP22 fusion protein for therapy has been described.

The work (You MN, Kim WJ, Shim W, Lee SR, Lee G, Choi S, Kim DY, Kim YM, Kim H, Han SU. Cytosine deaminase-producing human mesenchymal stem cells mediate an antitumor effect in a mouse xenograft model. J Gastroenterol Hepatol. 2009 24 (8): 1393-400), in which a plasmid based on the vector pCDNA3.1 (-) (Invitrogen) was used to express E. coli cytosine deaminase. The introduction of the plasmid in this work was carried out using transfection with Lipofectamine 2000, which, as is known to specialists in this field, gives a very low transfection efficiency, not exceeding 5%. In addition, when plasmids based on the pCDNA3.1 (-) vector and the like are used, the expression of the desired genes in MSCs rapidly decreases over time. Also, in this work, MSCs containing a cytosine deaminase-expressing plasmid were introduced directly into the bloodstream. With this method of administering MSCs, the efficiency of achieving a tumor by them is small, since the overwhelming majority of them is retained in the lungs (Lee RH, Pulin AA, Seo MJ et al. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti- inflammatory protein TSG-6. Stem Cell. 2009 5: 54-63).

The technical problem solved by the authors of the present invention was to increase the efficiency and safety of the use of MSCs expressing cytosine deaminase for the treatment of tumors of various etiologies.

The technical result is achieved by using the plasmid pCpG-CyDA / upp for expression in the MSC of a hybrid protein of E. coli cytosine deaminase fused with uracil phosphoribosyl transferase (hereinafter referred to as cytosine deaminase fusion), the sequence of which is shown in the list of nucleotide sequences under the number SEQ ID NO 1, and the physical map is in FIG. 1. In another embodiment, the problem was solved using the plasmid pCpG-CyDA / upp / VP22 for expression in MSC of a fusion protein of fusion cytosine deaminase fused to protein VP22. The sequence of this plasmid is shown in the list of nucleotide sequences under the number SEQ ID NO 2, and the physical map is shown in FIG. 2. Also, the problem was solved by the use of electroporation for more efficient introduction of plasmids into MSCs. In addition, the problem was solved by the introduction of MSCs directly into the tumor (intratumoral administration). As a result, significant efficacy was achieved with the use of MSCs expressing fusion cytosine deaminase in experimental models of mouse B16 melanoma and mouse Lewis lung adenocarcinoma. Even higher efficiency was achieved for MSCs expressing fusion cytosine deaminase-VP22.

Despite the fact that the solution of the technical problem of the invention was demonstrated only by the examples of melanoma B16 and Lewis adenocarcinoma of mice, this solution is applicable to many other types of cancer of mice and humans. The basis for this is the universal mechanism of action of the fused cytosine deaminase, which converts the non-toxic substance 5-fluorocytosine introduced into the body into the highly toxic product 5-fluorouracil, which irreversibly inhibits thymidylate synthase, an enzyme necessary for DNA synthesis, which in turn causes the death of rapidly dividing cancer cells . 5-fluorouracil, in particular, is used in the chemotherapy of skin cancers, including melanoma, breast cancer, gastrointestinal cancers, including esophageal cancer, gastric cancer, pancreatic cancer and colon and rectal cancer. In addition, 5-fluorouracil is used for chemotherapy of such oncological diseases as primary liver cancer, lung cancer, cancer of the bladder, prostate, ovary, cervix, endometrial carcinoma and malignant tumors of the head and neck, as well as some other, less common types oncological diseases. The use of 5-fluorouracil for glioblastoma therapy is hampered by the presence of a blood-brain barrier, but the literature describes the efficacy of the use of cells expressing cytosine deaminase for the treatment of glioblastoma with intracranial administration (Aboody KS, Najbauer J, Metz MZ et al. Neural stem cell-mediated enzyme / prodrug therapy for glioma: preclinical studies. Sci Transl Med. 2013 5: 184ra59), including in the case of prolonged intracranial administration of 5-fluorocytosine) (Altaner C, Altanerova V, Cihova M et al. Complete regression of glioblastoma by mesenchymal stem cells mediated prodrug gene therapy simulating clinical therapeutic scenario. Int J Cancer. 2014 134: 1458-6 5). Thus, the possibility of applying the proposed solution to the technical problem of the invention for numerous other types of human oncological diseases is obvious to a specialist.

Numerous examples are known from the literature of alternative routes of introducing MSCs, including genetically modified MSCs, into the body, including intravenous, intraperitoneal, and subcutaneous (e.g., Antitumor effects of TRAIL-expressing mesenchymal stromal cells in a mouse xenograft model of human mesothelioma. Lathrop MJ, Sage EK, Macura SL et al. Cancer Gene Ther. 2015 22: 44-54; Zou Z, Cai Y, Chen Y et al. Bone marrow-derived mesenchymal stem cells attenuate acute liver injury and regulate the expression of fibrinogen -like-protein 1 and signal transducer and activator of transcription 3. Mol Med Rep. 2015 12: 2089-97; Bahrambeigi V, Ahmadi N, Salehi R, Javanmard SH. Genetically modified murine adipose-derived mesenchymal stem cells producing interleukin-2 favor B16F10 melanoma cell proliferation. Immunol Invest. 2015 44: 216-36).

Thus, the possibility of using a combination of intratumoral administration and the above alternative methods of introducing MSCs into the body is obvious to a specialist. This combination can further increase the efficiency of using MSCs expressing fusion cytosine deaminase for the treatment of tumors.

The effectiveness of the proposed technical solution depends on how much MSC contains the introduced plasmid for expression of the fused cytosine deaminase, and can be increased by increasing this fraction. One way to achieve this is to select cells that contain the introduced plasmid. There are numerous examples in the literature of the use of the so-called co-transfection of cells with two plasmids, one of which expresses a selection marker (for example, Kurtz DT. Hormonal inducibility of rat alpha 2u globulin genes in transfected mouse cells. Nature. 1981 291: 629-31). This approach is based on the well-known fact that the probability of simultaneous productive (i.e., transgene expression) entry of two plasmids into one cell is large and significantly higher than the theoretical probability in the case of random distribution of plasmids after transfection. Co-transfection of packaging cells with two or more plasmids is used continuously to obtain infectious viral particles for further transduction of target cells by them. In addition, the method of co-transfection of cells with two plasmids, one of which expresses a surface protein used for magnetic selection of transfected cells using antibodies conjugated with magnetic particles, is used in the commercial MacSelect kit from Miltenyi Biotec (Germany). Clontech (USA) also produces plasmids for co-transfection and cell selection. Thus, it is obvious to a person skilled in the art that a simultaneous introduction into MSCs together with plasmid pCpG-CytDA / upp or plasmid pCpG-CytDA / upp / VP22 of another plasmid that allows selection of transfected cells.

The application of the invention is illustrated in the following examples.

Example 1. The creation of the plasmid pCpG-CytDA / upp expressing fused cytosine deaminase.

A fragment was cut from the plasmid pCpG-mSEAP (InvivoGen) using restriction endonucleases Xba I and Nhe I and replaced by a double-stranded fragment obtained by annealing the Ad # pCpG-S1 oligonucleotides (CTAGACAATTGTACTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG -S3 (GACAGGTTGGTGTACAGGTACCATGGTACTTAG) and Ad # pCpG-A3 (CTAGCTAAGTACCATGGTACCTGTACAC). The absence of errors in the embedded fragment was verified by sequencing. A fragment encoding a cytosine deaminase fusion cut from plasmid pORF-codA / upp (InvivoGen) using restriction endonucleases Nco I and Nhe I was inserted into the plasmid thus obtained at the Nco I and Nhe I sites. The nucleotide sequence of the pCpG-CytDA / upp plasmid is not listed nucleotide sequences under the number SEQ ID NO 1.

A physical map of this plasmid is shown in FIG. one.

Example 2. The creation of the plasmid pCpG-CytDA / upp / VP22 expressing fused cytosine deaminase-VP22.

To create an intermediate construct containing a coding sequence for the cytosine deaminase without the stop codon, the 3 ′ end portion of the open frame of the fusion cytosine deaminase was amplified from the plasmid pORF-codA / upp (InvivoGen) using CytDA / upp-S1 oligonucleotides (GGAGCCTGTAC) and upp-A1 (ACATAGCTAGCGGATCCTTTCGTACCAAAGATTTTGTC). This fragment was further inserted into the pCpG-CytDA / upp plasmid at the Age I and Nhe I sites with the replacement of the original 3′-terminal region. The absence of errors in the embedded fragment was verified by sequencing.

To create an intermediate construct containing the VP22 protein coding sequence, its open frame was amplified from the pVP22 / myc-His plasmid (Invitrogen) using the VP22-S2 oligonucleotides (ACATAAGATCTGGATCCATGACCTCTCGCCGCTCC) and VP22-A2 (ACATAGCTAGCTCACTCGGG and pGPGGGGGGGGGGGGGGGGGGGGG modification of plasmid pSP73 (Promega), at the sites of Bg1 II and Nhe I. The absence of errors in the inserted fragment was verified by sequencing. To create the target plasmid pCpG-CytDA / upp / VP22, the VP22 coding fragment was excised from the intermediate plasmid using restriction endonucleases BamH I and Nhe I and inserted into an intermediate plasmid containing fused cytosine deaminase without stop codon at the same sites. The nucleotide sequence of the plasmid pCpG-CytDA / upp / VP22 is shown in the list of nucleotide sequences under the number SEQ ID NO 2.

A physical map of this plasmid is shown in FIG. 2.

Example 3. Obtaining and culturing MSCs from adipose tissue of mice.

MSCs were isolated from the subcutaneous adipose tissue of C56B16 mice under sterile conditions. To do this, the crushed adipose tissue was subjected to enzymatic treatment in a 0.2% type IV collagenase solution (Invitrogen) for 20-30 minutes at 37 ° C with shaking. The resulting suspension was filtered through a 100 μm nylon strainer, washed 2 times in PBS. Cells were pelleted by centrifugation at 1200 rpm for 20 minutes and the pellet was resuspended in growth medium. Precipitated cells were counted, transferred to Petri dishes and cultured in DMEM / low glucose (Dulbecco) medium, 10% fetal calf serum, 2 mM glutamine, 100 μg / ml streptomycin, 100 IU / ml penicillin at 37 ° C, 5% CO2 and 21% O2. In the experiments used 1-3 passage MSC.

Example 4. The introduction of the plasmid in the MSC using electroporation.

For electroporation, MSCs were cultured until the monolayer reached 80% confluence, after which the cells were removed in 10% trypsin-EDTA solution and washed 2 times in phosphate-buffered saline. Cells were counted and resuspended in the amount of 106 cells in 200 μl of Opti-MEM medium (Gibco) containing 5 μg of plasmid in TE buffer. The mixture was incubated for 20 minutes and transferred to an electroporation cuvette with a gap of 2 mm. Electroporation was performed using an electroporator (BioRad) in exponential mode with parameters: voltage - 90 V, capacitance - 500 μF, resistance - infinity. The electroporation efficiency was evaluated one day after electroporation on a flow cytometer using the level of EGFP expression in control MSCs. MSCs were used in the experiment, the electroporation efficiency of which was at least 25%.

Example 5. Analysis of the antitumor efficacy of MSCs expressing fusion cytosine deaminase and fusion mouse cytosine deaminase VP22 in a mouse model of B16 melanoma and Lewis mouse adenocarcinoma

For transplantation of transplanted tumors, female mice of the C57B16 line were used, weighing 18-22 g. Animals were kept in a vivarium with natural light on briquetted food and constant access to water. B16 melanoma was transplanted on C57B16 females subcutaneously by a suspension of tumor cells of 30-60 mg in 0.3-0.5 ml of nutrient medium 199 (PanEco) per mouse. In the experiments used 3 passage of melanoma B16. Lewis adenocarcinoma was inoculated intramuscularly with 40 mg of suspension, and for the experiment was administered to males in the amount of 50 mg per mouse.

Before treatment, mice were divided into groups. One group was left without specific treatment and was considered a control. MSCs were administered intratumorally in 106 cells mixed with 50 μl of sterile phosphate-buffered saline on the 6-7th day after transplantation of melanoma and on the 8th day after transplantation of Lewis adenocarcinoma after reaching a tumor volume of 400 mm on average. The substrate for cytosine deaminase 5-fluorocytosine (InvivoGen) was started on the same day, 4-8 hours after the introduction of MSC, intraperitoneally at a dose of 50 mg per 1 kg of body weight, and then 1 time per day in the same dose for 7-10 days.

The treatment efficacy of mice with subcutaneously inoculated B16 melanoma and intramuscularly inoculated Lewis adenocarcinoma was evaluated according to standard criteria: inhibition of tumor growth (TPO%), increase in life expectancy (VL%) and cure of animals. TPO≥50%, UPJ≥25% were considered significant. Performance indicators were determined in comparison with control groups of mice. The effect of MSCs expressing fusion cytosine deaminase and fusion cytosine deaminase-VP22 on growth inhibition of B16 melanoma is shown in FIG. 3, and their effect on the survival of mice with B16 melanoma is shown in FIG. 4. Quantitative data on the effects of MSCs expressing fusion cytosine deaminase and fusion cytosine deaminase-VP22 on B16 melanoma are shown in Table 1. Quantitative data on the effects of MSC expressing fusion cytosine deaminase and fusion cytosine deaminase-VP22 on adenocarcinoma Table 2 are shown.

The list of nucleotide sequences

SEQ ID NO 1

<110> Karshieva S.S., Krasikova L.S., Belyavsky A.V.

<120> Recombinant plasmid pCpG-CytDA / upp for expression of the hybrid protein cytosine deaminase-uracylphosphoribosyl transferase, recombinant plasmid pCpG-CytDA / upp / VP22 for expression of the hybrid protein cytosine deaminase-uracilylphosphoric therapy and its use

160> 1

<210> 1

<211> 4981

<212> DNA

<213> Artificial sequence

<400> 1

SEQ ID NO 2

<110> Karshieva S.S., Krasikova L.S., Belyavsky A.V.

<120> Recombinant plasmid pCpG-CytDA / upp for expression of the hybrid protein cytosine deaminase-uracylphosphoribosyl transferase, recombinant plasmid pCpG-CytDA / upp / VP22 for expression of the hybrid protein cytosine deaminase-uracilylphosphoric therapy and its use

<160> 2

<210> 2

<211> 5876

<212> DNA

<213> Artificial sequence

<400> 1

Claims (7)

1. Recombinant plasmid pCpG-CytDA / upp size 4981 n.p., providing expression of the hybrid protein cytosine deaminase E. coli-uracylphosphoribosyl transferase, the nucleotide sequence of which is presented in the list of nucleotide sequences under the number SEQ ID NO: 1. 2. Recombinant plasmid pCpG-CytDA / upp / VP22 of 5876 bp, which provides expression of the fusion protein of E. coli cytosine deaminase, coli-uracylphosphoribosyl transferase-protein VP22 of human herpes virus, the nucleotide sequence of which is presented in the sequence list under the number SEQ ID NO: 2. 3. The composition, which includes: a) therapeutically effective amounts of mesenchymal stem / stromal cells obtained from the bone marrow or adipose tissue of a patient or donor, into which, using electroporation, the recombinant plasmid pCpG-CytDA / upp according to claim 1 or a recombinant plasmid pCpG-CytDA / upp / VP22 according to claim 2; b) a pharmaceutically acceptable buffer used in combination with the subsequent introduction of 5-fluorocytosine into the body for the treatment of a group of oncological diseases. 4. The composition according to p. 3, characterized in that another plasmid is introduced into the mesenchymal stem / stromal cells together with the plasmid pCpG-CytDA / upp or plasmid pCpG-CytDA / upp / VP22, which allows selection of transfected cells. 5. The composition according to p. 4, characterized in that before use, selection is made of transfected cells. 6. A method for the treatment of a group of oncological diseases, which are solid tumors, by administering a composition according to claims. 3, 4 or 5 intratumorally into the patient’s body, after which 5-fluorocytosine in therapeutically effective amounts is also administered. 7. The method of claim 6, wherein the cancer is selected from the group consisting of melanoma, breast cancer, esophageal cancer, stomach cancer, pancreatic cancer, colon cancer, colorectal cancer, primary liver cancer, lung cancer, bladder cancer, prostate cancer, ovarian cancer, cervical cancer, endometrial carcinoma, malignant tumors of the head and neck and glioblastoma.

Images