CN116617382B

CN116617382B - Novel coronavirus vaccine, preparation method and application thereof

Info

Publication number: CN116617382B
Application number: CN202310792889.0A
Authority: CN
Inventors: 彭育才; 刘隽; 刘琪; 雷奕欣; 李爽; 罗丽平
Original assignee: Zhuhai Lifanda Biotechnology Co ltd
Current assignee: Zhuhai Lifanda Biotechnology Co ltd
Priority date: 2022-09-30
Filing date: 2023-06-30
Publication date: 2024-02-02
Anticipated expiration: 2043-06-30
Also published as: CN116617382A; CN116808191A; CN115716866A

Abstract

The present disclosure provides a novel coronavirus vaccine, a preparation method and applications thereof, and relates to the technical field of vaccines. The novel coronavirus vaccine comprises nucleic acid molecules for encoding a novel coronavirus Delta variant S protein and encoding a novel coronavirus Omik Rong Zi variant BA.5S protein, and is a multivalent vaccine.

Description

Novel coronavirus vaccine, preparation method and application thereof

Cross Reference to Related Applications

The present application claims priority from chinese patent application (application number: 2022112076839, title of the invention: novel coronavirus vaccine, and methods for preparing and using the same), having application date 2022, 09, 30, which is incorporated herein by reference in its entirety.

Technical Field

The disclosure relates to the technical field of vaccines, and in particular relates to a novel coronavirus vaccine, a preparation method and application thereof.

Background

The novel coronavirus is extremely easy to mutate, and the strains such as a novel coronavirus original strain, a novel coronavirus Alpha strain, a novel coronavirus Beta strain, a novel coronavirus Gamma mutant strain, a novel coronavirus Kappa strain, a novel coronavirus Delta strain, a novel coronavirus Omicron strain and the like appear successively from the discovery to date.

The current market and most of the new coronavirus vaccines in clinical trial stage are designed against the antigen of the original strain of the new coronavirus. The omickon (omacron) variant is at least 60 more mutations compared to the original new coronavirus original strain sequence, with more than 35 mutations in the spike protein (S protein) and 15 mutations in the most critical receptor binding domain within the spike protein (S protein), as opposed to only 2 mutations in this region. The omnikom variant can be divided into at least 5 sub variants, ba.1, ba.2.12.1, ba.2, ba.4, ba.5, etc., according to the difference in mutation sites.

It was found that the protective effect of the marketed vaccine against variants was reduced to varying degrees, in particular against the novel coronavirus omnikom strain. Therefore, new crown vaccines with better protection effect against variant strains are urgently needed to be developed.

Disclosure of Invention

According to various embodiments of the present disclosure, there is provided a novel coronavirus vaccine comprising a nucleic acid molecule comprising a first open reading frame and comprising a second open reading frame;

the first open reading frame encodes a novel coronavirus Delta variant S protein; the second open reading frame encodes a novel coronavirus omnix Rong Zi variant ba.5s protein.

In one or more embodiments, the novel coronavirus vaccine comprises: a nucleic acid molecule comprising a first open reading frame; and, a nucleic acid molecule comprising a second open reading frame;

alternatively, the novel coronavirus vaccine comprises: a fusion nucleic acid molecule comprising both a first open reading frame and a second open reading frame.

In one or more embodiments, the novel coronavirus Delta variant S protein has an amino acid sequence as set forth in SEQ ID No.8, or comprises an amino acid sequence that is at least 80% identical to SEQ ID No.8, such as, but not limited to, an amino acid sequence that comprises at least 80%, 85%, 90%, 95%, or 98% identical to SEQ ID No. 8.

In one or more embodiments, the amino acid sequence of the novel coronavirus omnix Rong Zi variant ba.5s protein is as shown in SEQ id No.26, or comprises an amino acid sequence that is at least 80% identical to SEQ id No.26, for example, but not limited to, an amino acid sequence comprising at least 80%, 85%, 90%, 95% or 98% identical to SEQ id No. 26.

In one or more embodiments, the nucleic acid molecules include DNA molecules and/or RNA molecules.

In one or more embodiments, the DNA molecules include a chain DNA molecule and/or a circular DNA molecule.

In one or more embodiments, the RNA molecule comprises mRNA or circular RNA.

In one or more embodiments, the nucleic acid molecule is RNA.

In one or more embodiments, the total GC% content of the portion of the open reading frames in the RNA is 30-70%, and the GC% content in any one of the 60bp long fragments of the open reading frames is not less than 40%.

In one or more embodiments, the total gc% content of the portion of the open reading frame in the RNA is 50% to 60%, more preferably 54% to 60%.

In one or more embodiments, the RNA further includes one or more of a 5' cap, a 5' utr, a 3' utr, a polyA tail, a start region, a termination region, a signal sequence region, and a linker sequence.

In one or more embodiments, the nucleotide sequence of the first open reading frame is as set forth in SEQ id No.9, SEQ id No.36, SEQ id No.37, SEQ id No.38, SEQ id No.39, SEQ id No.40, SEQ id No.41, SEQ id No.42, or SEQ id No. 29.

In one or more embodiments, the nucleotide sequence of the second open reading frame is as set forth in SEQ id No.27, SEQ id No.32, SEQ id No.20, SEQ id No.21, SEQ id No.22, SEQ id No.23, SEQ id No.24, SEQ id No.25, SEQ id No. 28.

In one or more embodiments, the first open reading frame and the second open reading frame are combined in a manner selected from the group consisting of: SEQ ID No.9 and SEQ ID No.27, SEQ ID No.9 and SEQ ID No.32; SEQ ID No.36 and SEQ ID No.32, SEQ ID No.37 and SEQ ID No.20, SEQ ID No.38 and SEQ ID No.21, SEQ ID No.39 and SEQ ID No.22, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.29 and SEQ ID No.28, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.39 and SEQ ID No.32, SEQ ID No.38 and SEQ ID No.22, SEQ ID No.37 and SEQ ID No.21, SEQ ID No.36 and SEQ ID No.20.

In one or more embodiments, the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is (1:9) - (9:1); the mass ratio of the nucleic acid molecule comprising the coding for the first open reading frame to the nucleic acid molecule comprising the coding for the second open reading frame is (1:9), (1:8), (1:7), (1:6), (1:5), (1:4), (1:3), (1:2), (1:1), (2:1), (3:1), (4:1), (5:1), (6:1), (7:1), (8:1), (9:1); in one or more embodiments, the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is 3:1.

In one or more embodiments, the nucleic acid molecule is a fusion nucleic acid molecule, and the number of repetitions of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) - (9:1); the number of repeats of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9), (1:8), (1:7), (1:6), (1:5), (1:4), (1:3), (1:2), (1:1), (2:1), (3:1), (4:1), (5:1), (6:1), (7:1), (8:1), (9:1); in one or more embodiments, the number of repeats of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is 3:1.

In alternative embodiments, based on the provided RNA sequences, one of ordinary skill in the art will be able to obtain the corresponding DNA sequences (e.g., uracil to thymine). Likewise, based on the DNA sequences provided, one of ordinary skill in the art will obtain the corresponding RNA sequences (e.g., thymine to uracil conversion). In alternative embodiments, based on the provided RNA or DNA sequences, the person of ordinary skill in the art will be able to obtain the corresponding amino acid sequences.

In one or more embodiments, the vaccine further comprises a delivery formulation.

In one or more embodiments, the novel coronavirus vaccine contains nucleic acid lipid nanoparticles composed of the nucleic acid molecules and lipid components.

In one or more embodiments, the novel coronavirus vaccine is selected from (a), (b), or (c):

(a) The novel coronavirus vaccine comprises nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a first open reading frame, and nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a second open reading frame;

(b) The novel coronavirus vaccine comprises nucleic acid lipid nanoparticles encapsulated with a nucleic acid molecule comprising a first open reading frame and a nucleic acid molecule comprising a second open reading frame;

(c) The novel coronavirus vaccine comprises: nucleic acid lipid nanoparticles encapsulated with a fused nucleic acid molecule comprising both a first open reading frame and a second open reading frame.

According to various embodiments of the present disclosure, the present disclosure also provides a method of preparing the above-described novel coronavirus vaccine, comprising mixing the nucleic acid molecule with optional adjuvants to obtain the novel coronavirus vaccine.

In one or more embodiments, the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, the method of making comprising:

Separately preparing nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a first open reading frame and nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a second open reading frame; then mixing the two nucleic acid lipid nanoparticles according to the formula amount;

or, firstly mixing the nucleic acid molecules containing the first open reading frame and the nucleic acid molecules containing the second open reading frame according to the formula amount, and then preparing the nucleic acid lipid nanoparticle coated with the nucleic acid molecules containing the two nucleic acid molecules;

alternatively, nucleic acid lipid nanoparticles are prepared that encapsulate nucleic acid molecules that contain both a first open reading frame and a second open reading frame.

In one or more embodiments, the present disclosure also provides the use of the novel coronavirus vaccines described above, or the methods of preparation described above, in the preparation of a product configured to prevent or treat a disease caused by a novel coronavirus.

According to another aspect of the present disclosure, the present disclosure also provides a product configured to prevent or treat a novel coronavirus-induced disease, the product comprising the novel coronavirus vaccine described above.

The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the disclosure will be apparent from the description and drawings, and from the claims.

Drawings

For a clearer description of embodiments of the disclosure or of the prior art, reference may be made to one or more of the accompanying drawings. The appended claims or examples used to describe the drawings should not be construed to limit the scope of the disclosed invention, the presently described embodiments and or examples, and any of the best modes of carrying out the invention presently understood. The drawings that are needed in the detailed description and prior art description are briefly presented below, and it will be apparent to those of ordinary skill in the art that other drawings may be derived from these drawings without undue burden as well as from some embodiments of the present disclosure.

FIG. 1 shows the results of test for pseudovirus neutralizing activity of serum produced after immunization of cynomolgus monkeys with each vaccine preparation in experiment A of example 4.

FIG. 2 shows the results of test for pseudovirus neutralizing activity of serum produced after immunization of cynomolgus monkeys with each vaccine preparation in experiment B of example 4.

FIG. 3 shows the results of test of pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 5.

FIG. 4 shows the results of test for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 6.

FIG. 5 shows the results of test of pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 8.

FIG. 6 shows the results of test of pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 9.

FIG. 7 shows the results of test for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 10.

FIG. 8 is a graph showing the results of test of pseudovirus neutralizing activity of serum produced after immunization of C57 mice with each vaccine formulation of example 11 against novel coronaviruses.

FIG. 9 shows the results of the test for pseudovirus neutralizing activity of serum produced after immunization of C57 mice with each vaccine formulation of example 12 against novel coronaviruses.

FIG. 10 shows the results of test for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 13.

FIG. 11 is a graph showing the results of test of pseudovirus neutralizing activity of serum produced after immunization of C57 mice with each vaccine formulation of example 14 against novel coronaviruses.

Fig. 12 is the results of a real virus cross-neutralization activity test of each vaccine formulation immunized SPF mice against the original strain and the currently prevailing strain in example 15.

Detailed Description

The technical solutions of the present disclosure will be clearly and completely described below in connection with embodiments, and it is apparent that the described embodiments are some embodiments of the present disclosure, but not all embodiments. Based on the embodiments in this disclosure, all other embodiments that a person of ordinary skill in the art would obtain without making any inventive effort are within the scope of protection of this disclosure.

It should be noted that: in the present disclosure, all embodiments and preferred methods of implementation mentioned herein may be combined with each other to form new solutions, if not specifically stated; all technical features and preferred features mentioned herein may be combined with each other to form new solutions; the components involved or their preferred components can be combined with one another to form new technical solutions.

The "range" disclosed in the present disclosure may be in the form of a lower limit and an upper limit, respectively, of one or more lower limits, and of one or more upper limits; unless otherwise indicated, the steps may or may not be performed in sequential order.

Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any method or material similar or equivalent to those described may also be used in the present disclosure.

According to various embodiments of the present disclosure, the present disclosure provides a novel coronavirus vaccine comprising a nucleic acid molecule comprising a first open reading frame encoding a novel coronavirus Delta variant S protein and a second open reading frame encoding a novel coronavirus Omicron (Omicron) child variant ba.5S protein, as an immunogenic substance. After the novel coronavirus vaccine is used for immunizing an organism, novel coronavirus Delta variant and Omik Rong Zi variant BA.5S proteins can be expressed in the organism, so that the novel coronavirus vaccine is a multivalent vaccine.

"nucleic acid molecule" as used in this disclosure refers to a polymeric form of nucleotides of any length, including ribonucleotides and/or deoxyribonucleotides. Examples of nucleic acids include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA; integrating vector DNA from an exogenous gene, such as an expression cassette or plasmid; DNA-RNA hybrids or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases.

In the nucleic acid molecule comprising the first open reading frame and the second open reading frame, the first open reading frame and the second open reading frame may be present in the same nucleic acid molecule or may be present in different nucleic acid molecules. Therefore, as long as the nucleic acid molecules contained in the novel coronavirus vaccine contain the first open reading frame and the second open reading frame, the novel coronavirus Delta variant and the Omik Rong Zi variant BA.5S protein can be generated in the body after the novel coronavirus vaccine is applied to the body, namely the novel coronavirus vaccine provided by the disclosure.

In some alternative embodiments, the novel coronavirus vaccine comprises: a nucleic acid molecule comprising a first open reading frame; and, a nucleic acid molecule comprising a second open reading frame;

Experiments show that after animals are immunized by nucleic acid molecules containing S protein of a novel coronavirus Delta variant, antibodies generated in animal serum have strong neutralization activity on pseudoviruses of 6 strains of a novel coronavirus original strain, an Alpha variant strain, a Beta variant strain, a Gamma variant strain, a Delta variant strain and an Omicron variant strain; after animals are immunized by the nucleic acid molecules containing the S protein of the novel coronavirus omnikom variant, antibodies generated in animal serum have stronger neutralization activity on Omicron variant; the novel coronavirus vaccine contains nucleic acid molecules capable of encoding Delta variant S protein and Omikovia variant S protein, and has the effect of preventing various epidemic strains of the novel coronavirus.

In the novel coronavirus vaccine provided by the disclosure, the S protein of the novel coronavirus encoded by the open reading frame is optionally the S protein obtained by mutating a Delta variant strain and/or an Omikovia variant strain under natural conditions; alternatively, the mutant and modified S protein can be an amino acid sequence of the S protein which is obtained by wild type mutation and modification and accords with a Delta variant strain or an Omikou variant strain; alternatively, the amino acid sequence of the S protein may be obtained by further mutating and modifying the amino acid sequences of the S proteins of the Delta variant strain and the Omikovia variant strain.

In one or more embodiments, the amino acid sequence of the S protein of the novel coronavirus encoded by the open reading frame is as follows:

the amino acid sequence of the novel coronavirus Delta variant S protein is preferably as shown in SEQ ID.NO.8, or comprises an amino acid sequence at least 80% identical to SEQ ID.NO.8, for example, but not limited to, an amino acid sequence comprising at least 80%, 85%, 90%, 95% or 98% identical to SEQ ID.NO. 8; the amino acid sequence of the S protein of the novel coronavirus Omikovia variant is derived from the S protein of the BA.5 variant, the BA.2 variant, the BA.3 variant or the S protein of the BA.5 variant; or, the amino acid sequence of the S protein of the omnikom variant is optionally derived from the amino acid sequence obtained by mutating a wild-type S protein.

In one or more embodiments, the novel coronavirus omucon variant is the S protein of a ba.2 subvariant or a ba.1 subvariant or a ba.5 subvariant; more preferably, the strain is a strain of the BA.5 child variant.

The amino acid sequence of the novel coronavirus omucon variant ba.1 subvariant S protein is preferably as shown in SEQ id No.16 or comprises an amino acid sequence at least 80% identical to SEQ id No.16, for example, but not limited to, an amino acid sequence comprising at least 80%, 85%, 90%, 95% or 98% identical to SEQ id No. 16.

The amino acid sequence of the novel coronavirus omucon variant ba.2 subvariant S protein is preferably as shown in SEQ id No.14 or comprises an amino acid sequence at least 80% identical to SEQ id No.14, for example, but not limited to, an amino acid sequence comprising at least 80%, 85%, 90%, 95% or 98% identical to SEQ id No. 14.

The amino acid sequence of the novel coronavirus omucon variant ba.5 subvariant S protein is preferably as shown in SEQ id No.26 or comprises an amino acid sequence at least 80% identical to SEQ id No.26, for example, but not limited to, an amino acid sequence comprising at least 80%, 85%, 90%, 95% or 98% identical to SEQ id No. 26.

"sequence identity" between two nucleotide sequences indicates the percentage of identical nucleotides between the sequences. "sequence identity" between two amino acid sequences indicates the percentage of identical amino acids between the sequences.

The term "% identity" or similar terms refer to the percentage of identical nucleotides or amino acids between sequences to be compared under optimal alignment. The percentages are purely statistical and the differences between the two sequences may (but need not) be randomly distributed over the length of the sequences to be compared. Comparison of two sequences is typically performed by comparing the sequences with respect to a fragment or "comparison window" after optimal alignment to identify local regions of the corresponding sequences.

The S protein of the omacron ba.5 strain, SEQ id No.26, has higher expression levels by SN mutation (two proline residues substituted at positions 981 and 982 of the amino acid sequence of the full-length S protein).

The amino acid sequence positions are positioned by the full-length amino acid sequence of the wild-type S protein of the novel coronavirus original strain.

The novel coronavirus vaccine provided by the disclosure takes nucleic acid molecules as main efficacy components, and the novel coronavirus vaccine expresses and generates S protein of novel coronavirus Delta variant strain and virus Omikovia strain in vivo after being applied to an organism. In order to further enhance the immune effect of the vaccine, the present disclosure also optimizes the nucleic acid molecules, the ratio of the two nucleic acids encoding the S protein, and the vaccine formulation.

In one or more embodiments, the nucleic acid molecule can optimize mRNA sequence by means of sequence optimization, improving characteristics related to expression efficacy after in vivo administration: for example, mRNA with improved properties can be obtained by increasing mRNA stability, increasing translational efficiency in the target tissue, reducing the number of truncated proteins expressed, improving folding or preventing misfolding of the expressed protein, reducing toxicity of the expressed product, reducing cell death caused by the expressed product, increasing and/or reducing protein aggregation. The sequence optimization purposes also include: optimizing the characteristics of formulation and delivery of nucleic acid-based therapeutics while maintaining structural and functional integrity; overcoming the threshold of expression; the expression rate is improved; half-life and/or protein concentration; optimizing protein localization; and avoiding adverse biological responses such as immune responses and/or degradation pathways. The sequence optimizing means includes: (1) Codon optimization to ensure proper folding and proper expression is performed according to codon frequency in a particular organ and/or host organism; (2) Regulating the G/C content to increase mRNA stability or decrease secondary structure; (3) Minimizing tandem repeat codons or base strings (base run) that may impair gene construction or expression; (4) custom transcription and translation control regions; (5) Reducing or eliminating problematic secondary structures within the polynucleotide.

Optimization of nucleic acid molecules:

the nucleic acid molecules contained in the novel coronavirus vaccine are preferably RNA, and the novel coronavirus vaccine is preferably an RNA vaccine.

In one or more embodiments, the total gc% content of the open reading frame portions in the RNA is 30-70%, such as, but not limited to, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70%, or a range between any two points thereof, preferably 50-60%, more preferably 54-60%. Meanwhile, the GC% content in any fragment with the length of 60bp in the open reading frame part is not less than 40%, and the novel coronavirus S protein expression amount of the RNA meeting the conditions is found to be higher through experiments.

In one or more embodiments, the RNA further comprises one or more of a 5' cap, a 5' utr, a 3' utr, a polyA tail, a initiation region, a termination region, a signal sequence region, and a linker sequence; the structure of the RNA in the novel coronavirus vaccine is preferably as follows:

alternatively, the RNA comprises, in order from the 5 'end to the 3' end: 5 'cap-5' utr-first open reading frame and/or second open reading frame-3 'utr-3' polya tail; sequentially includes fragments comprising RNA from the 5 'end to the 3' end, and may or may not comprise at least one ribonucleotide or functional nucleic acid fragment.

Alternatively, the RNA contains both a first open reading frame and a second open reading frame, and is a fusion RNA, the structure of which is preferably as follows:

an alternative example structure is as follows: 5 'cap-5' utr-initiation region-first open reading frame-linker sequence-second open reading frame-3 'utr-termination region-3' polya tail;

or, a 5 'hat-5' UTR-first open reading frame-linker sequence-second open reading frame-3 'UTR-3' polyA tail;

an alternative example structure is as follows: 5 'hat-5' UTR-initiation region- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3 'UTR-termination region-3' polyA tail;

or, a 5 'hat-5' UTR- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3'UTR-3' polyA tail;

wherein n is: repeat number of the fragment "first coding region-linker sequence"; m is: repeat number of the fragment "linker sequence-second coding region"; n and m are each independently a positive integer.

In the above example, the content of the open reading frame encoding the novel coronavirus Delta variant S protein and the open reading frame encoding the novel coronavirus omucon variant S protein can be adjusted by adjusting the repetition number of the fragments of the first coding region-linker sequence and the fragment of the second coding region, namely the values of n and m, or adjusting the ratio of n and m, so that after RNA immunization of a human body in the novel coronavirus, delta variant S proteins and omucon variant S proteins with different content and proportion can be produced.

Other functional fragments in RNA are preferably as follows:

the 5 'cap structure is used to increase mRNA stability and prevent mRNA from being degraded by exonuclease, and the 5' cap structure modifying group is selected from ARCA, m7G (5 "") ppp (5 "") (2 "" "ome a) pG, m7G (5" ") ppp (5" ") (2" "" ome) pG, m7 (3 "" "ome) (5" ") ppp (5" ") (2" "" ome) pG, mCAP, dmCAP, tmCAP, or dmacap. An alternative example 5' cap structure is m7G (5 ') (2 ' -OMeA) pG.

The 5' UTR and 3' UTR are used to regulate translation of mRNA, the 5' UTR sequence is preferably: GGGAGAAAGCUUACC (as shown in SEQ ID. NO. 1).

The 3' UTR sequence is preferably: GGACUAGUUAUAAGACUGACUAGCCCGAUGGGCCUCCCAACGGGCCCUCCUCCCCUC CUUGCACCGAGAUUAAU (SEQ ID. NO. 2).

The 3' polyA tail is used for preventing mRNA from being degraded by exonuclease and simultaneously ending transcription, the length of polyA is 50-200, the optional length of polyA is 80-200, the optional length of polyA is 100bp, and the sequence is shown as SEQ ID No. 3.

In one or more embodiments, based on the provided RNA sequences, one of ordinary skill in the art will be able to obtain the corresponding DNA sequences (e.g., uracil to thymine). Likewise, based on the DNA sequences provided, one of ordinary skill in the art will obtain the corresponding RNA sequences (e.g., thymine to uracil conversion). In alternative embodiments, based on the provided RNA or DNA sequences, the person of ordinary skill in the art will be able to obtain the corresponding amino acid sequences.

In one or more embodiments, one or more uridine in the mRNA is replaced with a modified nucleoside. In some embodiments, the modified nucleoside that replaces uridine is pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), or 5-methyl-uridine (m 5U).

In some alternative embodiments, the Linker sequence contains at least one portion encoding a protein cleavage signal, which may be, for example, but not limited to, a cleavage signal with a cleavage functional substance as follows: protein precursor convertases, hormone precursor convertases, thrombin and factor Xa proteins. The protein cleavage signal preferably comprises a Furin cleavage site (Furin cleavage site, FCS, reference US7374930B 2). Furin cleavage sites are widely distributed in most cell types, and the fusion RNA can effectively express active polypeptide in almost any type of cells in vivo, so that the active polypeptide expressed in vivo by the fusion RNA can be effectively cleaved by using the Furin cleavage sites, and the first open reading frame and the second open reading frame fused on the same RNA respectively express Delta variant S protein and Omikou variant S protein.

The DNA sequence of the Furin cleavage site is preferably CGTCAACGTCGT (SEQ id No. 6); the RNA sequence is preferably CGUCAACGUCGU (SEQ ID. NO. 7).

In some alternative embodiments, the Linker is a cleavable Linker or a protease sensitive Linker. The cleavable linker is preferably a 2A peptide, and the 2A peptide (2A self-cleaving peptides) is a peptide fragment 18-22 amino acid residues in length, which can induce self-cleavage of a recombinant protein containing the 2A peptide in a cell. Several viruses use 2A peptides to produce two proteins from one transcript by ribosome skipping, such that normal peptide bonds are weakened at the 2A peptide sequence, resulting in two discrete proteins produced by one translational event.

Examples of 2A peptides may be, for example, but not limited to, F2A linkers, P2A linkers, E2A linkers, T2A linkers; the amino acid sequence of the F2A linker (foot-and-mouth disease virus (FMDV) 2A peptide) is shown as SEQ ID No.43 or SEQ ID No. 44; the amino acid sequence of the P2A linker (porcine teschovirus-12A peptide) is shown as SEQ ID.NO.45 or SEQ ID.NO. 46; the amino acid sequence of the E2A linker (equine rhinitis A virus 2A peptide) is shown as SEQ ID.NO.47 or SEQ ID.NO. 48; the amino acid sequence of the T2A linker (the Leptospira Minus virus 2A peptide) is shown as SEQ ID.NO.49 or SEQ ID.NO. 50.

The N-terminal of the 2A peptide sequence is added with a GSG (Gly-Ser-Gly, glycine, serine and glycine) sequence, so that the efficiency of 2A peptide induced shearing can be improved.

The nucleotide sequence encoding the 2A peptide includes, but is not limited to, or is based on, the following sequences, modified or codon optimized by methods described hereinabove and/or known in the art for the polynucleotide sequence of the 2A peptide. In some alternative embodiments, the nucleotide sequence encoding the 2A peptide is set forth in SEQ id No.30 or SEQ id No. 31.

The linker sequence in the fragment "first coding region-linker sequence" and the linker sequence in the fragment "linker sequence-second coding region" may be identical or different.

In some alternative embodiments, the nucleotide sequence encoding the first open reading frame of the novel coronavirus Delta variant S protein is shown as SEQ ID No.9, SEQ ID No.36, SEQ ID No.37, SEQ ID No.38, SEQ ID No.39, SEQ ID No.40, SEQ ID No.41, SEQ ID No.42, or SEQ ID No. 29.

In some alternative embodiments, the second open reading frame encodes a novel coronavirus omucotton variant ba.5 subvariant, the nucleotide sequence of which is shown in SEQ id No.27, SEQ id No.32, SEQ id No.20, SEQ id No.21, SEQ id No.22, SEQ id No.23, SEQ id No.24, SEQ id No.25, or SEQ id No. 28.

The first open reading frame and the second open reading frame are optionally combined as follows:

the nucleotide sequence of the first open reading frame is selected from one of the sequences shown as SEQ ID No.9, SEQ ID No.36, SEQ ID No.37, SEQ ID No.38, SEQ ID No.39, SEQ ID No.40, SEQ ID No.41, SEQ ID No.42, or SEQ ID No.29 that expresses the Delta variant S protein; and, the nucleotide sequence of the second open reading frame is selected from one of SEQ ID No.27, SEQ ID No.32, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 or SEQ ID No.28 expressing the variant S protein of the Omikovia BA.2 mutant.

The specific combination of the first open reading frame and the second open reading frame may be, for example, but not limited to: SEQ ID No.9 and SEQ ID No.27, SEQ ID No.9 and SEQ ID No.32; SEQ ID No.36 and SEQ ID No.32, SEQ ID No.37 and SEQ ID No.20, SEQ ID No.38 and SEQ ID No.21, SEQ ID No.39 and SEQ ID No.22, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.29 and SEQ ID No.28, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.39 and SEQ ID No.32, SEQ ID No.38 and SEQ ID No.22, SEQ ID No.37 and SEQ ID No.21, SEQ ID No.36 and SEQ ID No.20.

Nucleic acid ratio encoding S protein:

in some alternative embodiments, the ratio of two S proteins produced in the body after immunization of the body with the vaccine is adjusted by adjusting the amount of nucleic acid encoding the Delta variant S protein and the amount of the Omikovia variant S protein in the novel coronavirus vaccine.

In some alternative embodiments, the first open reading frame and the second open reading frame are located in different nucleic acid molecules, the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is (1:9) - (9:1); for example, but not limited to, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or 9:1, preferably (1:1) - (9:1), more preferably 3:1. In this embodiment, the nucleic acid molecule is preferably an RNA molecule and has a sequence as from 5 'to 3' end comprising: structure of 5 'hat-5' UTR-first open reading frame and/or second open reading frame-3 'UTR-3' polyA tail.

In some alternative embodiments, the nucleic acid molecule is a fusion nucleic acid molecule, i.e., the same nucleic acid molecule contains both a first open reading frame and a second open reading frame, the number of repeats of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule being (1:9) - (9:1); for example, but not limited to, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or 9:1, preferably (1:1) - (9:1), more preferably 3:1.

Vaccine formulation optimization:

it will be appreciated that the novel coronavirus vaccines provided by the present disclosure may also contain other adjuvants or functional ingredients acceptable in the art for preparing the vaccine, including, but not limited to, at least one or more of vaccine adjuvants, delivery formulations, solvents, preservatives, stabilizers, pH adjusters, buffer substances, and lyoprotectants.

In one or more embodiments, the vaccine further comprises a delivery formulation, preferably a lipid component, preferably constituting nucleic acid Lipid Nanoparticles (LNP) with the nucleic acid molecules of the novel coronavirus vaccine, the LNP being nanoparticles formed by encapsulating the nucleic acid with the lipid component, the LNP enabling more efficient delivery of the nucleic acid encapsulated therein into cells.

The vaccine preferably further comprises a delivery formulation, preferably a lipid component, preferably constituting nucleic acid Lipid Nanoparticles (LNP) with the nucleic acid molecules of the novel coronavirus vaccine, the LNP being nanoparticles formed by encapsulating the nucleic acid with the lipid component, the LNP enabling more efficient delivery of the nucleic acid encapsulated therein into cells.

The novel coronavirus vaccine contains LNP as follows (a), (b) or (c):

(a) The first open reading frame and the second open reading frame are respectively provided with different nucleic acid molecules, the nucleic acid molecule containing the first open reading frame and the nucleic acid molecule containing the second open reading frame are respectively wrapped in different LNPs, namely the novel coronavirus vaccine comprises the LNPs wrapped with the nucleic acid molecule containing the first open reading frame and the LNPs wrapped with the nucleic acid molecule containing the second open reading frame.

(b) The first open reading frame and the second open reading frame are respectively provided with different nucleic acid molecules, the nucleic acid molecules containing the first open reading frame and the nucleic acid molecules containing the second open reading frame are mixed and then are wrapped in the same LNP, namely the novel coronavirus vaccine comprises the LNP wrapped with the nucleic acid molecules containing the first open reading frame and the nucleic acid molecules containing the second open reading frame.

(c) The first open reading frame and the second open reading frame are present in the same nucleic acid molecule which is enclosed in the LNP, i.e. the novel coronavirus vaccine comprises: LNP coated with a nucleic acid molecule comprising both a first open reading frame and a second open reading frame.

The lipid components used to construct the LNP are preferably as follows: the lipid component forming the LNP comprises 20 to 50% protonatable cationic lipid in mole percent, such as, but not limited to, 20%, 25%, 30%, 35%, 40%, 45% or 50%; 20-50% structural lipids, such as, but not limited to, 20%, 25%, 30%, 35%, 40%, 45% or 50%; 5-20% helper lipid, for example, but not limited to, 5%, 10%, 15% or 20%; and 1-5% surfactant, which may be, for example, but not limited to, 1%, 2%, 3%, 4% or 5%. Wherein the molar content of protonatable cationic lipids, structural lipids, helper lipids and surfactant add up to 100%.

The protonatable cationic lipid preferably comprises at least one of DlinMC3-DMA, DODMA, C12-200 and DlinDMA. The helper lipid preferably comprises at least one of DSPC, DOPE, DOPC, DOPG and DOPS. The structural lipids preferably comprise cholesterol and/or cholesterol derivatives. The surfactant preferably comprises at least one of PEG-DMG, PEG-DSPE and TPGS.

In some preferred embodiments, the lipid component comprises Dlin-MC3-DMA 50%, DOPG 10%, cholesterol 38.5% and PEG-DMG 1.5% in mole percent. In some preferred embodiments, the lipid component comprises Dlin-MC3-DMA 50%, DOPG 20%, cholesterol 29% and PEG-DMG 1% in mole percent.

In some alternative embodiments, the LNP in the vaccine is prepared as follows: the nucleic acid lipid nanoparticle is obtained by uniformly mixing an aqueous phase containing a nucleic acid molecule and an organic phase containing the lipid component to obtain a mixed solution, removing the organic phase and making the concentration of the nucleic acid molecule in the system to be 1 to 100. Mu.g/ml, which may be, for example, but not limited to, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100. Mu.g/ml, preferably 55. Mu.g/ml.

The mixing of the aqueous and organic phases is preferably performed using a microfluidic device, the flow rate being controlled to >3ml/min.

The organic phase is removed by preferably diluting the mixture 50 to 100 times, such as, but not limited to, 50, 60, 70, 80, 90 or 100 times, with a buffer, and removing the organic phase from the solution using Tangential Flow Filtration (TFF), followed by concentration to bring the nucleic acid molecules in the system to the target concentration.

The aqueous phase is an aqueous buffer containing 0.08-1.2 mg/L of the nucleic acid molecule, and the concentration of the nucleic acid molecule in the aqueous phase can be, for example, but not limited to, 0.08, 0.1, 0.2, 0.5, 0.8, 1.0, 1.1 or 1.2mg/L; the aqueous phase buffer solution is citrate buffer solution or sodium acetate buffer solution.

The organic phase is anhydrous C1-C4 lower alcohol containing 5-7 mg/L of the lipid component, and the concentration of the lipid component can be, for example, but not limited to, 5, 5.5, 6, 6.5 or 7mg/ml; the anhydrous C1-C4 lower alcohol is preferably ethanol.

The volume ratio of the aqueous phase to the organic phase is 1:2-4, and may be, for example, but not limited to, 1:2, 1:3, or 1:4.

It should be noted that all the technical features and preferred features mentioned above in the optimization of nucleic acid molecules, optimization of the proportion of nucleic acids encoding the S protein and optimization of vaccine formulations can be combined with each other to form new technical solutions. For example, in an optimized protocol for the proportion of nucleic acid encoding the S protein, LNP is optionally prepared in either (a), (b) or (c), with or without other delivery means; in the vaccine preparation optimization scheme, a plurality of LNPs coated with different nucleic acids are prepared by adopting different combinations of a first open reading frame and a second open reading frame; when the nucleic acid molecule adopts other types of molecules, such as an expression cassette or a vector integrated with DNA, LNP coated with DNA can also be prepared by adopting the mode of (a), (b) or (c) to serve as a main efficacy component of the vaccine. Specific examples may be, for example, but not limited to

In some alternative embodiments, the novel coronavirus vaccine comprises two RNA molecules, each comprising a first open reading frame having a nucleotide sequence shown in SEQ id No.9 and a second open reading frame having a nucleotide sequence shown in SEQ id No. 27. The two RNA molecule sequences also feature a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2), the 3' tails of 100 polyA (as shown in SEQ ID. NO. 3), N1-methyl-pseudouridine (m 1. Phi.) modified nucleosides (all uridine substitutions). The mass ratio (1:9) - (9:1) of the RNA molecules comprising the first open reading frame to the RNA molecules comprising the second open reading frame; for example, but not limited to, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 3:1, 4:1, or 9:1. The two RNA molecules are respectively prepared into LNP, and then mixed according to the mass of RNA and the formula amount to obtain the effective components in the novel coronavirus vaccine.

In this embodiment, the nucleotide sequence of the first open reading frame may also be selected from any one of SEQ id No.9, SEQ id No.36, SEQ id No.37, SEQ id No.38, SEQ id No.39, SEQ id No.40, SEQ id No.41, SEQ id No.42 or SEQ id No. 29; the nucleotide sequence of the second open reading frame may also be selected from any of SEQ ID No.27, SEQ ID No.32, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 or SEQ ID No. 28.

In the above embodiment, the specific combination manner of the first open reading frame and the second open reading frame may be, for example, but not limited to: SEQ ID No.9 and SEQ ID No.27, SEQ ID No.9 and SEQ ID No.32; SEQ ID No.36 and SEQ ID No.32, SEQ ID No.37 and SEQ ID No.20, SEQ ID No.38 and SEQ ID No.21, SEQ ID No.39 and SEQ ID No.22, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.29 and SEQ ID No.28, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.39 and SEQ ID No.32, SEQ ID No.38 and SEQ ID No.22, SEQ ID No.37 and SEQ ID No.21, SEQ ID No.36 and SEQ ID No.20.

In other alternative embodiments, the novel coronavirus vaccine comprises two RNA molecules, each comprising a first open reading frame having a nucleotide sequence shown in SEQ ID No.9 and a second open reading frame having a nucleotide sequence shown in SEQ ID No. 27. The two RNA molecule sequences also feature a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2) and 100 polyA 3' tails (as shown in SEQ ID. NO. 3), N1-methyl-pseudouridine (m 1. Phi.) modified nucleosides (replacement of all uridine). The mass ratio (1:9) - (9:1) of the RNA molecules comprising the first open reading frame to the RNA molecules comprising the second open reading frame; for example, but not limited to, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or 9:1. Mixing the two RNA molecules according to the formula, and then preparing LNP coated with the two RNA molecules to obtain the effective components in the novel coronavirus vaccine.

In the above embodiment, the nucleotide sequence of the first open reading frame may also be selected from any one of SEQ id No.9, SEQ id No.36, SEQ id No.37, SEQ id No.38, SEQ id No.39, SEQ id No.40, SEQ id No.41, SEQ id No.42 or SEQ id No. 29; the nucleotide sequence of the second open reading frame may also be selected from any of the nucleotide sequences shown as SEQ ID No.27, SEQ ID No.32, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 or SEQ ID No. 28.

In other alternative embodiments, the novel coronavirus vaccine comprises a fusion RNA molecule comprising two coding regions comprising at least a first open reading frame selected from the nucleotide sequence set forth in SEQ id No.9 and a second open reading frame selected from the nucleotide sequence set forth in SEQ id No. 27.

The fusion RNA molecule has the structure of 5 'cap-5' UTR- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3'UTR-3' polyA tail, and n and m are respectively independent positive integers. Wherein the 5' cap is m7G (5 ') (2 ' -OMeA) pG, the 5' UTR is shown as SEQ ID.NO.1, the 3' UTR is shown as SEQ ID.NO.2 and the polyA is shown as SEQ ID.NO.3, and the Linker sequences are shown as SEQ ID.NO. 21. The ratio of n to m is (1:9) - (9:1); for example, but not limited to, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, or 9:1. LNP is prepared from the fusion RNA molecule and is used as an effective component in novel coronavirus vaccine.

In the above embodiment, the nucleotide sequence of the first open reading frame may also be selected from any one of the nucleotide sequences shown in SEQ id No.9, SEQ id No.36, SEQ id No.37, SEQ id No.38, SEQ id No.39, SEQ id No.40, SEQ id No.41, SEQ id No.42 or SEQ id No. 29; the nucleotide sequence of the second open reading frame may also be selected from any of the nucleotide sequences shown as SEQ ID No.27, SEQ ID No.32, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 or SEQ ID No. 28.

According to another aspect of the present disclosure, the present disclosure also provides a method of preparing the above novel coronavirus vaccine, comprising mixing the nucleic acid molecule with optional adjuvants to obtain the novel coronavirus vaccine.

In some alternative embodiments, the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, the method of making comprising:

preparing nucleic acid lipid nanoparticles coated with nucleic acid molecules containing a first open reading frame and nucleic acid lipid nanoparticles coated with nucleic acid molecules containing a second open reading frame respectively, obtaining nucleic acid lipid nanoparticles coated with different open reading frames respectively, and mixing the two nucleic acid lipid nanoparticles according to the formula amount.

Alternatively, the nucleic acid molecule containing the first open reading frame and the nucleic acid molecule containing the second open reading frame are mixed according to the formula amount, and then the nucleic acid lipid nanoparticle coated with the nucleic acid molecules containing the two nucleic acid molecules is prepared.

The preparation method of the nucleic acid lipid nanoparticle is preferably performed according to the method of Lipid Nanoparticle (LNP) described in the section of the novel coronavirus vaccine technical scheme, and will not be described in detail here.

In some alternative embodiments, the present disclosure also provides the use of the novel coronavirus vaccine described above, or a method of preparing the novel coronavirus vaccine described above, in the preparation of a product configured to prevent or treat a novel coronavirus-induced disease.

In some alternative embodiments, the present disclosure also provides a product configured to prevent or treat a novel coronavirus-induced disease, the product comprising the novel coronavirus vaccine described above.

The above-described products configured to prevent or treat the novel coronavirus-induced diseases may be, for example, but are not limited to, kits that also contain a device configured to vaccinate the novel coronavirus vaccine as described above; kits containing other prophylactically or therapeutically active ingredients; or, a kit for evaluating the effectiveness of the novel coronavirus vaccine.

The "original strain" identified on the graph is the EC50 value of the pseudovirus strain of the original strain of the new coronavirus; "Alpha" is the EC50 value of the pseudovirus strain of the novel coronavirus Alpha strain; "Beta" is the EC50 value of the pseudovirus strain of the new coronavirus Beta strain; "Gamma" is the EC50 value of the pseudovirus strain of the novel coronavirus Gamma strain; "Delta" is the EC50 value of the pseudovirus strain of the novel coronavirus Delta strain; "BA.1" is the EC50 value of the pseudovirus strain of the novel coronavirus Omikovia BA.1 subvariant strain; "BA.2" is the EC50 value of the pseudovirus strain of the novel coronavirus Omikovia BA.2 subvariant strain; "BA.4& BA.5" is the EC50 value of the pseudovirus strain of the new coronavirus omnikom BA.4& BA.5 child variant (the S protein of the new coronavirus omnikom BA.4 child variant is the same as that of the new coronavirus omnikom BA.5 child variant); "BQ1.1" is the EC50 value of the pseudovirus strain of the novel coronavirus Omikovia BQ1.1 subvariant strain; "XBB.1" is the EC50 value of the pseudovirus strain of the variant strain of novel coronavirus XBB.1. The technical solution and advantageous effects of the present disclosure are further described below in conjunction with the preferred embodiments.

Example 1

The present example provides a method for preparing lipid nanoparticles comprising RNA, wherein the lipid nanoparticles comprise in mole percent: dlin-MC3-DMA 50%, DOPG 20%, cholesterol 29% and PEG-DMG 1%, and the preparation method is as follows:

(a) RNA was dissolved in citrate buffer at pH4 to adjust the concentration to 0.1mg/ml, to give an aqueous phase.

(b) Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG were dissolved in absolute ethanol in the amounts of the formulation, and the concentration of the lipid component in the organic phase was adjusted to 6mg/mL to give an organic phase.

(c) Mixing the aqueous phase of step (a) and the organic phase of step (b) at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12mL/min, immediately diluting the mixture 100-fold with PBS solution at pH7.4, removing ethanol component from the solution using Tangential Flow Filtration (TFF), and concentrating to a mRNA concentration of 55 μg/mL in the system to obtain lipid nanoparticles comprising RNA encoding SARS-CoV-2 virus antigen.

Example 2

The formulation of different vaccine vectors (as shown in table 1 below, "MC3" means Dlin-MC3-DMA, "+" is detected by a small animal in vivo fluorescence imaging system after administration) was studied by in vivo fluorescence imaging technique using luciferase as a reporter gene for the efficiency of delivering mRNA encoding luciferase gene in mice, and the physicochemical index of different complex formulations (preparation method see example 1) was examined, and the results are shown in table 1. It is found that increasing the mass ratio of lipid to mRNA is beneficial to increasing the encapsulation rate of mRNA in lipid nanoparticles, so that the lipid nanoparticles have higher stability, and moreover, moderately increasing the content of polyethylene glycol (PEG) in the formula is beneficial to increasing the expression efficiency of mRNA in vivo. Therefore, the factors such as the mRNA encapsulation efficiency, the in-vivo delivery efficiency of mRNA and the like are comprehensively considered, and formulas 3 and 4 are selected for the subsequent research of mRNA vaccines.

TABLE 1

Example 3

The capacity of the cationic lipid nanoparticles of different formulations to encapsulate the mRNA encoding the full length of the S protein and the particle size data of the formed nanoparticles are shown in Table 2, and several formulations can compress the S protein mRNA into nanoparticles with a particle size below 100nm and a net neutral surface potential, and can encapsulate at least 50% of the mRNA, so that the cationic lipid nanoparticles have a certain in vivo delivery effect. "MC3" refers to Dlin-MC3-DMA.

TABLE 2

Example 4

This example designed a series of mRNA sequences in which the sequence of the open reading frames is shown in table 3; in addition to the open reading frame sequence, the series of mRNA sequence features also include a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2), and the 3' tail of 100 polyAs (as shown in SEQ ID. NO. 3).

TABLE 3 mRNA sequence design scheme

Each of the above mrnas was prepared as lipid nanoparticles according to the preparation method provided in example 1.

Experiment a: and selecting normal cynomolgus monkeys about 5-8 years old, and evaluating the immunogenicity of the vaccine. Animals were randomly divided into 5 groups, namely original strain group (SEQ ID. NO. 13) (50. Mu.g/only), delta group (SEQ ID. NO. 9) (50. Mu.g/only), beta group (SEQ ID. NO. 5) (50. Mu.g/only), omicron group (SEQ ID. NO. 11) (50. Mu.g/only) and negative control group, 12 in each group, hermaphroditic.

The mRNALNP preparation prepared in example 2 was used in a cynomolgus monkey immunization experiment, and 50. Mu.g (in terms of mRNA) of each cynomolgus monkey was intramuscular injected through the hind limb thigh, and the corresponding test vaccine and the control vaccine were intramuscular injected through the hind limb thigh on D0 (D0) and D21, respectively, on the day of administration, wherein the negative control group was injected with 0.5mL of PBS. The cynomolgus monkey serum was withdrawn 28 days after the first immunization and sent to a third party laboratory for the neutralization activity test of SARS-CoV-2 pseudovirus. Diluting cynomolgus monkey serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast at the same time, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. The serum-corresponding group numbers and results are shown in figure 1.

As can be seen from fig. 1:

(1) The vaccine preparation prepared from the 4 antigens can stimulate the cynomolgus monkey to generate antibodies with neutralizing capacity to pseudoviruses of target strains.

(2) mRNA (SEQ ID NO. 9) vaccine preparation for encoding novel coronavirus Delta variant S protein stimulates that antibodies produced by cynomolgus monkey have strong neutralizing activity on pseudoviruses of 6 strains of original strain, alpha variant, beta variant, gamma variant, delta variant and Omicron variant of the novel coronavirus;

the mRNA (SEQ ID. NO. 13) vaccine preparation for encoding the S protein of the original strain of the novel coronavirus stimulates that antibodies produced by the cynomolgus monkey have stronger neutralizing activity on pseudoviruses of the original strain, alpha variant, beta variant, gamma variant and Delta variant 5 strains of the novel coronavirus, and weaker neutralizing activity on the Omicron variant;

the mRNA (SEQ ID NO. 5) vaccine preparation encoding the S protein of the novel coronavirus Beta variant stimulates the cynomolgus monkey to produce antibodies which have stronger neutralizing activity against 3 strains of pseudoviruses of the novel coronavirus Beta variant, gamma variant and Delta variant, and weaker neutralizing activity against the original strain, alpha variant and Omicron variant.

The antibodies produced by the mRNA vaccine formulations encoding the novel coronavirus Delta variant and the novel coronavirus original strain S protein possess broader neutralizing activity from the point of view of stimulating the neutralizing activity of the antibodies produced by cynomolgus monkeys against pseudoviruses of each novel coronavirus strain and variant.

Experiment B: and selecting normal cynomolgus monkeys about 5-8 years old, and evaluating the immunogenicity of the vaccine. Animals were randomly divided into 3 groups, namely, original strain group (SEQ ID. NO. 13) (50. Mu.g/one), delta group (SEQ ID. NO. 9) (50. Mu.g/one), and negative control group, 36 each, male and female halves. The neutralization activity test of SARS-CoV-2 pseudovirus was performed as described in experiment A. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. The serum corresponds to the group number and the results are shown in figure 2. The mRNA vaccine preparation sample encoding the S protein of the novel coronavirus Delta variant is designated as sample 1-1, and the mRNA vaccine preparation sample encoding the S protein of the novel coronavirus original is designated as sample 1-2.

mRNA vaccine formulations encoding the S protein of the novel coronavirus Delta variant have better neutralizing activity against epidemic strains such as Beta variants and Omicron variants.

Example 5

Screening of Omicron subtype strain S protein:

this example designed a series of mRNA sequence information in which the sequence of the open reading frames is shown in table 4; in addition to the open reading frame sequence, the series of mRNA sequence features also include a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2), and the 3' tail of 100 polyAs (as shown in SEQ ID. NO. 3).

TABLE 4mRNA sequence design scheme

Four different antigens of samples 1-4 are respectively prepared into vaccines according to the method of the embodiment 1, different mRNA mixtures are respectively prepared into LNP preparations, the detection encapsulation rate of the LNP preparations is over 90%, and the particle size is about 70 nm.

The prepared mRNALNP formulation was used in C57 mice immunization experiments, each mouse being injected 5 micrograms (in terms of mRNA) via hind limb lateral thigh muscle, and a second immunization was performed after 7 days of interval, 3 mice per group. Mice were serum withdrawn 14 days after the first immunization and sent to third party laboratories for the neutralization activity test of SARS-CoV-2 pseudovirus. Diluting mouse serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. EC50 values for pseudovirus strains of different antigens prepared from samples 1-4 are shown.

From the graph results, it can be seen that: in the vaccine preparation prepared by the mRNA vaccine open reading frame encoding different S proteins (the amino acid sequences are shown as SEQ ID No.14, SEQ ID No.16, SEQ ID No.18 and SEQ ID No. 26), the mRNA vaccine encoding the S protein with the amino acid sequence shown as SEQ ID No.26 (the encoding amino acid is the S protein of the novel coronavirus Omicron BA.5 strain) stimulates mice to generate less neutralizing antibody activity reduction on pseudoviruses of various sub-variants of the novel coronavirus Omicron.

Example 6

The present example provides a series of novel coronavirus bivalent vaccines, prepared as follows:

(a) Samples 1.1, 1.2 and 1.3 of lipid nanoparticles were prepared as described in example 1, encoding the novel coronavirus Omicron ba.1 variant S protein, encoding the novel coronavirus Omicron ba.2 variant S protein and encoding the novel coronavirus Omicron ba.5 variant S protein (open reading frame sequences as set forth in SEQ id.no.17, SEQ id.no.15 and SEQ id.no.27, respectively).

(b) Sample 2 of lipid nanoparticles was prepared as described in example 1, encoding mRNA (SEQ ID. NO. 9) of the novel coronavirus Delta variant S protein;

(c) Samples 1.1, 1.2 and 1.3 were mixed with sample 2 in a mass ratio of 3:1 to prepare new coronavirus bivalent mRNA vaccine samples 1, 2 and 3, respectively. mRNA encoding the S protein of the novel coronavirus Omicron variant and Delta variant comprises, in addition to the above-mentioned open reading frame sequences, a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID.NO. 1), a 3'UTR (as shown in SEQ ID.NO. 2) and the 3' tail of 100 polyAs (as shown in SEQ ID.NO. 3).

3 samples prepared as described above were used in C57 mouse immunization experiments, each mouse being injected 5 micrograms (in mRNA) via hind limb lateral thigh muscle, and two immunizations were performed after 7 days apart, with 3 mice per group. Mice were drawn 14 days after the first immunization and sent to third party laboratories for SARS-CoV-2 pseudovirus neutralization activity testing. Diluting mouse serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. Serum corresponds to the group number and results are shown.

From the figure, it can be seen that sample 3 of the novel coronavirus bivalent mRNA vaccine (comprising mRNA lipid nanoparticles encoding the novel coronavirus omacron ba.5 variant S protein and mRNA lipid nanoparticles encoding the novel coronavirus Delta variant S protein) produced less decrease in antibody activity against each virus variant in the pseudovirus test.

Example 7

Optimization of mRNA sequence encoding ba.5 child variant strain S protein:

this example shows a series of mRNA sequences designed based on the novel coronavirus Omacron strain S protein (amino acid sequence shown in SEQ ID. NO. 26) and mRNA sequence optimization principle, wherein the open reading frame information is shown in Table 4 below.

In addition to the open reading frames of Table 5, the series of mRNA sequence features also included a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2) and the 3' tail of 100 polyAs (as shown in SEQ ID. NO. 3).

TABLE 5 mRNA sequence design and relative expression levels

"local GC% content" in Table 5: GC% content in the partial sequence was 60bp as window size from the 3 'end to the 5' end of the ORF.

The mRNA shown in Table 5 was transfected into cells, and the expression of the S full-length protein in the cells was examined, and the results are shown in Table 5. The detailed method is as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed, and the target protein was specifically detected by SDS-PAGE immunoblotting at a loading of 10. Mu.g of total protein, and in this example, incubation was performed using an anti-SARS-S1 protein antibody as primary antibody and a goat anti-mouse-HRP antibody as secondary antibody, respectively, followed by color development. When the protein expression amount detection result is analyzed, the internal reference beta-actin is used for standardization and quantification, meanwhile, cells which are not transfected with mRNA are set as negative controls, and the difference of the expressed protein amount of transfected cells of different mRNA is compared. The detection results show that the expression of the whole S protein and the S1 subunit can be detected. The expression levels of the respective sequences were measured in terms of relative OD values as shown in Table 4; the method for calculating the relative OD value comprises the following steps: sample OD/OD of sample 1.

As can be seen from table 5: when the GC% content of the total mRNA open reading frame sequence is 54-60%, the relative expression amount of S protein is higher when the local GC% content is not lower than 40% (see SEQ ID. NO.27 and 32); in addition, the expression level of the S protein with the mRNA open reading frame sequence of SEQ ID No.27 is higher than that of the mRNA open reading frame sequence of SEQ ID No. 32.

Example 8

Two different antigens of samples 1 and 2 in example 7 are respectively prepared into vaccines according to the method in example 1, different mRNA mixtures are respectively prepared into LNP preparations, the LNP preparations have encapsulation rates of more than 90% after detection, and the particle size is about 70nm. The two groups of vaccine formulations obtained were used in C57 mouse immunization experiments, the experimental procedure being shown in example 6. Serum corresponds to the group number and results are shown.

As can be seen from the figures: since the expression level of the mRNA sequence SEQ ID.NO.27 is high, the neutralizing capacity of the antibody produced by the mRNA vaccine preparation prepared by the mRNA sequence SEQ ID.NO.27 is optimal.

Example 9

(a) An mRNA (SEQ id No. 27) lipid nanoparticle sample 1 encoding the novel coronavirus omacron ba.5 variant S protein was prepared according to the method of example 1.

(c) Sample 1 and sample 2 were mixed in a mass ratio of 1:15, 1:10, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, 9:1, 10:1 and 15:1 to prepare new coronavirus bivalent mRNA vaccine samples 2-1-2-11. mRNA encoding the S protein of the novel coronavirus Omicron BA.5 variant and Delta variant also includes, in addition to the open reading frames of SEQ ID.NO.27 and SEQ ID.NO.9, the 5 'cap (m 7G (5') (2 '-OMeA) pG), the 5' UTR (as shown in SEQ ID.NO. 1), the 3'UTR (as shown in SEQ ID.NO. 2) and the 3' tail of 100 polyAs (as shown in SEQ ID.NO. 3).

11 samples prepared as described above were used in C57 mouse immunization experiments, as described in example 6. Serum corresponds to the group number and results are shown.

The neutralizing activity of antibodies produced by the tested vaccines was considered to be better when the EC50 value of the pseudovirus strain was not less than 200. The bar graph in the figure shows the EC50 values of the pseudovirus strains of samples 2-1 to 2-11; dashed lines are indicator lines indicating positions where the EC50 value of the pseudovirus strain is 200.

Example 10

The novel coronavirus bivalent vaccine provided in this example comprises lipid nanoparticles encoding RNA of antigen 1 and antigen 2, wherein the lipid nanoparticles comprise 50% of Dlin-MC3-DMA, 10% of DOPG, 38.5% of cholesterol and 1.5% of PEG-DMG in mole percent.

The preparation method comprises the following steps:

dissolving RNA encoding different antigens in citrate buffer solution with pH of 4, and adjusting the concentration to 0.1mg/ml to obtain water phase;

Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG were dissolved in absolute ethanol in the amounts of the formulation, and the concentration of the lipid component in the organic phase was adjusted to 6mg/mL to give an organic phase.

Mixing the aqueous phase of step (a) and the organic phase of step (b) at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12mL/min, immediately diluting the mixture 100-fold with a PBS solution at ph7.4, removing the ethanol component from the solution using Tangential Flow Filtration (TFF), and concentrating to a mRNA concentration of 0.55mg/mL in the system to obtain lipid nanoparticles comprising RNAs encoding antigen 1 and antigen 2.

When the nucleotide open reading frame sequence encoding antigen 1 is SEQ ID.NO.9 (encoding the S protein of the novel coronavirus Delta variant) and the nucleotide open reading frame sequence encoding antigen 2 is SEQ ID.NO.27 (encoding the S protein of the novel coronavirus Omicron BA.5 variant), samples 1-11 were prepared for antigen 1 and antigen 2 at 1:15, 1:10, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, 9:1, 10:1 and 15:1. When the nucleotide sequences encoding antigens 1 and 2 include, in addition to the open reading frames, the 5 'cap (m 7G (5') (2 '-OMeA) pG), the 5' UTR (as shown in SEQ ID. NO. 1), the 3'UTR (as shown in SEQ ID. NO. 2) and the 3' tail of 100 polyAs (as shown in SEQ ID. NO. 3). M1 and M2 are the mRNA quality encoding antigen 1 and the mRNA quality encoding antigen 2, respectively, including the 5 'cap (M7G (5') (2 '-OMeA) pG), 5' UTR, open reading frame, 3'UTR and 3' tail.

11 samples prepared as described above were used in C57 mouse immunization experiments, as described in example 6. Serum corresponds to the group number and results are shown in the figure.

The neutralizing activity of antibodies produced by the tested vaccines was considered to be better when the EC50 value of the pseudovirus strain was not less than 200. The bar graph in the figure shows the EC50 values of the pseudovirus strains of samples 1-11; dashed lines are indicator lines indicating positions where the EC50 value of the pseudovirus strain is 200.

As can be seen from the figures: when M1: when M2 is (1:9) - (9:1) (samples 3-9), the neutralizing activity of antibodies produced by the novel coronavirus bivalent mRNA vaccine on each variant of the epidemic novel coronavirus is better. Wherein M1: when M2 is (1:1) to (9:1) (samples 6 to 9), the neutralizing activity of the antibody is more excellent.

Example 11

A novel coronal bivalent mRNA lipid nanoparticle vaccine encoding the novel coronavirus Delta variant S protein (SEQ ID. NO. 9) and the novel coronavirus Omicron BA.5 variant S protein (SEQ ID. NO. 27) were prepared as described in example 9, with mass ratios of 2 lipid nanoparticles of 1:1 and 3:1, respectively, designated as samples a and b, respectively.

A novel coronal bivalent mRNA lipid nanoparticle vaccine encoding the novel coronavirus Delta variant S protein (SEQ ID. NO. 9) and the novel coronavirus Omicron BA.5 variant S protein (SEQ ID. NO. 27) were prepared as described in example 10, with mass ratios of 2 mRNAs of 1:1 and 3:1, designated as sample c and sample d.

The mRNA sequence features also include a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (shown as SEQ ID. NO. 1), a 3'UTR (shown as SEQ ID. NO. 2) and the 3' tails of 100 polyAs (shown as SEQ ID. NO. 3).

The EC50 values of the pseudovirus strains of the novel coronavirus bivalent mRNA vaccine samples a, b, c and d prepared in this example were tested according to the method of example 6, and the experimental results are shown in the figure.

Example 12

The RNA molecules in the novel coronavirus vaccine provided in this embodiment are of a fusion RNA structure, and the specific structure is as follows:

5 'hat-5' UTR- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3 'UTR-3' polyA tail; n=3, m=1;

wherein the nucleotide sequence of the first coding region is shown as SEQ ID No. 9; the nucleotide sequence of the second coding region is shown as SEQ ID No. 27;

the 5' cap is m7G (5 ') (2 ' -OMeA) pG; the 5' UTR is shown as SEQ ID No. 1; the 3' UTR is shown as SEQ ID.NO. 2; the 3' tails of 100 polyAs are shown in SEQ ID No. 3;

the Linker sequences are shown in SEQ ID No. 31.

LNP was prepared from the above fusion RNA according to the preparation method provided in example 1, and the test results are shown in the graph, wherein the EC50 value of the pseudovirus strain of the novel coronavirus bivalent mRNA vaccine sample prepared in this example was tested according to the method of example 6.

Example 13

This example provides a series of novel coronavirus bivalent vaccines prepared as described in example 9, wherein the mRNA open reading frame sequence encoding the novel coronavirus omacron ba.5 variant S protein and the mRNA open reading frame sequence encoding the novel coronavirus Delta variant S protein, and mass ratios are shown in the following table:

TABLE 6

The test results are shown in the test results of the EC50 value of the pseudovirus strain of the novel coronavirus bivalent mRNA vaccine samples 12-1 to 12-8 prepared in this example according to the method of example 6.

Example 14

This example provides a series of novel coronavirus bivalent vaccines prepared as described in example 10, wherein the open reading frame sequence of the mRNA encoding the novel coronavirus Omacron BA.5 variant S protein and the open reading frame sequence of the mRNA encoding the novel coronavirus Delta variant S protein, and mass ratios are shown in the following table.

The test results are shown in the test results of the EC50 value of the pseudovirus strain of the novel coronavirus bivalent mRNA vaccine samples 13-1 to 13-8 prepared in this example according to the method of example 6.

TABLE 7

Example 15

The embodiment provides the immune effect of the novel coronavirus bivalent vaccine and the novel coronavirus original strain vaccine in mice, and the detection of the real virus cross neutralization activity of the original strain and the current epidemic strain is carried out by using a CPE method.

The novel coronavirus bivalent vaccine was prepared according to the method described in example 10, wherein the open reading frame sequence of the mRNA encoding the novel coronavirus Omicron BA.5 variant S protein was shown as SEQ ID No.27, the open reading frame sequence of the mRNA encoding the novel coronavirus Delta variant S protein was shown as SEQ ID No.9, and the mass ratio of the mRNA encoding the novel coronavirus Omicron BA.5 variant S protein to the mRNA encoding the novel coronavirus Delta variant S protein was 1:3. In addition to the open reading frame, the mRNA sequence of the novel coronavirus bivalent vaccine also includes a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2) and the 3' tail of 100 polyAs (as shown in SEQ ID. NO. 3). Prepared as sample 14-1.

The novel coronavirus original strain vaccine was prepared according to the method described in example 1, wherein the open reading frame sequence of the mRNA encoding the S protein of the novel coronavirus original strain is shown as SEQ ID No. 13; in addition to the open reading frame, the mRNA sequence of the novel coronavirus bivalent vaccine also includes a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in SEQ ID. NO. 1), a 3'UTR (as shown in SEQ ID. NO. 2) and the 3' tail of 100 polyAs (as shown in SEQ ID. NO. 3). Sample 14-2 was prepared.

Two new crown mRNA vaccine samples 14-1 and 14-2 were used, respectively, and 6-8 week old female KM mice were immunized by intramuscular administration (i.m.) in the foreleg and lateral regions, at a dose of 15 μg/each, 10 per group, and 3 total groups. Both vaccines were immunized at D0, D28 according to a clinically established immunization program. Post orbital blood collection was performed on D34 animals, serum was isolated and post-immune serum was tested for cross-neutralizing activity against the original strain and the currently prevalent strain using CPE method. The comparison of the effectiveness of the two vaccines of product 14-1 and sample 14-2 was performed by detecting the serum neutralizing antibody levels after immunization of the two different vaccines.

TABLE 8

Comparing the cross-neutralizing activity of the serum of sample 14-2 and sample 14-1 to the original strain of the new coronavirus and the new coronavirus variant XBB.1 of the currently prevalent strain, the new coronavirus variant BQ1.1 and the new coronavirus variant BA.5 after two immunizations of D0 and D28, respectively, the results show that the geometric average titers (GMT) of neutralizing antibodies of sample 14-2 to the original strain, BA.5, XBB.1 and BQ1.1 are respectively: 32. 12, 12 and 7; sample 14-1 had Geometric Mean Titers (GMT) of neutralizing antibodies to the original strain, ba.5, xbb.1 and BQ1.1, respectively: 12. 2702, 446 and 676 (see table below for details); when compared with sample 14-2, the neutralization activity of sample 14-1 is respectively improved by 225.2 times, 37.2 times and 96.6 times when three strains of BA.5, XBB.1 and BQ1.1 are currently prevalent, and the neutralization activity of sample 14-1 is obviously superior to that of sample 14-2 (P is less than 0.001, and the neutralization activity of sample 14-1 are not obviously different when the strain is currently prevalent (see figure).

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present disclosure, and not for limiting the same; although the present disclosure has been described in detail with reference to the foregoing embodiments, it should be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present disclosure.

Claims

1. A novel coronavirus vaccine, characterized in that the novel coronavirus vaccine comprises a nucleic acid molecule comprising a first open reading frame; and, a nucleic acid molecule comprising a second open reading frame;

the first open reading frame encodes a novel coronavirus Delta variant S protein; the second open reading frame encodes novel coronavirus omnix Rong Zi variant ba.5s protein;

the amino acid sequence of the novel coronavirus Delta variant S protein is shown as SEQ ID.NO. 8; the amino acid sequence of the novel coronavirus Omik Rong Zi variant BA.5S protein is shown in SEQ ID.NO. 26.

2. The novel coronavirus vaccine of claim 1, wherein the nucleic acid molecule is RNA; the total GC% content of the open reading frame part in the RNA is 30-70%, and the GC% content in any fragment with the length of 60bp in the fragments of the open reading frame is not less than 40%.

3. The novel coronavirus vaccine of claim 2, wherein the RNA further comprises one or more of a 5' cap, a 5' utr, a 3' polya tail, a initiation region, a termination region, a signal sequence region, and a linker sequence;

the 5' cap is selected from ARCA, m7G (5 "") ppp (5 "") (2 "" "ome) pG, m7 (3" "" ome) (5 "") ppp (5 "") (2 "" "ome) pG, mCAP, dmCAP, tmCAP, or dmCAP;

The sequence of the 5' UTR is shown as SEQ ID No. 1; the sequence of the 3' UTR is shown as SEQ ID.NO. 2; the length of the 3' polyA tail is 50-200; one or more uridine in the RNA is replaced with a modified nucleoside.

4. The novel coronavirus vaccine of claim 2, wherein the RNA has a total gc% content of the open reading frame fraction of 50-60%.

5. The novel coronavirus vaccine of claim 3, wherein the 3' polya tail is 80-200 in length; the modified nucleoside is selected from at least one of pseudouridine (ψ), N1-methyl-pseudouridine (m 1 ψ) or 5-methyl-uridine (m 5U).

6. The novel coronavirus vaccine of claim 5, wherein the 3' polya tail has the sequence shown in SEQ id No. 3.

7. The novel coronavirus vaccine of claim 2, wherein the nucleotide sequence of the first open reading frame is as set forth in SEQ id No.9, SEQ id No.36, SEQ id No.37, SEQ id No.38, SEQ id No.39, SEQ id No.40, SEQ id No.41, SEQ id No.42 or SEQ id No. 29;

the nucleotide sequence of the second open reading frame is shown as SEQ ID No.27, SEQ ID No.32, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22, SEQ ID No.23, SEQ ID No.24, SEQ ID No.25 or SEQ ID No. 28.

8. The novel coronavirus vaccine of claim 7, wherein the first open reading frame and the second open reading frame are combined in a manner selected from the group consisting of: SEQ ID No.9 and SEQ ID No.27, SEQ ID No.9 and SEQ ID No.32; SEQ ID No.36 and SEQ ID No.32, SEQ ID No.37 and SEQ ID No.20, SEQ ID No.38 and SEQ ID No.21, SEQ ID No.39 and SEQ ID No.22, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.29 and SEQ ID No.28, SEQ ID No.42 and SEQ ID No.25, SEQ ID No.41 and SEQ ID No.24, SEQ ID No.40 and SEQ ID No.23, SEQ ID No.39 and SEQ ID No.32, SEQ ID No.38 and SEQ ID No.22, SEQ ID No.37 and SEQ ID No.21, SEQ ID No.36 and SEQ ID No.20.

9. The novel coronavirus vaccine of claim 1, wherein the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is (1:9) - (9:1).

10. The novel coronavirus vaccine of claim 9, wherein the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is selected from the group consisting of (1:9), (1:8), (1:7), (1:6), (1:5), (1:4), (1:3), (1:2), (1:1), (2:1), (3:1), (4:1), (5:1), (6:1), (7:1), (8:1), (9:1).

11. The novel coronavirus vaccine of claim 10, wherein the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is (3:1).

12. The novel coronavirus vaccine of claim 1, wherein the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles comprised of the nucleic acid molecules and lipid components;

the novel coronavirus vaccine is selected from (a) or (b):

(b) The novel coronavirus vaccine comprises nucleic acid lipid nanoparticles encapsulated with a nucleic acid molecule comprising a first open reading frame and a nucleic acid molecule comprising a second open reading frame.

13. The novel coronavirus vaccine of claim 12, wherein the lipid component comprises, in mole percent, 20-50% protonatable cationic lipid, 20-50% structural lipid, 5-20% helper lipid, and 1-5% surfactant, wherein the molar content of protonatable cationic lipid, structural lipid, helper lipid, and surfactant add up to 100%;

The protonatable cationic lipid comprises at least one of dlimc 3-DMA, DODMA, C12-200 and DlinDMA;

the helper lipid comprises at least one of DSPC, DOPE, DOPC, DOPG and DOPS;

the structural lipid is cholesterol;

the surfactant includes at least one of PEG-DMG, PEG-DSPE and TPGS.

14. The novel coronavirus vaccine of claim 13, wherein the lipid component comprises Dlin-MC3-DMA 50%, DOPG 10%, cholesterol 38.5% and PEG-DMG 1.5% in mole percent.

15. The novel coronavirus vaccine of claim 13, wherein the lipid component comprises Dlin-MC3-DMA 50%, DOPG 20%, cholesterol 29% and PEG-DMG 1% in mole percent.

16. The novel coronavirus vaccine of claim 12, wherein the nucleic acid lipid nanoparticle is prepared according to the following method:

uniformly mixing an aqueous phase containing nucleic acid molecules and an organic phase containing the lipid component to obtain a mixed solution, and removing the organic phase to ensure that the concentration of the nucleic acid molecules in the system is 1-100 mug/ml to obtain the nucleic acid lipid nanoparticle;

The aqueous phase is an aqueous phase buffer solution containing 0.08-1.2 mg/L nucleic acid molecules, and the aqueous phase buffer solution is a citrate buffer solution or a sodium acetate buffer solution;

the organic phase is anhydrous C1-C4 low-carbon alcohol containing 5-7 mg/L of the lipid component; the volume ratio of the aqueous phase to the organic phase is 1:2-4.

17. A method of preparing a novel coronavirus vaccine according to any one of claims 1 to 16, comprising mixing said nucleic acid molecule with an adjuvant to obtain said novel coronavirus vaccine;

the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, and the preparation method comprises the following steps:

18. Use of the novel coronavirus vaccine of any one of claims 1-16 in the preparation of a product configured to prevent a novel coronavirus-induced disease.

19. Use of the method of preparation of claim 17 for the preparation of a product configured to prevent a novel coronavirus-induced disease.

20. A product configured to prevent a novel coronavirus-induced disease comprising the novel coronavirus vaccine of any one of claims 1-16.