JP2023526422A - Coronavirus antigen compositions and their uses - Google Patents

Abstract

The disclosure provides compositions and methods comprising circular polyribonucleotides comprising sequences encoding coronavirus antigens, as well as compositions and methods comprising linear polyribonucleotides comprising sequences encoding coronavirus antigens. For example, related compositions and methods are provided for generating polyclonal antibodies using the disclosed cyclic polyribonucleotides or the disclosed linear polyribonucleotides.

Description

SEQUENCE LISTING This application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy created on May 20, 2021 is named 51509-020WO6_Sequence_Listing_5.20.21_ST25 and is 207,385 bytes in size.

There is an urgent need for effective vaccines and therapeutics against coronavirus.

The present disclosure relates generally to cyclic polyribonucleotides comprising sequences encoding coronavirus antigens and immunogenic compositions comprising the cyclic polyribonucleotides. The disclosure further relates to methods of using cyclic polyribonucleotides and immunogenic compositions comprising sequences encoding coronavirus antigens. In certain embodiments, the cyclic polyribonucleotides and immunogenic compositions of this disclosure are used in methods of generating polyclonal antibodies. The polyclonal antibodies produced can be used in a method of prophylaxis in a subject (eg, a human subject) or a method of treatment of a subject (eg, a human subject) having a coronavirus infection. The polyclonal antibodies generated can be administered to subjects at high risk of exposure to coronavirus infection.

The present disclosure also relates to linear polyribonucleotides comprising sequences encoding sequences of SEQ ID NOs selected from Table 3 and immunogenic compositions comprising linear polyribonucleotides. The present disclosure further relates to methods of using linear polyribonucleotides comprising sequences encoding coronavirus antigens and immunogenic compositions comprising linear polyribonucleotides. In certain embodiments, the linear polyribonucleotides and immunogenic compositions of this disclosure are used in methods to generate polyclonal antibodies. The polyclonal antibodies generated can be used in a method of prophylaxis in a subject (eg, a human subject for therapy) or a method of treatment of a subject (eg, a human subject for therapy) having a coronavirus infection. The polyclonal antibodies generated can be administered to subjects at high risk of exposure to coronavirus infection for treatment.

In one aspect, the invention provides (a) a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen, e.g., a sequence selected from SEQ ID NOs in Table 1 or Table 2; A composition (eg, an immunogenic composition) comprising a linear polyribonucleotide comprising a sequence selected from SEQ ID NOs is featured.

In one embodiment, the composition further comprises plasma from a non-human animal (eg, a non-human animal comprising a humanized immune system) or a human subject (eg, after immunization of the subject for immunization).

In one embodiment, the composition contains plasma from a non-human animal (e.g., a non-human animal comprising a humanized immune system) and coronavirus antigens (e.g., after immunization of the non-human animal subject for immunization). Including further. In one embodiment, the composition further comprises plasma from a human subject (eg, after immunization of the human subject for immunization) and coronavirus antigens.

In certain embodiments, the composition further comprises a non-human B cell comprising a humanized immunoglobulin locus and a humanized B cell receptor, wherein the humanized B cell receptor binds a coronavirus antigen. In certain embodiments, the composition or immunogenic composition further comprises a plurality of non-human B cells, wherein the plurality of non-human B cells comprises humanized immunoglobulin loci, wherein a plurality of The non-human B cells comprise a first B cell that binds a first epitope of a coronavirus antigen and a second B cell that binds a second epitope of a coronavirus antigen.

In certain embodiments, the coronavirus antigen is derived from a betacoronavirus or fragment thereof or a sarvecovirus or fragment thereof. In certain embodiments, the coronavirus antigen is derived from a severe acute respiratory syndrome (SARS)-associated coronavirus or fragment thereof. In certain embodiments, the coronavirus antigen is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or fragments thereof, severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) or fragments thereof, or Middle Eastern Derived from respiratory syndrome coronavirus (MERS-CoV) or fragments thereof.

In certain embodiments, the coronavirus antigen is a membrane protein or variant or fragment thereof, a viral envelope protein or variant or fragment thereof, a viral spike protein or variant or fragment thereof, a viral nucleocapsid protein or variant or fragment thereof, or Fragments, viral accessory proteins or variants or fragments thereof. In certain embodiments, the coronavirus antigen is the receptor binding domain of the spike protein or variant or fragment thereof. In certain embodiments, the spike protein lacks a cleavage site. In certain embodiments, the coronavirus accessory protein is selected from the group consisting of ORF3a, ORF7a, ORF7b, ORF8, ORF10, or any variant or fragment thereof. In some embodiments, the coronavirus antigen is at least about 80%, 85%, 90%, 95%, 97%, 98% relative to a sequence selected from Table 1 or a sequence of SEQ ID NOs selected from Table 2 , 99% or 100% sequence identity. In some embodiments, the cyclic polyribonucleotide is at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% relative to a sequence of SEQ ID NOs selected from Table 2 includes sequences that have the sequence identity of

In certain embodiments, the polyribonucleotide comprises a plurality of sequences each encoding an antigen, at least one sequence of the plurality encoding a coronavirus antigen. In certain embodiments, a cyclic polyribonucleotide comprises two or more ORFs. In certain embodiments, the cyclic polyribonucleotide comprises at least five sequences each encoding an antigen, at least one of which is a coronavirus antigen. In certain embodiments, the cyclic polyribonucleotide comprises at least 2 ORFs, such as at least 2, 3, 4 or 5 ORFs. In certain embodiments, the cyclic polyribonucleotide comprises 5-20 sequences each encoding an antigen, at least one of which is a coronavirus antigen. In certain embodiments, the cyclic polyribonucleotide comprises 5-10 sequences each encoding an antigen, at least one of which is a coronavirus antigen. In certain embodiments, the cyclic polyribonucleotide comprises sequences encoding antigens from at least two different microorganisms, and at least one microorganism is a coronavirus. In certain embodiments, the linear polyribonucleotide comprises sequences encoding two or more antigens, wherein at least one antigen is a coronavirus antigen encoded by the sequence of SEQ ID NO in Table 3. In certain embodiments, the linear polyribonucleotide comprises sequences encoding at least 2, 3, 4, or 5 antigens, wherein at least one antigen is a coronavirus antigen encoded by the sequence of SEQ ID NO in Table 3. is. In certain embodiments, a coronavirus antigen comprises an epitope. In certain embodiments, coronavirus antigens include epitopes recognized by B cells. In certain embodiments, a coronavirus antigen comprises at least two epitopes.

In certain embodiments, the composition or immunogenic composition comprising a cyclic polyribonucleotide further comprises a second cyclic polyribonucleotide comprising a sequence encoding a second antigen. In certain embodiments, the composition or immunogenic composition further comprises a second cyclic polyribonucleotide comprising a second ORF. In certain embodiments, the composition or immunogenic composition further comprises a third, fourth, or fifth cyclic polyribonucleotide comprising a sequence encoding a third, fourth, or fifth antigen. In certain embodiments, the composition or immunogenic composition further comprises a second linear polyribonucleotide comprising a sequence encoding a second antigen. In certain embodiments, the composition or immunogenic composition comprising linear polyribonucleotides further comprises a second linear polyribonucleotide comprising a second ORF. In certain embodiments, the composition or immunogenic composition further comprises a third, fourth, or fifth linear polyribonucleotide comprising a sequence encoding a third, fourth, or fifth antigen. . In certain embodiments, the first antigen, second antigen, third antigen, fourth antigen, and fifth antigen are different antigens.

In certain embodiments, the composition or immunogenic composition further comprises a pharmaceutically acceptable carrier or excipient. In some embodiments, the polyribonucleotide is administered without a carrier (“naked”). In other embodiments, polyribonucleotides are formulated with carriers such as LNPs, VLPs, liposomes, and the like.

In some embodiments, the composition further comprises an adjuvant. In certain embodiments, the composition or immunogenic composition further comprises a diluent. In some embodiments, the composition or immunogenic composition further comprises protamine.

In another aspect, the invention provides (a) a composition described herein (e.g., (i) a sequence encoding a coronavirus antigen, e.g., selected from SEQ ID NOs in Tables 1, 2 or 3). or (ii) a composition comprising a linear polyribonucleotide comprising a sequence selected from the SEQ ID NOs in Table 3) to a non-human animal or human subject (e.g., immunized against an antigen). to induce a response or to generate polyclonal antibodies against the antigen in a non-human animal or human subject for immunization); A method comprising obtaining antibodies to an antigen from a non-human animal or a human subject for the purpose of transformation is characterized.

In certain embodiments, the method includes adding an adjuvant (e.g., Addavax™ adjuvant, MF59, AS03, Complete Freund's Adjuvant) to a non-human animal or human subject (e.g., a non-human animal or human for immunization). subject). The adjuvant can be combined and co-administered with the polyribonucleotide, or it can be formulated and administered separately.

In certain embodiments, the method comprises pre-administering an agent, e.g. priming). For example, the method includes administering a protein antigen (eg, 1-7 days prior, eg, 1, 2, 3, 4, 5, 6, 7 days prior) to administration of a polyribonucleotide comprising a sequence encoding the antigen. , to a non-human animal or human subject (eg, a non-human animal or human subject for immunization). Protein antigens can be administered as protein formulations, or encoded in plasmids (pDNA), or displayed in virus-like particles (VLPs), formulated in lipid nanoparticles (LNPs), etc. is.

In certain embodiments, the method further comprises administering or immunizing the subject (eg, the subject for immunization) with protamine.

In some embodiments, the polyribonucleotide is administered without a carrier (“naked”). In other embodiments, polyribonucleotides are formulated with carriers such as LNPs, VLPs, liposomes, and the like.

In certain embodiments, the method includes administering a polyribonucleotide (e.g., circular or linear polyribonucleotide) to a subject (e.g., a subject for immunization) at least two times, e.g., 2, 3, 4, 5 times. or immunizing with polyribonucleotides (eg, circular or linear polyribonucleotides).

In certain embodiments, the method further comprises collecting plasma from the subject (eg, after immunization of the subject for immunization). In certain embodiments, the method further comprises purifying polyclonal antibodies from the subject (eg, after immunization of the subject for immunization). In certain embodiments, the method further comprises administering or immunizing the subject (eg, the subject for immunization) with the vaccine. In certain embodiments, the vaccine is a pneumococcal polysaccharide vaccine (eg, PCV13 or PPSV23). In certain embodiments, the vaccine is for bacterial infections. In certain embodiments, a subject (eg, a subject for immunization) is immunized with circular RNA by injection. In certain embodiments, a subject (eg, a subject for immunization) is immunized with linear RNA by injection.

In embodiments, the subject is a human subject (eg, a human subject for immunization). In certain embodiments, a human subject (e.g., a human subject for immunization) is a subject at risk for coronavirus-associated disease, e.g., humans over the age of 50; immunocompromised humans; obesity, diabetes, cancer, etc. Humans with chronic health problems; health care workers.

In embodiments, the subject is a non-human animal (eg, non-human animal for immunization). In certain embodiments, the non-human animal (e.g., non-human animal for immunization) is a farm animal, such as a cow, pig, sheep, horse, goat; a pet, such as a cat or dog; or a zoo animal, such as , is an animal of the cat family.

In certain embodiments, the non-human animal (e.g., non-human animal for immunization) is a mammal, e.g., a rodent (e.g., rabbit, rat or mouse), or an ungulate, e.g., pig, cow. , goats, or sheep. In certain embodiments, the non-human animal (eg, non-human animal for immunization) is an artificially transchromosomal non-human animal comprising humanized immunoglobulin loci. In certain embodiments, the non-human animal is an artificially transchromosomal bovine comprising a human artificial chromosome (HAC) vector comprising humanized immunoglobulin loci. In certain embodiments, the humanized immunoglobulin locus encodes an immunoglobulin heavy chain. In certain embodiments, the humanized immunoglobulin heavy chain comprises an IgG isotype heavy chain. In certain embodiments, the humanized immunoglobulin heavy chain comprises an IgG1, IgG2, IgG3, or IgG4 isotype heavy chain.

In certain embodiments, the non-human animal (eg, non-human animal for immunization) comprises B cells having a B cell receptor, the B cell receptor binding a coronavirus antigen. In certain embodiments, the non-human animal has a plurality of B cells comprising a first B cell that binds a first epitope of a coronavirus antigen and a second B cell that binds a second epitope of a coronavirus antigen. include.

In certain embodiments, the non-human animal (eg, non-human animal for immunization) comprises T cells, wherein the T cells comprise T cell receptors that bind coronavirus antigens. In certain embodiments, after activation, T cells promote the production of antibodies that bind antigens. In certain embodiments, after activation, T cells promote antibody production by B cells that bind to coronavirus antigens. In certain embodiments, after activation, T cells promote survival, proliferation, plasma cell differentiation, somatic hypermutation, immunoglobulin class switching, or a combination thereof of B cells that bind coronavirus antigens.

In certain embodiments, a non-human animal or human subject (eg, a non-human animal or human subject for immunization) produces antibodies that specifically bind to coronavirus antigens. In certain embodiments, the antibody is a humanized or fully human antibody. In certain embodiments, the antibody is an antibody IgG, IgA, or IgM isotype antibody. In certain embodiments, the antibody is an IgG1, IgG2, IgG3, or IgG4 isotype antibody. In certain embodiments, the non-human animal (eg, the non-human animal for immunization) comprises a plurality of polyclonal antibodies that specifically bind at least two epitopes encoded by cyclic polyribonucleotides. In certain embodiments, a non-human animal or human subject (e.g., a non-human animal or human subject for immunization) is raised with a plurality of polyclonal antibodies that specifically bind to at least two epitopes encoded by the linear RNA. include. In certain embodiments, the plurality of antibodies comprises humanized antibodies. In certain embodiments, the plurality of polyclonal antibodies comprises fully human antibodies. In certain embodiments, the plurality of polyclonal antibodies comprises IgG antibodies, IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, IgG4 antibodies, IgM antibodies, IgA antibodies, or combinations thereof. In certain embodiments, the immunoglobulin heavy chain comprises an IgM or IgA isotype heavy chain. In certain embodiments, the humanized immunoglobulin locus encodes an immunoglobulin light chain. In certain embodiments, immunoglobulin light chains comprise kappa or lambda light chains.

In certain embodiments, the method comprises collecting blood from a non-human animal or human subject (e.g., after immunizing the non-human animal or human subject for immunization) and purifying antibodies to the antigen from the blood. further comprising:

In another aspect, the invention provides (a) a composition comprising a polyribonucleotide as described herein, in a non-human animal as described herein (e.g., humanized as described herein). (b) a non-human animal or human subject (e.g., a non-human animal for immunization); or after immunization of a human subject) are characterized as anti-coronavirus antibody preparations (eg, polyclonal antibody preparations) produced by harvesting antibodies against the antigen.

In embodiments, the polyribonucleotide is (a) a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen, e.g., a sequence selected from SEQ ID NOs in Tables 1, 2 or 3, or (b) is a linear polyribonucleotide comprising a sequence selected from SEQ ID NOs in.

In embodiments, an antibody formulation is formulated as a pharmaceutical composition.

In another aspect, the present invention provides antibodies to coronavirus to a subject having, at risk of exposure to, or in need of coronavirus infection (e.g., a subject for treatment). For example, a method of preventing or treating a subject (eg, a subject for treatment) against coronavirus infection. The method includes administering to a subject having, at risk of exposure to, or in need of, a coronavirus infection (e.g., a subject for treatment) a polyribonucleotide described herein. Polyclonal antibodies generated from a human or an animal with a humanized immune system (e.g., a mammal) immunized with nucleotides, e.g., (a) sequences encoding coronavirus antigens, e.g., Tables 1, 2 or 3 or (b) a linear polyribonucleotide comprising a sequence selected from the SEQ ID NOS in Table 3.

In certain embodiments, the method includes immunizing a non-human animal genetically engineered to produce human antibodies (eg, a non-human animal for immunization) with a polyribonucleotide disclosed herein. obtaining blood from the non-human animal; purifying the antibody from the non-human animal; formulating the antibody for pharmaceutical use; administering to a human subject).

In certain embodiments, a mammal with a human or humanized immune system is a human (eg, a human subject for immunization).

In certain embodiments, the human or mammal having a humanized immune system is a non-human animal genetically engineered to produce human antibodies, e.g., a non-human animal comprising humanized immunoglobulin loci, e.g., human immunoglobulin An artificial chromosome transgenic cattle containing a human artificial chromosome (HAC) vector containing the locus.

In embodiments, a subject having a coronavirus infection or in need of treatment (e.g., a subject for treatment) is a human subject diagnosed with a coronavirus-related disease, e.g., Covid-19, SARS, MERS. . In certain embodiments, a subject at risk of exposure to coronavirus infection or in need of treatment (e.g., a subject for treatment) is a subject at risk of coronavirus-related disease, e.g., over the age of 50 Immunocompromised humans; humans with chronic health conditions such as obesity, diabetes, cancer; health care workers.

In certain embodiments, administration or immunization is before, after, or concurrent with risk of exposure to coronavirus.

In certain embodiments, the method further comprises monitoring the human subject (eg, the subject for treatment) for the presence of antibodies to coronavirus, eg, before and/or after administration.

Illustrative embodiments of the invention are described in the following enumerated paragraphs.

E1.
a) a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen; or b) a linear polyribonucleotide comprising a sequence selected from any one of SEQ ID NOS: 13, 15 and 12. thing.

E2. An immunogenic composition comprising a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen, wherein the coronavirus antigen is SEQ ID NOS: 1-10, 13, 15, 17, 19, 21, 23, 25-30 at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a coronavirus antigen selected from any one of , 48, and 49 or the cyclic polyribonucleotides are selected from SEQ ID NOs: 12, 14, 16, 18, 20, 22, and 24, at least about 80%, 85%, 90 An immunogenic composition comprising sequences having %, 95%, 97%, 98%, 99% or 100% sequence identity.

E3. further comprising plasma from a non-human animal (e.g., a non-human animal comprising a humanized immune system; e.g., a non-human animal for immunization) or a human subject (e.g., a human subject for immunization), preceding An immunogenic composition according to any one of the embodiments.

E4. An immunogenic composition according to any one of the preceding embodiments, further comprising a coronavirus antigen.

E5. of the preceding embodiment, wherein the composition further comprises a non-human B cell comprising a humanized immunoglobulin locus and a humanized B cell receptor, wherein the humanized B cell receptor binds a coronavirus antigen. An immunogenic composition according to any one of the preceding.

E6. The composition further comprises a plurality of non-human B cells, wherein the plurality of non-human B cells comprises a humanized immunoglobulin locus, wherein the plurality of B cells comprises the first An immunogenic composition according to any one of the preceding embodiments, comprising a first B cell that binds an epitope and a second B cell that binds a second epitope of a coronavirus antigen.

E7. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen is derived from a betacoronavirus or fragment thereof or a sarvecovirus or fragment thereof.

E8. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen is derived from a severe acute respiratory syndrome-associated coronavirus or fragment thereof.

E9. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen is derived from a severe acute respiratory syndrome (SARS) associated coronavirus or fragment thereof.

E10. The coronavirus antigen is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or fragments thereof, severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) or fragments thereof, or Middle East respiratory syndrome coronavirus An immunogenic composition according to any one of the preceding embodiments, which is derived from (MERS-CoV) or a fragment thereof.

E11. The coronavirus antigen is a membrane protein or variant or fragment thereof, a viral envelope protein or variant or fragment thereof, a viral spike protein or variant or fragment thereof, a viral nucleocapsid protein or variant or fragment thereof, a viral accessory An immunogenic composition according to any one of the preceding embodiments which is a protein or variant or fragment thereof.

E12. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen is the receptor binding domain of the spike protein or variant or fragment thereof.

E13. 9. The immunogenic composition of embodiment 8, wherein the spike protein lacks a cleavage site.

E14. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus accessory protein is selected from the group consisting of ORF3a, ORF7a, ORF7b, ORF8, ORF10, or any variant or fragment thereof. .

E15. An immunogenic composition according to any one of the preceding embodiments, wherein the circular polyribonucleotide comprises a plurality of sequences each encoding an antigen, at least one sequence encoding a coronavirus antigen.

E16. An immunogenic composition according to any one of the preceding embodiments, wherein the circular polyribonucleotide comprises two or more ORFs.

E17. An immunogenic composition according to any one of the preceding embodiments, wherein the cyclic polyribonucleotide comprises at least five sequences each encoding an antigen, and wherein at least one antigen is a coronavirus antigen.

E18. An immunogenic composition according to any one of the preceding embodiments, wherein the circular polyribonucleotide comprises at least two ORFs (eg at least 2, 3, 4 or 5).

E19. An immunogenic composition according to any one of the preceding embodiments, wherein the circular polyribonucleotide comprises sequences encoding antigens from at least two different microorganisms, and wherein at least one microorganism is a coronavirus.

E20. An immunogenic composition according to any one of the preceding embodiments, wherein the linear polyribonucleotide comprises sequences encoding two or more antigens, at least one antigen being a coronavirus antigen.

E21. wherein the linear polyribonucleotide comprises sequences encoding at least 2, 3, 4, or 5 antigens, wherein at least one antigen is a coronavirus antigen encoded by the sequence of SEQ ID NO in Table 3. Prior The immunogenic composition of any one of the embodiments.

E22. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen comprises an epitope.

E23. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen comprises an epitope recognized by B cells.

E24. An immunogenic composition according to any one of the preceding embodiments, wherein the coronavirus antigen comprises at least two epitopes.

E25. An immunogenic composition according to any one of the preceding embodiments, further comprising a second circular polyribonucleotide comprising a sequence encoding a second antigen.

E26. An immunogenic composition according to any one of the preceding embodiments, further comprising a second cyclic polyribonucleotide comprising a second ORF.

E27. Immunogenic according to any one of the preceding embodiments, further comprising a third, fourth or fifth cyclic polyribonucleotide comprising a sequence encoding a third, fourth or fifth antigen Composition.

E28. An immunogenic composition according to any one of the preceding embodiments, further comprising a second linear polyribonucleotide comprising a sequence encoding a second antigen.

E29. An immunogenic composition according to any one of the preceding embodiments, further comprising a second linear polyribonucleotide comprising a second ORF.

E30. An immunogen according to any one of the preceding embodiments, further comprising a third, fourth or fifth linear polyribonucleotide comprising a sequence encoding a third, fourth or fifth antigen. sex composition.

E31. An immunogenic composition according to any one of the preceding embodiments, wherein the first antigen, second antigen, third antigen, fourth antigen and fifth antigen are different antigens.

E32. An immunogenic composition according to any one of the preceding embodiments, wherein the immunogenic composition further comprises a pharmaceutically acceptable carrier or excipient.

E33. An immunogenic composition according to any one of the preceding embodiments, wherein the immunogenic composition further comprises a pharmaceutically acceptable excipient and no carrier.

E34. Any one of the preceding embodiments, wherein the cyclic polyribonucleotide, linear polyribonucleotide, or immunogenic composition is formulated with a carrier (e.g., lipid nanoparticles, virus-like particles, or liposomes) An immunogenic composition as described.

E35. An immunogenic composition according to any one of the preceding embodiments, wherein the immunogenic composition further comprises an adjuvant.

E36. 36. The immunogenic composition of embodiment 35, wherein the adjuvant is a saponin or oil emulsion.

E37. 37. The immunogenic composition of embodiment 36, wherein the oil emulsion is a squalene-water emulsion (eg, Addavax™ adjuvant, MF59 or AS03).

E38. An immunogenic composition according to any one of the preceding embodiments, wherein the immunogenic composition further comprises a diluent.

E40. A lipid nanoparticle (LNP) comprising the immunogenic composition according to any one of the preceding embodiments.

E41. 41. The LNP of embodiment 40, comprising ionizable lipids.

E42. 41. The LNP of embodiment 40, comprising cationic lipids.

で表される構造を有する、実施形態４２に記載のＬＮＰ。 E43. cationic lipids

43. The LNP of embodiment 42, having a structure represented by:

E44.One or more neutral lipids, such as DSPC, DPPC, DMPC, DOPC, POPC, DOPE, SM, steroids, such as cholesterol, and/or one or more polymer-conjugated lipids, such as pegylated lipids, For example, the LNP according to any one of embodiments 40-43, further comprising PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer or PEG dialkoxypropyl carbamate.

E45. A method of delivering an immunogenic composition to a non-human animal or human subject (e.g., a non-human animal or human subject for immunization), comprising: a) any one of the preceding embodiments. A method comprising administering an immunogenic composition to a non-human animal or human subject, and b) optionally collecting antibodies against coronavirus antigens from the non-human animal or human subject.

E46. A method of inducing an immune response against coronavirus antigens in a non-human animal or human subject (e.g., for immunization), comprising: a) any one of the preceding embodiments. A method comprising administering an immunogenic composition to a non-human animal or human subject, and b) optionally collecting antibodies against coronavirus antigens from the non-human animal or human subject.

E47. A method according to any one of the preceding embodiments, further comprising administering an adjuvant to the non-human animal or human subject (eg, the non-human animal or human subject for immunization).

E48. 48. The method of embodiment 47, wherein the adjuvant is co-administered with the immunogenic composition, or formulated and administered separately from the immunogenic composition.

E49. Further comprising administering (e.g., predosing or priming) a coronavirus antigen to the non-human animal or human subject (e.g., the non-human animal or human subject for immunization) prior to administration of the immunogenic composition. A method as in any one of the preceding embodiments.

E50. 1-7 days (e.g., 1, 2, 3, 4, 5, 6, or 7 days) prior to administration of the immunogenic composition, a coronavirus antigen is administered to a non-human animal or human subject (e.g., prior to immunization). A method according to any one of the preceding embodiments, further comprising administering to a non-human animal or human subject for the purpose of treatment.

E51. Prior art in which coronavirus antigens were administered as protein formulations, encoded in plasmids (pDNA), displayed in virus-like particles (VLPs), or formulated in lipid nanoparticles (LNPs). The method of any one of the embodiments of.

E52. A method according to any one of the preceding embodiments, further comprising administering the cyclic or linear polyribonucleotide without a carrier.

E53. The method of any one of the preceding embodiments, further comprising formulating the immunogenic composition with a carrier (eg, lipid nanoparticles, virus-like particles, or liposomes).

E54. at least twice (e.g., 2, 3, 4, or 5 times) a non-human animal or human subject (e.g., a non-human animal or human subject for immunization) with a cyclic or linear polyribonucleotide or immunizing with a cyclic or linear polyribonucleotide.

E55. A method according to any one of the preceding embodiments, further comprising collecting plasma from the non-human animal or human subject (eg, the non-human animal or human subject for immunization).

E56. A method according to any one of the preceding embodiments, further comprising purifying the polyclonal antibodies from the plasma of the non-human animal or human subject (eg, the non-human animal or human subject for immunization).

E57. Any one of the preceding embodiments, further comprising administering or immunizing the non-human animal or human subject (e.g., the non-human animal or human subject for immunization) with the vaccine. Method.

E58. 52. The method of embodiment 51, wherein the vaccine is a pneumococcal polysaccharide vaccine (eg PCV13 or PPSV23).

E59. 58. The method of embodiment 57, wherein the vaccine is for bacterial infection.

E60. Any one of the preceding embodiments, wherein the non-human animal or human subject (e.g., non-human animal or human subject for immunization) is immunized with cyclic or linear polyribonucleotides by injection. The method described in .

E61. A method according to any one of the preceding embodiments, wherein the human subject (eg, the human subject for immunization) is at risk for coronavirus-related disease.

E62. the human subject (e.g., the human subject for immunization) is over the age of 50, immunocompromised, has a chronic health condition (e.g., obesity, diabetes, cancer), or is a healthcare worker; A method as in any one of the preceding embodiments.

E63. A method according to any one of the preceding embodiments, wherein the non-human animal (eg, non-human animal subject for immunization) is a domestic animal (eg, pigs, cows, goats, chickens, sheep).

E64. Non-human animals (e.g., non-human animal subjects for immunization) can be pets (e.g., dogs or cats), zoo animals (e.g., felines), mammals (e.g., ungulates (e.g., A method according to any one of the preceding embodiments, wherein the animal is a pig, a cow, a goat, a sheep), a rodent (eg, a rabbit, a rat, a mouse).

E65. A method according to any one of the preceding embodiments, wherein the non-human animal is an artificially transchromosomal non-human animal comprising humanized immunoglobulin loci.

E66. 66. The method of embodiment 65, wherein the non-human animal is an artificially transchromosomal bovine comprising a human artificial chromosome (HAC) vector comprising humanized immunoglobulin loci.

E67. 67. The method of any one of embodiments 65 or 66, wherein the humanized immunoglobulin loci encode immunoglobulin heavy chains.

E68. 68. The method of embodiment 67, wherein the humanized immunoglobulin heavy chain comprises an IgG isotype heavy chain.

E69. 69. The method of any one of embodiments 67 or 68, wherein the humanized immunoglobulin heavy chain comprises an IgG1, IgG2, IgG3, or IgG4 isotype heavy chain.

E70. 70. The method of any one of embodiments 65-69, wherein the humanized immunoglobulin locus encodes an immunoglobulin light chain.

E71. 71. The method of embodiment 70, wherein the immunoglobulin light chain comprises a kappa light chain or a lambda light chain.

E72. A method according to any one of the preceding embodiments, wherein the non-human animal comprises B cells having B cell receptors, and wherein the B cell receptors bind the antigen.

E73. Prior practice wherein the non-human animal comprises a plurality of B cells comprising a first B cell that binds to a first epitope of a coronavirus antigen and a second B cell that binds to a second epitope of a coronavirus antigen A method according to any one of the aspects.

E74. A method according to any one of the preceding embodiments, wherein the non-human animal comprises T cells, wherein the T cells comprise T cell receptors that bind coronavirus antigens.

E75. A method according to any one of the preceding embodiments, wherein after activation the T cells promote the production of antibodies that bind to coronavirus antigens.

E76. A method according to any one of the preceding embodiments, wherein after activation the T cells promote the production of antibodies by B cells that bind to coronavirus antigens.

E77. Any of the preceding embodiments, wherein, following activation, T cells promote survival, proliferation, plasma cell differentiation, somatic hypermutation, immunoglobulin class switching, or combinations thereof of B cells that bind coronavirus antigens. The method described in 1.

E78. Any one of the preceding embodiments, further comprising purifying polyclonal antibodies against coronavirus antigens from the plasma of the non-human animal or human subject (e.g., non-human animal or human subject for immunization). Method.

E79. A method according to any one of the preceding embodiments, wherein the antibody of the polyclonal antibody specifically binds to a coronavirus antigen.

E80. A method according to any one of the preceding embodiments, wherein the antibody of the polyclonal antibody is a humanized antibody or a fully human antibody.

E81. A method according to any one of the preceding embodiments, wherein the antibody of the polyclonal antibody is an IgG IgG, IgA, or IgM isotype antibody.

E82. A method according to any one of the preceding embodiments, wherein the antibody of the polyclonal antibody is an IgG1, IgG2, IgG3, or IgG4 isotype antibody.

E83. A method according to any one of the preceding embodiments, wherein the non-human animal comprises a plurality of polyclonal antibodies that specifically bind to at least two epitopes encoded by cyclic polyribonucleotides.

E84. A method according to any one of the preceding embodiments, wherein the non-human animal comprises a plurality of polyclonal antibodies that specifically bind to at least two epitopes encoded by linear polyribonucleotides.

E85. 83. The method of any one of embodiments 81 or 82, wherein the plurality of polyclonal antibodies comprises humanized antibodies.

E86. 85. The method of any one of embodiments 83 or 84, wherein the plurality of polyclonal antibodies comprises fully human antibodies.

E87. 87. The method of any one of embodiments 83-86, wherein the plurality of polyclonal antibodies comprises IgG antibodies, IgGl antibodies, IgG2 antibodies, IgG3 antibodies, IgG4 antibodies, IgM antibodies, IgA antibodies, or combinations thereof.

E88. 87. The method of any one of embodiments 83-86, wherein the plurality of polyclonal antibodies comprises humanized immunoglobulin loci comprising IgM or IgA isotype heavy chains.

E89. 89. The method of any one of embodiments 83-88, wherein the plurality of polyclonal antibodies comprises humanized immunoglobulin loci encoding immunoglobulin light chains.

E90. 90. The method of embodiment 89, wherein the immunoglobulin light chains comprise kappa light chains or lambda light chains.

E91. Any of the preceding embodiments further comprising drawing blood from the non-human animal or human subject (e.g., for immunization, the non-human animal or human subject) and purifying antibodies to coronavirus antigens from the blood. The method described in 1.

E92. A method of producing a polyclonal antibody preparation against a coronavirus antigen (e.g., an anti-coronavirus antibody preparation), comprising:
a) administering an immunogenic composition according to any one of the preceding embodiments to a non-human animal or human subject (e.g., a non-human animal or human subject for immunization); and b) A method comprising collecting blood or plasma from a non-human animal or human subject.

E93. 93. The method of embodiment 92, wherein the polyclonal antibody formulation is formulated as a pharmaceutical or veterinary composition.

E94. A method of delivering a polyclonal antibody formulation against coronavirus to a subject (e.g., for treatment) with coronavirus infection, wherein the polyclonal antibody formulation according to any one of the preceding embodiments is administered to a subject with coronavirus infection. A method comprising administering to a subject having

E95. A method of delivering a polyclonal antibody formulation to a subject at risk of exposure to coronavirus infection (e.g., a subject for treatment), wherein the polyclonal antibody formulation of any one of the preceding embodiments is administered to a subject at risk of exposure to coronavirus infection. A method comprising administering to a subject at risk of exposure to a viral infection.

E96. A method of prophylaxis or treatment of a subject in need of prophylaxis or treatment against coronavirus infection (e.g., a subject for treatment), comprising administering a polyclonal antibody formulation according to any one of the preceding embodiments to a subject in need thereof. A method comprising administering to a subject.

E97.
a) a non-human animal that has been genetically engineered to produce human antibodies, a cyclic polyribonucleotide according to any one of the preceding embodiments or a linear polyribonucleotide according to any one of the preceding embodiments; immunizing with a ribonucleotide;
b) collecting blood from a non-human animal;
c) purifying the antibody from the non-human animal;
The method of any one of the preceding embodiments, further comprising d) formulating the antibody for pharmaceutical use; and e) administering the formulated antibody to a human subject.

E98. 98. The method of embodiment 97, wherein the non-human animal has a humanized immune system.

E99. 98. The method of embodiment 97, wherein the non-human animal has humanized immunoglobulin loci.

E100. 98. The method of embodiment 97, wherein the non-human animal is an artificially transchromosomal bovine containing a human artificial chromosome (HAC) vector containing human immunoglobulin loci.

E101. A method according to any one of the preceding embodiments, wherein administration or immunization occurs before, after, or at the same time as the subject in need thereof is at risk of exposure to coronavirus.

E102. any one of the preceding embodiments, wherein the subject having a coronavirus infection (e.g., for treatment), at risk of exposure to a coronavirus infection, or in need of treatment is a human subject The method described in .

E103. A human subject (e.g., a human subject for treatment) is over the age of 50, an immunocompromised human, a human with a chronic health condition (e.g., obesity, diabetes, or cancer), or a healthcare professional. 103. The method of aspect 102.

E104. Any one of the preceding embodiments, wherein the subject at risk of exposure to coronavirus infection (e.g., for treatment) or in need of treatment is a human subject at risk for coronavirus-related disease. the method described in Section 1.

E105. A subject with a coronavirus infection (e.g., for treatment), at risk of exposure to a coronavirus infection, or in need of treatment has a coronavirus-related disease (e.g., Covid-19, SARS, MERS) A method according to any one of the preceding embodiments, wherein the human subject is diagnosed with ).

E106. A subject with a coronavirus infection (e.g. for treatment), at risk of exposure to coronavirus infection (e.g. for treatment), or in need of treatment (e.g. for treatment) is a non-human animal subject.

E107. A subject with a coronavirus infection (e.g. for treatment), at risk of exposure to coronavirus infection (e.g. for treatment), or in need of treatment (e.g. for treatment) is a livestock (e.g., cow, pig, sheep, horse, goat), pet (e.g., cat or dog), or zoo animal (e.g., feline) The method described in .

E108. Monitor subjects with coronavirus infection (e.g., subjects for treatment), subjects at risk of exposure to coronavirus infection (e.g., subjects for treatment), or subjects in need of treatment for the presence of polyclonal antibodies A method according to any one of the preceding embodiments, further comprising:

E109. A method according to any one of the preceding embodiments, wherein monitoring occurs before administration of the polyclonal antibody and/or after administration of the polyclonal antibody.

DEFINITIONS The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. The terms described hereinafter are generally to be understood in their ordinary meanings unless otherwise indicated.

As used herein, the terms "circRNA" or "circular polyribonucleotide" or "circular RNA" are used interchangeably and have no free ends (i.e. , free 3′ and/or 5′ ends), eg, polyribonucleotide molecules that form circular or endless structures through covalent or non-covalent bonds.

As used herein, the terms "circRNA preparation", "circular polyribonucleotide preparation", and "circular RNA preparation" are used interchangeably to refer to circular RNA It means a composition comprising a molecule and a diluent, carrier, primary adjuvant, or combination thereof. An "immunogenic" circular RNA formulation is one that, when introduced into an animal, makes the animal's immune system more reactive to the antigen expressed by the circular RNA.

As used herein, the terms "linear RNA," "linear polyribonucleotide," and "linear polyribonucleotide molecule" are used interchangeably and have 5' and 3' ends. A monoribonucleotide molecule or a polyribonucleotide molecule is meant. One or both of the 5' and 3' ends can be free ends or attached to another moiety. In certain embodiments, linear RNAs have 5' or 3' ends that are modified or protected from degradation (e.g., by a 5' or 3' capping agent). In certain embodiments, linear RNAs have 5' or 3' ends that are non-covalently linked. Linear RNA can be used as starting material for circularization by, for example, splint ligation, or chemical, enzymatic, ribozyme- or splicing-catalyzed circularization methods.

As used herein, the terms "linear RNA formulation" and "linear polyribonucleotide formulation" are used interchangeably and refer to a linear RNA molecule and a diluent, carrier, first adjuvant, or combinations thereof. An "immunogenic" linear RNA preparation is one that, when introduced into an animal, makes the animal's immune system more reactive to the antigen expressed by the circular RNA.

As used herein, the term "total ribonucleotide molecule" refers to linear polyribonucleotide molecules, circular polyribonucleotide molecules, monomeric ribonucleotide molecules, other polynucleotide molecules, as measured by the total amount of ribonucleotide molecules. It means the total amount of any ribonucleotide molecule, including ribonucleotide molecules, fragments thereof, and modified forms thereof.

As used herein, the term "fragment" means any portion of a nucleotide molecule that is at least one nucleotide shorter than the nucleotide molecule. For example, the nucleotide molecule can be a linear polyribonucleotide molecule and the fragment can be a monoribonucleotide or any number of contiguous polyribonucleotides that are part of the linear polyribonucleotide molecule. As another example, the nucleotide molecule can be a circular polyribonucleotide molecule and the fragment can be any number of contiguous polyribonucleotides that are part of a polyribonucleotide or circular polyribonucleotide molecule. A fragment of a nucleotide molecule comprises at least 10 nucleic acid residues, such as at least 20 nucleic acid residues, at least 50 nucleic acid residues, and at least 100 nucleic acid residues. A fragment also refers to any portion of a polypeptide molecule that is at least one peptide shorter than the polypeptide molecule. For example, a fragment of a polypeptide can be any number of contiguous amino acids that are part of the polypeptide or full-length polypeptide molecule. A fragment of a polypeptide comprises at least 5 amino acid residues, eg, at least 10 amino acid residues, at least 20 amino acid residues, at least 50 amino acid residues, at least 100 amino acid residues.

As used herein, the term "expressed sequence" is a nucleic acid sequence that encodes a product, eg, a peptide or polypeptide, or regulatory nucleic acid. An exemplary expressed sequence that encodes a peptide or polypeptide can include multiple nucleotide triplets, each of which can encode an amino acid, called a "codon."

As used herein, the term "modified ribonucleotide" is a nucleotide with at least one modification to the sugar, nucleobase, or internucleoside linkage.

As used herein, the phrase "pseudohelical structure" is a conformation of a cyclic polyribonucleotide, wherein at least a portion of the cyclic polyribonucleotide is folded into a helical structure.

As used herein, the phrase "pseudo-duplex secondary structure" is the conformation of a circular polyribonucleotide, wherein at least a portion of the circular polyribonucleotide comprises an internal double strand. Form.

As used herein, the term "regulatory element" is a moiety, such as a nucleic acid sequence, that regulates expression of an expressed sequence within a circular polyribonucleotide.

As used herein, the term "repetitive nucleotide sequence" is a repetitive nucleic acid sequence within a stretch of DNA or RNA or throughout the genome. In certain embodiments, the repetitive nucleotide sequence comprises poly CA or poly TG (UG) sequences. In certain embodiments, the repeated nucleotide sequence comprises repeated sequences in the Alu family of introns.

As used herein, the term "replication element" is a sequence and/or motif that is useful for replication or initiates transcription of a circular polyribonucleotide.

As used herein, the term "stagger element" is a portion, such as a nucleotide sequence, that induces ribosome pausing during translation. In certain embodiments, the staggered element is a non-conserved sequence of amino acids with a strong alpha-helical propensity followed by the consensus sequence -D(V/I)ExNPG P, where x = any amino acid. In certain embodiments, stagger elements can include chemical moieties such as glycerol, non-nucleic acid linking moieties, chemical modifications, modified nucleic acids, or any combination thereof.

As used herein, the term "substantially resistant" means at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% resistance to effectors.

As used herein, the term "stoichiometric translation" is the substantially equivalent production of translated expression products from cyclic polyribonucleotides. For example, for a circular polyribonucleotide having two expressed sequences, stoichiometric translation of the circular polyribonucleotide requires that the expression products of the two expressed sequences have substantially equal amounts, e.g. is about 0 or 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, or less than 20%, or any percentage therebetween.

As used herein, the term "translation initiation sequence" is a nucleic acid sequence that initiates translation of an expressed sequence in a circular polyribonucleotide.

As used herein, the term "termination element" is a moiety, such as a nucleic acid sequence, that terminates translation of an expressed sequence in a circular polyribonucleotide.

As used herein, the term "translation efficiency" is the rate or amount of protein or peptide production from ribonucleotide transcripts. In certain embodiments, the translation efficiency is measured, e.g., in a given translation system, e.g., in an in vitro translation system such as rabbit reticulocyte lysate, or in an in vivo translation system such as a eukaryotic or prokaryotic cell, e.g. It can be expressed as the amount of protein or peptide produced per given amount of transcript encoding the protein or peptide in a period of .

As used herein, the term "cyclization efficiency" is a measure of the resulting circular polyribonucleotide compared to its non-circular starting material.

As used herein, the term "adaptive immune response" means either a humoral or a cell-mediated immune response. Humoral immune responses (also called antibody immune responses) are mediated by B lymphocytes that release antibodies that specifically bind antigens. A cell-mediated immune response (also called a cell-mediated immune response) involves the binding of cytotoxic T lymphocytes (CTLs) to foreign or infected cells, followed by mobilization of these cells.

As used herein, the term "adjuvant" refers to a compound that enhances or otherwise alters or modifies the resulting immune response when used in combination with a circular RNA molecule. Modification of the immune response includes enhancing or broadening the specificity of either or both antibody and cell-mediated immune responses. Modification of the immune response can also mean reducing or suppressing a particular antigen-specific immune response.

As used herein, the terms "human antibody," "human immunoglobulin," and "human polyclonal antibody" are used interchangeably to refer to antibodies produced in humans vaccinated with the same circular RNA formulation. means one or more antibodies produced in a non-human animal that are indistinguishable from This is in contrast to "humanized antibodies" which have been modified, such as by producing chimeras, to have human characteristics, but which retain the attributes of the host animal in which they are produced. Because human antibodies generated according to the methods disclosed herein are composed of IgG that is entirely human, no enzymatic treatment is required to eliminate the risk of anaphylaxis and serum sickness associated with xenogeneic IgG.

As used herein, the term "linear equivalent" refers to a nucleotide sequence that is the same as or similar to a circular polyribonucleotide (e.g., 100%, 95%, 90%, 85%, 80%, 75% %, or any percentage sequence similarity therebetween) and having two free ends (i.e., non-circularized forms of circularized polyribonucleotides (and Its fragment)). In certain embodiments, the linear equivalent (e.g., pre-circularized form) has the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%) as the circular polyribonucleotide. %, or any percentage sequence similarity therebetween) and having the same or similar nucleic acid modifications and having two free ends (i.e., circularized polyribonucleotide molecules (and fragments thereof) (and fragments thereof)). In certain embodiments, the linear equivalent has the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any in between) to the circular polyribonucleotide. percentage of sequence similarity) and polyribonucleotide molecules (and fragments thereof) with different or no nucleic acid modifications and with two free ends (i.e., non-circularization of circularized polyribonucleotides morphology (and its fragments)). In certain embodiments, a fragment of a linear equivalent polyribonucleotide molecule is any portion of a linear equivalent polyribonucleotide molecule that is shorter than the linear equivalent polyribonucleotide molecule. In some embodiments, the linear equivalent further comprises a 5' cap. In certain embodiments, the linear equivalent further comprises a polyadenosine tail. In some embodiments, the linear equivalent further comprises a 3'UTR. In some embodiments, the linear equivalent further comprises a 5'UTR.

As used herein, the term "carrier" refers to a composition (e.g., means a compound, composition, reagent, or molecule that facilitates the transport or delivery of a cyclic polyribonucleotide). Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), nanoparticles (e.g., lipid nanoparticles encapsulating or covalently attached to cyclic polyribonucleotides i.e. nanoparticles such as LNPs), liposomes, fusosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently attached to cyclic polyribonucleotides), or cationic carriers (e.g., cationic lipopolymers or transfectants). injection reagent).

As used herein, the terms "naked", "naked delivery" and their cognates use no carrier and have covalent modifications to moieties that aid in delivery to cells. not a formulation for delivery to a cell. Naked delivery formulations do not include any transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. For example, a naked delivery formulation of cyclic polyribonucleotides is a formulation comprising cyclic polyribonucleotides without covalent modifications and no carrier. Naked delivery formulations may include non-carrier pharmaceutical excipients or diluents.

The term "diluent" means a vehicle comprising an inert solvent in which a composition described herein (eg, a composition comprising cyclic polyribonucleotides) can be diluted or dissolved. Diluents can be RNA solubilizing agents, buffers, tonicity agents, or mixtures thereof. The diluent can be a liquid diluent or a solid diluent. Non-limiting examples of liquid diluents include water or other solvents, solubilizers and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 - butylene glycol, dimethylformamide, oils (especially cottonseed, peanut, corn, germ, olive, castor and sesame), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan, and 1,3 - butanediol. Non-limiting examples of solid diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium lactose phosphate, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol. , sorbitol, inositol, sodium chloride, dry starch, corn starch, or powdered sugar.

As used herein, a "subject for immunization" refers to an immunogenic composition (e.g., a composition comprising a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen or a sequence in Table 3). A composition comprising a linear polyribonucleotide comprising a sequence selected from numbers). The subject for immunization can be a non-human animal ("non-human animal subject for immunization") (e.g., farm animals, pets, zoo animals, etc.) or a human subject ("human subject for immunization"). is.

As used herein, a "subject for treatment" is administered a polyclonal antibody against coronavirus (e.g., a polyclonal antibody formulation against coronavirus) as a prophylactic treatment or to treat a coronavirus infection. It is subject to be Prophylactic treatment is recommended for subjects at risk of exposure to coronavirus (e.g., health care workers) or subjects at risk of coronavirus-associated disease (e.g., persons over the age of 50; immunocompromised persons; obesity, diabetes, administration of polyclonal antibodies against coronavirus to humans with chronic health conditions such as cancer). The subject for immunization is a non-human animal (“non-human animal therapeutic subject”) (e.g., farm animals, pets, zoo animals, etc.) or a human subject (“human subject for therapeutic treatment”). .

As used herein, a "variant" has at least one alteration, e.g., substitution, insertion, deletion, and/or substitution, insertion, deletion, and/or at one or more residue positions, as compared to a parent or wild-type polypeptide. Or refers to a polypeptide containing a fusion. A variant may contain 1-10, 10-20, 20-50, 50-100, or more modifications.

INCORPORATION BY REFERENCE All publications, patents and patent applications mentioned in this specification are indicated that each individual publication, patent or patent application is specifically and individually incorporated by reference. are incorporated herein by reference to the same extent.

The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention can be obtained by reference to the following detailed description and accompanying drawings, which set forth illustrative embodiments in which the principles of the invention are employed.

Exemplary cyclic polyribonucleotides comprising sequences encoding coronavirus antigens (eg, spike protein, receptor binding domain (RBD) protein of spike protein) are shown. FIG. 1 shows a schematic for the generation of human polyclonal antibodies that bind to coronavirus antigens administered to human subjects. Circular RNA-encoded RBD antigen was detected in BJ fibroblasts and HeLa cells and not in BJ fibroblasts and HeLa cells in the vehicle control. We show that sustained anti-RBD antibody responses were obtained in a mouse model following administration of circular RNA encoding the SARS-CoV-2 RBD antigen formulated with a cationic polymer (eg, protamine). We show that anti-spike responses were obtained in a mouse model following administration of circular RNA encoding the SARS-CoV-2 RBD antigen formulated with a cationic polymer (eg, protamine). Anti-RBD IgG2a and IgG1 isotype levels obtained after administration of circular RNA encoding the SARS-CoV-2 RBD antigen formulated with a cationic polymer (eg, protamine) in a mouse model. Protein expression from circular RNA in vivo over time in circular RNA formulations (Trans-IT formulated, protamine formulated, unformulated), following intramuscular injection of protamine vehicle only, and uninjected control mice is shown. Addavax with (i) unformulated circular RNA formulation (left graph), (ii) circular RNA formulated with TransIT (middle graph), and (iii) circular RNA formulated with protamine (right graph). FIG. 3 shows protein expression from circular RNA in vivo over time after co-delivery of TM adjuvant intramuscularly. In each case, Addavax™ adjuvant was delivered as individual injections at 0 and 24 hours. (i) circular RNA formulated with protamine, (ii) circular RNA formulated with protamine with injection of Addavax™ adjuvant at 24 hours, (iii) after intradermal delivery of protamine vehicle alone. and (iv) protein expression from circular RNA in vivo over time in non-injected control mice. Schematic representation of an exemplary circular RNA comprising two expressed sequences, where each expressed sequence encodes an antigen and one or both expressed sequences encode a coronavirus antigen. The circular RNA contains two open reading frames (ORFs), each ORF encoding an expressed sequence, where each ORF is operably linked to an IRES. Schematic representation of an exemplary circular RNA comprising two expressed sequences, where each expressed sequence is an antigen and one or both expressed sequences encode a coronavirus antigen. The circular RNA contains two expressed sequences separated by a 2A sequence, all operably linked to an IRES. FIG. 1 shows a schematic representation of a plurality of polyribonucleotides, where each polynucleotide comprises an antigen-encoding ORF, and one or both ORFs encode a coronavirus antigen. Multiple antigen expression from circular polyribonucleotides is shown. RBD antigen expression was detected from circular RNAs encoding SARSs-CoV-2 RBD antigen and GLuc polypeptides. Multiple antigen expression from circular polyribonucleotides is shown. GLuc activity was detected from circular RNA encoding SARSs-CoV-2 RBD antigen and GLuc polypeptide. Immunogenicity of multiple antigens from circular RNA in a mouse model. Mice were inoculated with a first circular RNA encoding a SARS-CoV-2 RBD antigen and a second circular RNA encoding a GLuc polypeptide. Anti-RBD antibodies were obtained at 17 days post-injection. Immunogenicity of multiple antigens from circular RNA in a mouse model. Mice were inoculated with a first circular RNA encoding a SARS-CoV-2 RBD antigen and a second circular RNA encoding a GLuc polypeptide. GLuc activity was detected at 2 days after injection. Immunogenicity of multiple antigens from circular RNA in a mouse model. Mice were inoculated with a first circular RNA encoding SARS-CoV-2 RBD antigen and a second circular RNA encoding influenza hemagglutinin (HA) antigen. Anti-RBD antibodies were obtained at 17 days post-injection. Immunogenicity of multiple antigens from circular RNA in a mouse model. Mice were inoculated with a first circular RNA encoding SARS-CoV-2 RBD antigen and a second circular RNA encoding influenza hemagglutinin (HA) antigen. Anti-HA antibodies were obtained at 17 days after injection. Immunogenicity of multiple antigens from circular RNA in a mouse model. Mice were inoculated with a first circular RNA encoding the SARS-CoV-2 spike antigen and a second circular RNA encoding the influenza hemagglutinin (HA) antigen. Anti-RBD (spike domain) antibodies were obtained at 17 days post-injection. Immunogenicity of multiple antigens from circular RNA in a mouse model. Mice were inoculated with a first circular RNA encoding the SARS-CoV-2 spike antigen and a second circular RNA encoding the influenza hemagglutinin (HA) antigen. Anti-HA antibodies were obtained at 17 days after injection. Demonstrate anti-HA antibody responses in mice administered circular RNAs encoding multiple antigens. Mice were challenged with SARS-CoV-2 RBD antigen, SARS-CoV-2 spike antigen, influenza HA antigen, SARS-CoV-2 RBD antigen and influenza HA antigen, SARS-CoV-2 RBD antigen and GLuc polypeptide, or SARS- Circular RNAs encoding CoV-2 RBD antigen and SARS-CoV-2 spike antigen were administered. Anti-influenza HA antibodies were measured using a hemagglutination inhibition assay (HAI). Figure 24 shows HAI potency in samples administered circular RNA formulations encoding influenza HA antigens when administered alone or in combination with SARS-CoV-2 antigens such as RBD or spikes. value.

The present disclosure generally provides cyclic polyribonucleotides comprising sequences encoding antigens and/or epitopes from coronaviruses, immunogenic compositions comprising cyclic polyribonucleotides encoding coronavirus antigens and/or epitopes, and coronaviruses. A method for producing a composition comprising cyclic polyribonucleotides encoding viral antigens and/or epitopes and cyclic polyribonucleotides encoding coronavirus antigens and/or epitopes. In certain embodiments, cyclic polyribonucleotides and/or immunogenic compositions are administered to a subject or sequences encoding coronavirus antigens and/or epitopes. and/or an immunogenic composition comprising cyclic polyribonucleotides, in a method of generating an immune response against antigens and/or epitopes from a coronavirus. A subject (eg, for immunization) can be a mammal, such as an ungulate. A subject for immunization can be a human. In certain embodiments, the subject for immunization is a non-human animal with a humanized immune system.

The present disclosure also generally provides linear polyribonucleotides comprising sequences encoding antigens and/or epitopes from coronaviruses, immunogenic compositions comprising linear polyribonucleotides encoding coronavirus antigens and/or epitopes and methods for producing linear polyribonucleotides encoding coronavirus antigens and/or epitopes and compositions comprising linear polyribonucleotides encoding coronavirus antigens and/or epitopes. In certain embodiments, the linear polyribonucleotide and/or immunogenic composition encodes a coronavirus antigen and/or epitope when the linear polyribonucleotide and/or immunogenic composition is administered to a subject. in a method of generating an immune response against antigens and/or epitopes from a coronavirus by immunizing a subject with a linear polyribonucleotide comprising a sequence and/or an immunogenic composition comprising a linear polyribonucleotide used. A subject (eg, for immunization) can be a mammal, such as an ungulate. A subject for immunization can be a human. In certain embodiments, the subject for immunization is a non-human animal with a humanized immune system.

The present disclosure also generally describes methods of generating or producing polyclonal antibodies that bind to antigens and/or epitopes from coronaviruses in a subject using the cyclic polyribonucleotides or immunogenic compositions described herein. Regarding. In certain embodiments, the subject for immunization is human. In certain embodiments, the subject for immunization is a non-human animal (eg, an ungulate). In certain embodiments, the non-human animal has a humanized immune system. In certain embodiments, immunogenic compositions comprising cyclic polyribonucleotides encoding antigens and/or epitopes from coronavirus and/or cyclic polyribonucleotides encoding coronavirus antigens and/or epitopes are humanized It is administered to a non-human animal having an immune system, thereby stimulating the production of human polyclonal antibodies that bind antigens and/or epitopes from the coronavirus.

The present disclosure also generally uses the linear polyribonucleotides or immunogenic compositions described herein to generate or generate polyclonal antibodies that bind to antigens and/or epitopes from coronaviruses in a subject. Regarding the method. In certain embodiments, the subject for immunization is human. In certain embodiments, the subject for immunization is a non-human animal (eg, an ungulate). In one embodiment, an immunogenic composition comprising linear polyribonucleotides encoding antigens and/or epitopes from a coronavirus and/or linear polyribonucleotides encoding coronavirus antigens and/or epitopes is a human administered to a non-human animal with an enhanced immune system, thereby stimulating the production of human polyclonal antibodies that bind antigens and/or epitopes from the coronavirus.

In a further embodiment, the polyclonal antibodies produced are purified. Purified polyclonal antibodies are suitable for use as prophylactics against coronaviruses or as treatments for coronavirus infections. Purified polyclonal antibodies can be administered to a subject for immunization. A schematic example of the method described herein is shown in FIG.

Circular Polyribonucleotides The cyclic polyribonucleotides disclosed herein comprise sequences encoding antigens and/or epitopes from coronaviruses. This circular polyribonucleotide expresses sequences encoding antigens and/or epitopes from a coronavirus in a subject (eg, a subject for immunization). In certain embodiments, cyclic polyribonucleotides comprising coronavirus antigens and/or epitopes are used to generate an immune response in a subject (eg, a subject for immunization). In certain embodiments, cyclic polyribonucleotides comprising coronavirus antigens and/or epitopes are used to generate the polyclonal antibodies described herein.

Coronavirus Antigens and Epitopes Cyclic polyribonucleotides comprise sequences encoding coronavirus antigens or epitopes. Antigens and/or epitopes disclosed herein are associated with coronaviruses. In certain embodiments, the antigens and/or epitopes are expressed by a coronavirus or are derived from antigens and/or epitopes expressed by a coronavirus.

An antigen is a molecule that contains one or more epitopes (either linear, conformational, or both) that elicit an adaptive immune response in a subject (eg, a subject for immunization). An epitope can be that part of an antigen that is recognized, targeted, or bound by a given antibody or T-cell receptor. An epitope can be a linear epitope, eg, a contiguous sequence of amino acids. The epitope can be a conformational epitope, eg, an epitope containing amino acids that form an epitope in the folded conformation of a protein. A conformational epitope may contain non-contiguous amino acids from the primary amino acid sequence. Ordinarily, an epitope will comprise about 3-15, generally about 5-15, amino acids. B-cell epitopes are usually about 5 amino acids, but can be as long as 3-4 amino acids. A T-cell epitope, such as a CTL epitope, will include at least about 7-9 amino acids, and a helper T-cell epitope will include at least about 12-20 amino acids. Usually an epitope will comprise about 7-15 amino acids, eg 9, 10, 12 or 15 amino acids.

Coronavirus antigens or epitopes may be proteins, peptides, glycoproteins, lipoproteins, phosphoproteins, ribonucleoproteins, carbohydrates (e.g. polysaccharides), lipids (e.g. phospholipids or triglycerides), or nucleic acids (e.g. DNA, RNA). or may include all or part thereof.

Coronavirus antigens or epitopes can include protein antigens or epitopes (eg, peptide antigens or peptide epitopes from proteins, glycoproteins, lipoproteins, phosphoproteins, or ribonucleoproteins). Antigens or epitopes can include amino acids, sugars, lipids, phosphoryl, or sulfonyl groups, or combinations thereof.

A coronavirus protein antigen or epitope may comprise post-translational modifications such as glycosylation, ubiquitination, phosphorylation, nitrosylation, methylation, acetylation, amidation, hydroxylation, sulfation, or lipidation.

In certain embodiments, the coronavirus is a pathogenic coronavirus. In certain embodiments, the coronavirus is a respiratory pathogen. In certain embodiments, the coronavirus is a blood-borne pathogen. In certain embodiments, the coronavirus is an enteric pathogen.

Non-limiting examples of coronaviruses of the present disclosure include severe acute respiratory syndrome-associated coronavirus (SARS-CoV, e.g., SARS-CoV-1, SARS-CoV-2), Middle East respiratory syndrome coronavirus (MERS -CoV), bat coronaviruses, zoonotic coronaviruses that can infect humans or other animals, novel or newly discovered coronaviruses, and other coronaviruses.

In certain embodiments, the cyclic polyribonucleotide comprises severe acute respiratory syndrome-associated coronavirus (SARS-CoV) antigens and/or epitopes. In some embodiments, the cyclic polyribonucleotide comprises SARS-CoV-1 antigens and/or epitopes. In some embodiments, the cyclic polyribonucleotide comprises SARS-CoV-2 antigens and/or epitopes. In certain embodiments, the cyclic polyribonucleotide comprises Middle East respiratory syndrome coronavirus (MERS-CoV) antigens and/or epitopes. In certain embodiments, the cyclic polyribonucleotides comprise zoonotic coronavirus antigens and/or epitopes capable of infecting humans or other animals. In some embodiments, the cyclic polyribonucleotide comprises antigens and/or epitopes from a novel coronavirus.

In certain embodiments, the cyclic polyribonucleotide comprises a Coronaviridae antigen and/or epitope.

In certain embodiments, the cyclic polyribonucleotide is isolated from Alphacoronavirus, Betacoronavirus, Gammacoronavirus, Deltacoronavirus, Merbecovirus ), or the genus or subgenus that is Sarbecovirus. In certain embodiments, the cyclic polyribonucleotides comprise betacoronavirus antigens and/or epitopes. In certain embodiments, the cyclic polyribonucleotide comprises sarvecovirus antigens and/or epitopes. In certain embodiments, the cyclic polyribonucleotide comprises Merbecovirus antigens and/or epitopes.

In certain embodiments, the cyclic polyribonucleotide comprises sequences for antigens from coronaviruses, which are biosafety level 2 (BSL-2) pathogens. In some embodiments, the cyclic polyribonucleotide comprises a sequence from the biosafety level 3 (BSL-3) pathogen coronavirus. In certain embodiments, the coronavirus is a Biosafety Level 4 Pathogen (BSL-4). In certain embodiments, there are no approved drugs (eg, antivirals or antibiotics) available to treat coronavirus infections from which antigens expressed by cyclic polyribonucleotides are derived. In certain embodiments, there are no licensed vaccines available to prevent or reduce the risk of infection from coronaviruses from which antigens expressed by cyclic polyribonucleotides are derived.

The antigen and/or epitope is a coronavirus surface protein, a coronavirus membrane protein, a coronavirus envelope protein, a coronavirus capsid protein, a coronavirus nucleocapsid protein, a coronavirus spike protein, a coronavirus receptor binding domain (RBD) of the spike protein, coronavirus entry protein, coronavirus membrane fusion protein, coronavirus structural protein, coronavirus nonstructural protein, coronavirus regulatory protein, coronavirus accessory protein, secreted coronavirus protein, coronavirus polymerase protein, coronavirus RNA polymerase, coronavirus protease , a coronavirus glycoprotein, a coronavirus fusion, a coronavirus helical capsid protein, a coronavirus icosahedral capsid protein, a coronavirus substrate protein, a coronavirus replicase, a coronavirus transcription factor, or a coronavirus enzyme.

Antigens and/or epitopes from various coronaviruses are expressed by cyclic polyribonucleotides. In some cases, the antigens and/or epitopes are associated with or expressed by one of the coronaviruses disclosed herein. In certain embodiments, the antigens and/or epitopes are associated with or expressed by more than one coronavirus disclosed herein.

In some cases, two or more coronaviruses are phenotypically related. For example, the compositions and methods of the present disclosure can be used to treat two or more coronaviruses that are respiratory pathogens, two or more coronaviruses that are associated with severe disease, harmful viruses in immunocompromised subjects (e.g., subjects for immunization). ≥ 2 coronaviruses associated with outcome, ≥ 2 coronaviruses associated with acute respiratory distress syndrome (ARDS), ≥ 2 coronaviruses associated with severe acute respiratory syndrome (SARS), Middle East respiratory syndrome Antigens and/or epitopes from two or more coronaviruses associated with (MERS), or combinations thereof, may be used.

cyclic polyribonucleotides are, for example, It may comprise or encode at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or more antigens and/or epitopes from a coronavirus.

In some embodiments, the cyclic polyribonucleotide is 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, 20 or less, 25 or less, 30 or less, contains or encodes 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, or less antigens and/or epitopes from a coronavirus.

In some embodiments, the cyclic polyribonucleotide is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, Contains or encodes antigens and/or epitopes from 90 or 100 coronaviruses.

In certain embodiments, the antigen and/or epitope is a coronavirus, eg, severe acute respiratory syndrome-associated coronavirus (SARS-CoV, eg, SARS-CoV-1, SARS-CoV-2), Middle East respiratory syndrome coronavirus derived from a virus (MERS-CoV), or another coronavirus. In certain embodiments, the antigens and/or epitopes of this disclosure are derived from predicted open reading frames from the coronavirus genome.

The novel SARS isolate has 99%, 98%, 97%, 95%, 92%, 90% of the polynucleotide sequence of the specific genomic region of the novel virus with the polynucleotide sequence of the specific genomic region of the known SARS virus. It can be identified by a percent homology of %, 85%, or 80% homology. Furthermore, the novel SARS isolate has 99% of the polypeptide sequences encoded by the novel SARS virus specific genomic region polynucleotides relative to the polypeptide sequences encoded by the known SARS virus specific region polynucleotides; Identifiers can be identified by homology percentages of 98%, 97%, 95%, 92%, 90%, 85%, or 80% homology. These genomic regions include regions that are typically common among many coronaviruses (e.g., gene products or ORFs), as well as group-specific regions (e.g., antigenic groups), such as those readily available to those skilled in the art of virology. 5′ untranslated region (UTR), leader sequence, ORF1a, ORF1b, nonstructural protein 2 (NS2), hemagglutinin-esterase glycoprotein ( HE) (also called E3), spike glycoprotein (S) (also called E2), ORF3a, ORF3b, nonstructural protein 4 (NS4), envelope (small membrane) protein (E) (also called sM), membrane glycoproteins (M) (also called E1), ORF5a, ORF5b, nucleocapsidrin protein (N), ORF6, ORF7a, ORF7b, ORF8, ORF8a, ORF8b, ORF9a, ORF9b, ORF10, intergenic sequence, receptor binding domain of spike protein ( RBD), 3′UTR, or RNA-dependent RNA polymerase (pol). A SARS virus may have identifiable genomic regions, including one or more of the above-identified genomic regions. SARS virus antigens include proteins encoded by any one of these genomic regions. SARS virus antigens can be proteins or fragments thereof that are highly conserved with coronaviruses. A SARS virus antigen may be a protein or fragment thereof specific to the SARS virus (compared to known coronaviruses).

In certain embodiments, antigens and/or epitopes of the present disclosure are derived from predicted transcripts from the SARS-CoV genome. In certain embodiments, the antigens and/or epitopes of this disclosure are derived from proteins encoded by open reading frames from the SARS-CoV genome. Non-limiting examples of open reading frames in the SARS-CoV genome are ORF1a, ORF1b, spike (S), ORF3a, ORF3b, envelope (E), membrane (M), ORF6, ORF7a, ORF7b, ORF8, ORF8a, ORF8b , ORF9a, ORF9b, nucleocapsid (N), and ORF10.

ORF1a and ORF1b encode 16 nonstructural proteins (nsps), e.g. do. Nonstructural proteins contribute, for example, to viral replication, viral assembly, immune response regulation, or a combination thereof. In certain embodiments, the antigen is a nonstructural protein or an antigenic sequence encoding a nonstructural protein. In certain embodiments, the epitope is derived from a coronavirus nonstructural protein.

The spike (S) encodes a spike protein, which in certain embodiments is responsible for binding to a host cell receptor, fusion of the virus with the host cell membrane, entry of the virus into the host cell, or combinations thereof. contribute. A spike protein can be an antigen. In certain embodiments, the epitopes of this disclosure are derived from the spike protein. In certain embodiments, an epitope of the disclosure comprises the receptor binding domain of a spike protein. In certain embodiments, an epitope of the disclosure comprises the ACE2 binding domain of the spike protein.

Envelope (E) encodes envelope proteins, which in certain embodiments contribute to viral assembly and morphogenesis. An envelope protein can be an antigen. In certain embodiments, the epitopes of this disclosure are derived from the coronavirus envelope protein.

Membrane (M) encodes membrane proteins, which in certain embodiments contribute to viral assembly. A membrane protein can be an antigen. In certain embodiments, the epitopes of the present disclosure are derived from coronavirus membrane proteins.

The nucleocapsid (N) encodes a nucleocapsid protein, which in certain embodiments can complex with genomic RNA, contribute to viral assembly, and/or interact with the M protein. A nucleocapsid protein can be an antigen. In certain embodiments, the epitopes of this disclosure are derived from the coronavirus nucleocapsid protein.

ORF3a, ORF3b, ORF6, ORF7a, ORF7b, ORF8, ORF8a, ORF8b, ORF9a, ORF9b, and ORF10 encode accessory proteins. In certain embodiments, accessory proteins may modulate host cell signaling, modulate host cell immune responses, may be incorporated into mature virions as minor structural proteins, or combinations thereof. Accessory proteins can be antigens. In certain embodiments, the epitopes of this disclosure are derived from coronavirus accessory proteins.

The compositions and methods of the present disclosure may employ antigens and/or epitopes encoded by or derived from one or more open reading frames of the SARS-CoV genome. For example, antigens and/or epitopes are ORF1a, ORF1b, spike (S), ORF3a, ORF3b, envelope (E), membrane (M), ORF6, ORF7a, ORF7b, ORF8, ORF8a, ORF8b, ORF9a, ORF9b, nucleocapsid ( N), ORF10, or any combination thereof.

In certain embodiments, the epitopes of this disclosure are derived from the spike protein. In certain embodiments, epitopes of the disclosure comprise the receptor binding domain (RBD) of the spike protein. In certain embodiments, an epitope of the disclosure comprises the ACE2 binding domain of the spike protein. In certain embodiments, epitopes of the disclosure comprise the S1 subunit spike protein, the S2 subunit of the spike protein, or combinations thereof. In certain embodiments, epitopes of the disclosure comprise the extracellular domain of spike protein. In certain embodiments, epitopes of the disclosure include Gln498, Thr500, Asn501, or combinations thereof from the coronavirus spike protein. In certain embodiments, epitopes of the disclosure include Lys417, Tyr453, or a combination thereof from the coronavirus spike protein. In certain embodiments, epitopes of the disclosure comprise Gln474, Phe486, or a combination thereof from the coronavirus spike protein. In certain embodiments, the epitope of the present disclosure comprises 1 equivalent or more amino acids from Gln498, Thr500, Asn501, Lys417, Tyr453, Gln474, Phe486 from the coronavirus spike protein, spike protein mutants or derivatives, or combinations thereof. include. In certain embodiments, spike proteins of the present disclosure comprise a D614G mutation, ie, have the amino acid glycine (G) at position 614 instead of aspartic acid (D). In certain embodiments, epitopes of the present disclosure include Gly614 from spike protein mutants or derivatives from coronavirus spike protein, or combinations thereof. In some cases, the D614G mutation may result in decreased S1 shedding and increased infectivity of coronaviruses.

In certain embodiments, the antigen and/or epitope is encoded by or derived from ORF1a. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF1b. In certain embodiments, antigens and/or epitopes are encoded by or derived from the SARS-CoV spike. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF3a. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF3b. In certain embodiments, the antigens and/or epitopes are encoded by or derived from the SARS-CoV envelope (E). In certain embodiments, the antigens and/or epitopes are encoded by or derived from the SARS-CoV membrane (M). In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF6. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF7a. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF7b. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF8. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF8a. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF9a. In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF9b. In certain embodiments, the antigen and/or epitope is encoded by or derived from the SARS-CoV nucleocapsid (N). In certain embodiments, the antigen and/or epitope is encoded by or derived from SARS-CoV ORF10. In certain embodiments, antigens and/or epitopes are encoded by or derived from the SARS-CoV spike (S), envelope (E), membrane (M), and nucleocapsid (N).

In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF1a. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF1b. In certain embodiments, antigens and/or epitopes are not encoded by or derived from the SARS-CoV spike. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF3a. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF3b. In certain embodiments, the antigen and/or epitope is not encoded by or derived from the SARS-CoV envelope (E). In certain embodiments, the antigens and/or epitopes are not encoded by or derived from the SARS-CoV membrane (M). In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF6. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF7a. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF7b. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF8. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF8a. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF9a. In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF9b. In certain embodiments, the antigen and/or epitope is not encoded by or derived from the SARS-CoV nucleocapsid (N). In certain embodiments, the antigen and/or epitope is not encoded by or derived from SARS-CoV ORF10. In certain embodiments, the antigens and/or epitopes are not encoded by or derived from the SARS-CoV spike (S), envelope (E), membrane (M), and nucleocapsid (N).

Antigens and/or epitopes may be encoded by or derived from SARS-CoV2.

A non-limiting example of the SARS-CoV-2 genome is provided in DB Source accession MN908947.3, Complete Genome Sequence of Severe Acute Respiratory Syndrome Coronavirus 2 Isolate, the entire contents of which are incorporated herein by reference. be done. DB Source accession MN908947.3:21563-25384 corresponds to the S protein and is hereby incorporated by reference in its entirety. A non-limiting example of a SARS-CoV-2 spike protein is provided in GenBank sequence: QHD43416.1, Sequence of Spike Protein of Severe Acute Respiratory Syndrome Coronavirus 2 Isolate, the entire contents of which are herein incorporated by reference. Incorporated into

A non-limiting example of the SARS-CoV-2 genome is provided in sequence NCBI Reference Sequence Accession No. NC_045512, version NC_045512.2, complete genome sequence of severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, The entire contents of which are incorporated herein by reference.

A non-limiting example of the SARS-CoV-2 genome is provided in sequence NCBI Reference Sequence Accession No. MW450666, complete genome sequence of severe acute respiratory syndrome coronavirus 2 isolate, the entire contents of which are incorporated herein by reference. Incorporated.

A non-limiting example of a SARS-CoV-2 genome is sequence NCBI Reference Sequence Accession No. MW487270, severe acute respiratory syndrome coronavirus strain 2 B. 1.1.7 virus, the entire contents of which are incorporated herein by reference.

A non-limiting example of the SARS-CoV-2 genome is sequence GISAID Reference Sequence Accession No. EPI_ISL_792683, severe acute respiratory syndrome coronavirus strain 2 P. 1 virus complete genome sequence, the entire contents of which are incorporated herein by reference.

A non-limiting example of the SARS-CoV-2 genome is sequence GISAID Reference Sequence Accession No. EPI_ISL_678615, severe acute respiratory syndrome coronavirus strain 2 B. 1.351 virus, the entire contents of which are incorporated herein by reference.

A non-limiting example of the SARS-CoV-2 genome is sequence NCBI reference sequence accession numbers MW972466-MW974550, severe acute respiratory syndrome coronavirus strain 2 B. 1.427 and B.I. 1.429 virus, the entire contents of which are incorporated herein by reference.

A non-limiting example of a SARS-CoV-2 genome is provided in sequence NCBI Reference Sequence Accession Nos. MZ156756-MZ226428, complete genome sequence of severe acute respiratory syndrome coronavirus 2 virus, the entire contents of which are herein incorporated by reference. Incorporated into

In one embodiment, the SAR-CoV-2 genome is obtained from www. gisaid. provided in the GISAID database at org. In one embodiment, the SARS-CoV-2 genome is obtained from www. insdc. org under the International Nucleotide Sequence Database Consortium (INSDC).

In certain embodiments, antigens and/or epitopes of the present disclosure are derived from predicted transcripts from the SARS-CoV-2 genome. In certain embodiments, the antigens and/or epitopes of the present disclosure are derived from proteins encoded by open reading frames from the SARS-CoV-2 genome, or derivatives thereof. Non-limiting examples of open reading frames in the SARS-CoV-2 genome include ORF1a, ORF1b, spike (S), ORF3a, envelope (E), membrane (M), ORF6, ORF7a, ORF7b, ORF8, nucleocapsid. (N), and ORF10. In certain embodiments, the SARS-CoV-2 genome encodes ORF3b, ORF9a, ORF9b, or a combination thereof. In certain embodiments, the SARS-CoV-2 genome does not encode ORF3b, ORF9a, ORF9b, or any combination thereof.

Non-limiting examples of amino acid sequences are shown in Table 1. In certain embodiments, the antigen has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from Table 1. include.

Further non-limiting examples of proteins encoded by the SARS-CoV-2 genome include NCBI Accession Nos. 3, MT334534, MT334535, MT334536, MT334537, MT334538, MT334539, MT334540, MT334541, MT334542, MT334543, MT334544, MT334545, MT334546, MT334555, MT334547, MT334548, MT 334549, MT334550, MT334551, MT334552, MT334553, MT334554, MT334556, MT334557, MT334558, MT334559, MT334560, MT334561, MT334562, MT334563, MT334564, MT334565, MT334566, MT334567, MT334568, MT334569, MT334570, MT334571, MT334572, MT334573, MT326097, MT 326106, MT326107, MT326116, MT326117, MT326124, MT326125, MT326126, MT326127, MT326134, MT326135, MT326136, MT326137, MT326138, MT326139, MT326140, MT326141, MT326142, MT326143, MT326144, MT326145, MT326146, MT326148, MT326149, MT326150, MT326151, MT 326152, MT326158, MT326159, MT326160, MT326161, MT326162, MT326168, MT326169, MT326170, MT326171, MT326172, MT326178, MT326179, MT326180, MT326181, MT326182, MT326183, MT326188, MT326189, MT326190, MT326191, MT326129, MT326121, MT326120, MT326119, MT 326118, MT326111, MT326023, MT326025, MT326033, MT326035, MT326036, MT326040, MT326043, MT326045, MT326053, MT326055, MT326056, MT326063, MT326066, MT326070, MT326071, MT326072, MT326075, MT326076, MT326078, MT326079, MT326089, MT325563, MT325565, MT 325566, MT326155, MT326163, MT326177, MT326130, MT326128, MT326110, MT326109, MT326108, MT326101, MT326100, MT326099, MT326098, MT326094, MT326093, MT326092, MT325568, MT325569, MT325590, MT325640, MT325606, MT325607, MT325608, MT325609, MT325610, MT 325611, MT325616, MT325618, MT325619, MT325620, MT325622, MT325623, MT325624, MT325599, MT325600, MT325601, MT325602, MT325612, MT325613, MT325615, MT325617, MT325625, MT324062, MT324684, MT325573, MT325574, MT325577, MT325579, MT325586, MT325592, MT 325593, MT325594, MT325598, MT325605, MT325626, MT325627, MT325633, MT325634, MT326028, MT326031, MT326091, MT326090, MT326085, MT326084, MT326083, MT326082, MT326081, MT326080, MT326077, MT326067, MT326057, MT326024, MT326026, MT326027, MT326032, MT 326034, MT326037, MT326039, MT326041, MT326042, MT326044, MT326046, MT326047, MT326049, MT326050, MT326051, MT326052, MT326054, MT326059, MT326060, MT326061, MT326062, MT326064, MT326065, MT326068, MT326069, MT326073, MT326074, MT326088, MT327745, MT 324679, MT325561, MT325571, MT325572, MT325575, MT325583, MT325587, MT325588, MT325589, MT325596, MT325597, MT325603, MT325604, MT325614, MT325621, MT325629, MT325630, MT325631, MT325632, MT325635, MT325636, MT325637, MT325638, MT325639, MT326086, MT 326096, MT326102, MT326104, MT326105, MT326112, MT326113, MT326114, MT326115, MT326122, MT328034, MT325564, MT325567, MT326164, MT326165, MT326173, MT326174, MT326184, MT326185, MT326186, MT326187, MT325584, MT325585, MT326087, MT326095, MT326103, MT 326123, MT326131, MT326132, MT326133, MT328033, MT325562, MT326147, MT326153, MT326154, MT326156, MT326157, MT326166, MT326167, MT326175, MT326176, MT324680, MT325570, MT325576, MT325578, MT325580, MT325581, MT325582, MT325591, MT325595, MT325628, MT 326029, MT326030, MT326038, MT326048, MT326058, MT324681, MT324682, MT324683, MT328032, MT328035, MT322404, MT039874, MT322398, MT322409, MT322421, MT322423, MT322408, MT322413, MT322417, MT322394, MT322407, MT322418, MT322424, MT322411, MT077125, MT 322395, MT322396, MT322397, MT322399, MT322400, MT322401, MT322402, MT322403, MT322405, MT322406, MT322414, MT322416, MT322419, MT322420, MT322410, MT322412, MT322415, MT322422, MT320538, MT320891, MT308692, MT308693, MT308695, MT308696, MT308698, MT 308699, MT308701, MT308703, MT308704, MT308694, MT308697, MT308700, MT308702, MT293547, MT304476, MT304474, MT304475, MT304477, MT304478, MT304479, MT304481, MT304482, MT304484, MT304485, MT304486, MT304487, MT304488, MT304491, MT304480, MT304483, MT 304489, MT304490, MT300186, MT292571, MT292576, MT292578, MT293186, MT292570, MT292573, MT293173, MT292575, MT293179, MT293180, MT293184, MT293189, MT293192, MT293193, MT293194, MT293201, MT293202, MT292572, MT292577, MT293185, MT293187, MT293188, MT 291826, MT291832, MT291833, MT291835, MT291836, MT291831, MT293170, MT292574, MT293178, MT293181, MT293183, MT293195, MT293196, MT293197, MT293203, MT293204, MT293223, MT293212, MT293214, MT293215, MT293216, MT293219, MT293224, MT293225, MT293206, MT 293208, MT293209, MT293221, MT295464, MT293160, MT293166, MT293171, MT293190, MT293161, MT293167, MT293168, MT293174, MT293175, MT293182, MT293191, MT293158, MT293162, MT293163, MT293164, MT293156, MT293157, MT293159, MT291834, MT291829, MT291827, MT 291830, MT291828, MT293169, MT293200, MT293210, MT293211, MT293217, MT293218, MT295465, MT293198, MT293205, MT293207, MT293213, MT293220, MT293222, MT292581, MT292569, MT293172, MT293177, MT293176, MT293199, MT292580, MT292582, MT293165, MT292579, MT 273658, MT281577, MT281530, MT276597, MT276598, MT276323, MT276328, MT276331, MT276329, MT276330, MT276324, MT276325, MT276327, MT276326, MT263388, MT263392, MT262900, MT262902, MT262906, MT262908, MT262912, MT262913, MT262914, MT262993, MT263074, MT 263381, MT263391, MT262901, MT262903, MT262907, MT262909, MT262911, MT262899, MT262904, MT262915, MT262916, MT262897, MT262898, MT262905, MT262910, MT263400, MT263382, MT263383, MT263384, MT263385, MT262896, MT263407, MT263415, MT263406, MT263408, MT 263422, MT263469, MT263439, MT263457, MT263459, MT263432, MT263450, MT263458, MT263467, MT263401, MT263411, MT263413, MT263426, MT263421, MT263443, MT263412, MT263416, MT263417, MT263423, MT263431, MT263461, MT263410, MT263424, MT263425, MT263427, MT 263442, MT263402, MT263405, MT263409, MT263418, MT263419, MT263398, MT263399, MT263403, MT263404, M.

T263414, MT263430, MT263390, MT263434, MT263436, MT263446, MT263448, MT263452, MT263453, MT263456, MT263462, MT263463, MT263386, MT263387, MT263389, MT 263428, MT263429, MT263433, MT263435, MT263437, MT263438, MT263440, MT263447, MT263449, MT263455, MT263444, MT263445, MT263451, MT263466, MT263420, MT263441, MT263454, MT263464, MT263465, MT263468, MT263460, MT263393, MT263394, MT263395, MT263396, MT 263397, MT259226, MT259275, MT259276, MT259279, MT259247, MT258377, MT258378, MT258379, MT259231, MT259228, MT259238, MT259248, MT256917, MT259227, MT259236, MT256918, MT258380, MT259235, MT259237, MT259239, MT259281, MT259282, MT259283, MT259240, MT 259243, MT259249, MT259250, MT259251, MT259256, MT259258, MT259266, MT259267, MT259274, MT259286, MT259287, MT259241, MT259242, MT258381, MT259257, MT259261, MT259262, MT259263, MT259264, MT259268, MT259269, MT259270, MT259271, MT259272, MT259273, MT 259277, MT259278, MT259280, MT258383, MT258382, MT259246, MT256924, MT259244, MT259245, MT259252, MT259253, MT259254, MT259255, MT259259, MT259284, MT259229, MT259230, MT259265, MT259260, MT259285, LC534419, LC534418, MT253710, MT253709, MT253705, MT 253708, MT253701, MT253702, MT253703, MT253704, MT253706, MT253707, MT251972, MT251974, MT251975, MT251973, MT251976, MT251979, MT253697, MT253699, MT253696, MT253698, MT253700, MT251977, MT251978, MT251980, MT246451, MT246461, MT246471, MT246472, MT 246474, MT246483, MT246450, MT246453, MT246454, MT246462, MT246463, MT246464, MT246470, MT246473, MT246480, MT246484, MT246449, MT246455, MT246456, MT246478, MT246485, MT246488, MT246452, MT246460, MT246465, MT246481, MT246482, MT246490, MT246459, MT 246468, MT246475, MT246477, MT246479, MT246457, MT246458, MT246466, MT246467, MT246469, MT246476, MT246486, MT246487, MT246489, MT233526, MT246667, MT240479, MT232870, MT232871, MT233523, MT232869, MT232872, MT233519, MT233521, MT233522, MT233520, MT 226610, MT198653, MT198651, MT198652, MT192773, MT192758, MT192772, MT192765, MT192759, MT188341, MT188340, MT188339, MT186676, MT186681, MT186677, MT186678, MT187977, MT186680, MT186682, MT186679, MT184909, MT184911, MT184912, MT184913, MT184910, MT 184907, MT184908, CADDYA000000000, MT163718, MT163719, MT163720, MT163714, MT163715, MT163721, MT163717, MT163737, MT163738, MT163712, MT163716, MT159706, MT159716, MT159719, MT159707, MT159717, MT159709, MT159715, MT159718, MT159722, MT159708, MT161607, MT 159705, MT159710, MT159711, MT159712, MT159713, MT159714, MT159720, MT159721, MT121215, MT159778, LC 528232, LC528233, MT123293, MT123291, MT123290, MT123292, MT118835, MT111896, MT111895, MT106052, MT106053, MT106054, MT093571, MT093631, MT081061, MT081063, MT081066, MT081062, MT081064, MT081065, MT081067, MT081059, MT081060, MT081068, MT072667, MT 072668, MT072688, MT066157, MT066176, MT066159, MT066175, MT066158, LC523809, LC523807, LC523808, MT044258, MT044257, MT050416, MT050417, MT042773, MT042774, MT042775, MT042776, MT049951, MT050414, MT050415, MT042777, MT042778, MT039887, MT039888, MT 039890, MT039873, LC522350, MT027062, MT027063, MT027064, MT020881, MT019530, MT019531, MT019533, MT020880, MT019532, MT019529, MT020781, LR757995, LR757998, LR757996, LR757997, MT007544, MT008022, MT008023, MN996531, MN996530, MN996527, MN 996528, MN996529, MN997409, MN988668, MN988669, MN994467, MN994468, MN988713, MN938384, MN975262, MN985325, MN938386, MN938388, MN938385, MN938387, MN938390, MN938389, MN975263, MN975267, MN975268, MN975265, MN975264, MN975266, MN970004, MN97 0003, MN 908947, each of which is incorporated herein by reference in its entirety. Incorporated.

In certain embodiments, the cyclic polyribonucleotides comprise SARS-CoV-2 antigens listed in Table 2. In certain embodiments, the antigen has at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from Table 2. include.

In Table 2, "proline substitutions" indicates proline substitutions at residues 986 and 987 and a "GSAS" substitution at the furin cleavage site (residues 682-685). In "Cloning Optimization", a single base substitution was made at coordinate 2541 to destroy a BsaI site that aids in Golden Gate Cloning construction of the plasmid DNA template. In "circularization optimization": four single nucleotides at positions 2307, 2790, 159 and 315 are replaced to destroy potential binding sites for the circularization element of the splint nucleic acid sequence, thereby Potentially inhibits efficient ligation. In constructs with removed type II terminators (e.g., p33, p35, p36, p39, p41, p44, and p45): two single nucleotides at 1047, 1049 were replaced to destroy the type II terminator site. rice field. For constructs with GC optimization (eg p39 and p41), GC optimization was performed such that the GC content was approximately 50%. All single base pair substitutions were designed to be translationally silent. Additionally, in Table 2, the IRES is EMCV (SEQ ID NO: 31) or CVB3 (SEQ ID NO: 45).

In certain embodiments, the antigen or epitope is derived from host subject (eg, subject for immunization) cells. For example, antibodies that block coronavirus entry can be generated by using antigens or epitopes from components of the host cell that the virus uses as entry factors.

In some embodiments, the coronavirus epitopes are at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 amino acids, or more or contain. In certain embodiments, the coronavirus epitopes are 18 or less, 19 or less, 20 or less, 21 or less, 22 or less, 23 or less, 24 or less, 25 or less, 26 or less, 27 or less, 28 or less, 29 or less, or 30 or less amino acids, or less or contain. In certain embodiments, the coronavirus epitopes are comprises or contains 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In certain embodiments, the coronavirus epitope contains 5 amino acids. In certain embodiments, the coronavirus epitope contains 6 amino acids. In certain embodiments, the epitope contains 7 amino acids. In certain embodiments, the coronavirus epitope contains 8 amino acids. In certain embodiments, an epitope can be from about 8 to about 11 amino acids. In certain embodiments, an epitope can be from about 9 to about 22 amino acids.

Coronavirus antigens may include antigens recognized by B cells, antigens recognized by T cells, or a combination thereof. In certain embodiments, antigens include antigens recognized by B cells. In certain embodiments, the coronavirus antigen is an antigen recognized by B cells. In some embodiments, coronavirus antigens include antigens recognized by T cells. In certain embodiments, the antigen is an antigen recognized by T cells.

Coronavirus epitopes include those recognized by B cells, antigens recognized by T cells, or combinations thereof. In certain embodiments, coronavirus epitopes include epitopes recognized by B cells. In certain embodiments, the epitope is an epitope recognized by B cells. In certain embodiments, coronavirus epitopes include epitopes recognized by T cells. In certain embodiments, the coronavirus epitope is an epitope recognized by T cells.

Techniques for identifying antigens and epitopes in silico are described, for example, in Sanchez-Trincado, et al. (2017), Fundamentals and methods for T-and B-cell epitope prediction. , Journal of immunology research; Grifoni, Alba, et al. A Sequence Homology and Bioinformatic Approach Can Predict Candidate Targets for Immune Responses to SARS-CoV-2. Cell host & microbe (2020); Russi et al. In silico prediction of T-and B-cell epitopes in PmpD: First step to the design of a Chlamydia trachomatis vaccine. biomedical journal 41.2 (2018): 109-117; Baruah, et al. Immunoinformatics-aided identification of T cell and B cell epitopes in the surface glycoprotein of 2019-nCoV. Journal of Medical Virology (2020); each of which is hereby incorporated by reference in its entirety.

The cyclic polyribonucleotides of the present disclosure may contain sequences of various coronavirus antigens and/or epitopes. cyclic polyribonucleotides are, for example, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450 , contains sequences of at least 500 or more coronavirus antigens or epitopes.

In some embodiments, the cyclic polyribonucleotide is, for example, 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, 20 or less, 25 or less. 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 or less, 350 or less, Include sequences of 400 or less, 450 or less, 500 or less, or less coronavirus antigens or epitopes.

In certain embodiments, the cyclic polyribonucleotide is, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 sequences of coronavirus antigens or epitopes.

A circular polyribonucleotide may contain sequences for one or more coronavirus epitopes from a coronavirus antigen. For example, a coronavirus antigen may comprise an amino acid sequence that may contain multiple coronavirus epitopes (e.g., epitopes recognized by B cells and/or T cells), and cyclic polyribonucleotides may contain those coronavirus epitopes. It may contain or encode one or more of the epitopes.

The cyclic polyribonucleotides are, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 from one coronavirus antigen. , at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, at least Include a sequence of 350, at least 400, at least 450, at least 500, or more epitopes.

In certain embodiments, the cyclic polyribonucleotides are, for example, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, 20 or less, 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 or less , 350 or less, 400 or less, 450 or less, or 500 or less, or less sequences of coronavirus epitopes.

In certain embodiments, the cyclic polyribonucleotides are, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40 from one coronavirus antigen. , 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 coronavirus epitopes.

Circular polyribonucleotides may encode variants of coronavirus antigens or epitopes. Variants can be natural variants (e.g., variants identified in sequence data from different coronavirus genera, species, isolates, or quasispecies) or those disclosed herein generated in silico. can be a derivative sequence (eg, an antigen or epitope having one or more amino acid insertions, deletions, substitutions, or combinations thereof compared to the wild-type antigen or epitope).

The cyclic polyribonucleotide is, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 20, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, at least 350 , including sequences of at least 400, at least 450, at least 500, or more variants.

In some embodiments, the cyclic polyribonucleotide is, for example, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, 20 or less of the coronavirus antigen or epitope. 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 or less, Including sequences of 350 or less, 400 or less, 450 or less, 500 or less, or less variants.

In certain embodiments, the cyclic polyribonucleotide is, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, of a coronavirus antigen or epitope. 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 variant sequences.

Circular polyribonucleotide coronavirus antigen and/or epitope sequences may also be referred to as coronavirus expression sequences. In certain embodiments, the cyclic polyribonucleotide comprises one or more coronavirus-expressed sequences, each of which may encode a coronavirus polypeptide. Coronavirus polypeptides can be produced in significant quantities. A coronavirus polypeptide can be a coronavirus polypeptide that is secreted from the cell or confined to the cytoplasm, nucleus or membrane compartment of the cell. Some coronavirus polypeptides include, but are not limited to, antigens disclosed herein, epitopes disclosed herein, coronavirus proteins (e.g., viral envelope protein, viral matrix protein, viral spike protein, , the viral receptor binding domain (RBD) of the viral spike protein, the viral membrane protein, the viral nucleocapsid protein, the viral accessory proteins, fragments thereof, or combinations thereof). In certain embodiments, coronavirus polypeptides encoded by cyclic polyribonucleotides of the present disclosure comprise fragments of the coronavirus antigens disclosed herein. In certain embodiments, coronavirus polypeptides encoded by cyclic polyribonucleotides of the present disclosure comprise fusion proteins, or fragments thereof, comprising two or more coronavirus antigens disclosed herein. In certain embodiments, a coronavirus polypeptide encoded by a cyclic polyribonucleotide of the disclosure comprises a coronavirus epitope. In certain embodiments, a polypeptide encoded by a cyclic polyribonucleotide of the disclosure is a fusion protein comprising two or more coronavirus epitopes disclosed herein, e.g., one or more coronavirus epitopes of the disclosure. contains artificial peptide sequences containing multiple predicted epitopes from

In certain embodiments, exemplary coronavirus proteins expressed from the cyclic polyribonucleotides disclosed herein are secreted proteins, e.g., proteins that naturally include signal peptides (e.g., antigens and/or epitopes), Or, those that do not normally encode a signal peptide, but have been modified to include one.

In some cases, the cyclic polyribonucleotide expresses a secreted coronavirus protein with a short half-life in the blood, or is a protein with an intracellular localization signal, or a protein with a secretory signal peptide. In some cases, the cyclic polyribonucleotide is a protein that expresses a transmembrane domain with a short half-life in blood, or has a subcellular localization signal, or a secreted peptide.

In certain embodiments, the circular polyribonucleotide comprises one or more coronavirus expression sequences and is configured for sustained expression in cells of a subject (eg, a subject for immunization) in vivo. In certain embodiments, the cyclic polyribonucleotide is configured such that expression of one or more coronavirus-expressed sequences in the cell at later time points is equal to or higher than at earlier time points. In such embodiments, expression of one or more coronavirus expression sequences may be maintained at a relatively stable level or increased over time. In certain embodiments, expression of coronavirus expression sequences is relatively stable over an extended period of time.

In certain embodiments, the cyclic polyribonucleotide expresses one or more coronavirus antigens and/or epitopes in a subject (eg, a subject for immunization), eg, transiently or over time. In certain embodiments, expression of the coronavirus expression sequences is from at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days , 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or longer or any time therebetween. In certain embodiments, coronavirus antigen and/or epitope expression is about 30 minutes to about 7 days or less, or about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours. hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days , 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 45 days, 60 days, 75 days, 90 days Lasts up to a day or any time in between.

In certain embodiments, the coronavirus expression sequence is less than 5000 bps (e.g., about 5000 bps, 4000 bps, 3000 bps, 2000 bps, 1000 bps, 900 bps, 800 bps, 700 bps, 600 bps, 500 bps, 400 bps, 300 bps, 200 bps, 100 bps, 50 bps, 40 bps, 30bps , 20 bps, less than 10 bps, or less). In certain embodiments, the coronavirus expression sequences independently or in addition have greater than 10 bps (e.g., at least about 10 bps, 20 bps, 30 bps, 40 bps, 50 bps, 60 bps, 70 bps, 80 bps, 90 bps, 100 bps, 200 bps, 300 bps, 400bps, 500bps, 600bps, 700bps, 800bps, 900bps, 1000kb, 1.1kb, 1.2kb, 1.3kb, 1.4kb, 1.5kb, 1.6kb, 1.7kb, 1.8kb, 1.9kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 3.1 kb, 3.2 kb, 3. 3 kb, 3.4 kb, 3.5 kb, 3.6 kb, 3.7 kb, 3.8 kb, 3.9 kb, 4 kb, 4.1 kb, 4.2 kb, 4.3 kb, 4.4 kb, 4.5 kb, 4. 6 kb, 4.7 kb, 4.8 kb, 4.9 kb, over 5 kb or more).

Derivatives and Fragments An antigen or epitope of the disclosure may comprise a wild-type sequence. The term "wild-type" when referring to an antigen or epitope refers to a sequence (eg, amino acid sequence) that is naturally occurring and encoded by a genome (eg, a coronavirus genome). A coronavirus may have one wild-type sequence, or two or more wild-type sequences (e.g., one canonical wild-type sequence present in a reference coronavirus genome, and any additional mutant wild-type sequences present resulting from mutations). ).

When referring to an antigen or epitope, the terms "derivative" and "derived from" are those that differ from the wild-type sequence by one or more amino acids, e.g., one or more amino acid insertions, deletions compared to the wild-type sequence. , and/or a sequence (eg, an amino acid sequence) containing a substitution.

An antigen or epitope derivative sequence is at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92% relative to a wild-type sequence, e.g., a wild-type protein, antigen, or epitope sequence. , 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity.

"Sequence identity" and "sequence similarity" are determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences are "substantially identical" or "essentially" when they share at least a certain minimum percentage of sequence identity (e.g., when optimally aligned by the programs GAP or BESTFIT using default parameters). called "similar". GAP aligns two sequences over their entire lengths using the Needleman and Wunsch global alignment algorithm to maximize the number of matches and minimize the number of gaps. Generally, GAP default parameters are used with gap creation penalty = 50 (nucleotides)/8 (protein) and gap extension penalty = 3 (nucleotides)/2 (protein). For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for percentage sequence identity were obtained from Accelrys Inc. using a computer program such as the GCG Wisconsin Package, Version 10.3, or EmbossWin version 2.10.0 (using the program "needle"), available from Physics, Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA. can be determined. Alternatively or additionally, percent similarity or identity is determined by searching against databases using algorithms such as FASTA, BLAST. Sequence identity refers to sequence identity over the entire length of the sequence.

In certain embodiments, the antigen or epitope contains one or more amino acid insertions, deletions, substitutions, or combinations thereof that affect the structure of the encoded protein. In certain embodiments, the antigen or epitope contains one or more amino acid insertions, deletions, substitutions, or combinations thereof that affect the function of the encoded protein. In certain embodiments, the antigen or epitope contains one or more amino acid insertions, deletions, substitutions, or combinations thereof that affect the expression or processing of the encoded protein by the cell.

Amino acid insertions, deletions, substitutions, or combinations thereof can introduce sites for post-translational modifications (e.g., glycosylation, ubiquitination, phosphorylation, nitrosylation, methylation, acetylation, amidation, hydration, introducing oxidation, sulfation, or lipidation sites, or sequences targeted for cleavage). In certain embodiments, amino acid insertions, deletions, substitutions, or combinations thereof remove sites for post-translational modification (e.g., glycosylation, ubiquitination, phosphorylation, nitrosylation, methylation, acetylation, amidation, hydroxylation, sulfation, or lipidation sites, or sequences targeted for cleavage). In certain embodiments, amino acid insertions, deletions, substitutions, or combinations thereof modify sites for post-translational modification (e.g., glycosylation, ubiquitination, phosphorylation, nitrosylation, methylation, acetylation, amidation, hydroxylation, sulfation, or lipidation sites, or modifying sites to alter the efficiency or properties of cleavage).

Amino acid substitutions may be conservative or non-conservative. A conservative amino acid substitution can be the substitution of one amino acid for another amino acid of similar biochemical properties (eg, charge, size, and/or hydrophobicity). Non-conservative amino acid substitutions can be the substitution of one amino acid for another amino acid that has different biochemical properties (eg, charge, size, and/or hydrophobicity). Conservative amino acid changes can be, for example, substitutions that have minimal impact on the secondary or tertiary structure of the polypeptide. Conservative amino acid changes can be amino acid changes from one hydrophilic amino acid to another. Hydrophilic amino acids include Thr (T), Ser (S), His (H), Glu (E), Asn (N), Gln (Q), Asp (D), Lys (K) and Arg (R). can contain. A conservative amino acid change can be an amino acid change from one hydrophobic amino acid to another hydrophilic amino acid. Hydrophobic amino acids are Ile (I), Phe (F), Val (V), Leu (L), Trp (W), Met (M), Ala (A), Gly (G), Tyr (Y), and Pro(P). A conservative amino acid change can be an amino acid change from one acidic amino acid to another. Acidic amino acids can include Glu (E) and Asp (D). Conservative amino acid changes can be amino acid changes from one basic amino acid to another. Basic amino acids can include His (H), Arg (R) and Lys (K). Conservative amino acid changes can be amino acid changes from one polar amino acid to another. Polar amino acids can include Asn (N), Gln (Q), Ser (S) and Thr (T). A conservative amino acid change can be an amino acid change from one non-polar amino acid to another non-polar amino acid. Non-polar amino acids can include Leu (L), Val (V), Ile (I), Met (M), Gly (G) and Ala (A). Conservative amino acid changes can be amino acid changes from one aromatic amino acid to another. Aromatic amino acids can include Phe (F), Tyr (Y) and Trp (W). Conservative amino acid changes can be amino acid changes from one aliphatic amino acid to another. Aliphatic amino acids can include Ala (A), Val (V), Leu (L) and Ile (I). In certain embodiments, conservative amino acid substitutions are in the following groups: Group I: ala, pro, gly, gln, asn, ser, thr; Group II: cys, ser, tyr, thr; Group III: val, ile, leu, met, ala, phe; Group IV: lys, arg, his; Group V: phe, tyr, trp, his; and Group VI: asp, glu from one amino acid to another amino acid. is an amino acid change to

In certain embodiments, the antigen or epitope derivative of the present disclosure has at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, At least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 amino acid deletions.

In certain embodiments, the antigen or epitope derivative of the present disclosure has at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, It contains at least 35, at least 40, at least 45, or at least 50 amino acid substitutions.

In certain embodiments, an antigen derivative or epitope derivative of the present disclosure has 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 7 or less, 8 or less, 9 or less, 10 or less, 11 or less, 12 or less, 13 or less, 14 or less, 15 or less, 16 or less, 17 or less, 18 or less, 19 or less, 20 or less, 25 or less, 30 or less, Include 35 or fewer, 40 or fewer, 45 or fewer, or 50 or fewer amino acid substitutions.

In certain embodiments, the antigen or epitope derivatives of the present disclosure are 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-15, 1-20, 1-30, 1-40, 2-3, 2-4, 2-5, 2- 6, 2-7, 2-8, 2-9, 2-10, 2-15, 2-20, 2-30, 2-40, 3-3, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-15, 3-20, 3-30, 3-40, 5-6, 5-7, 5-8, 5-9, 5- Contains 10, 5-15, 5-20, 5-30, 5-40, 10-15, 15-20, or 20-25 amino acid substitutions.

In certain embodiments, antigen or epitope derivatives of the present disclosure have 1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8, Contains 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions.

One or more amino acid substitutions can be at the N-terminus, C-terminus, within the amino acid sequence, or in combination. Amino acid substitutions can be consecutive, non-consecutive, or a combination thereof.

In certain embodiments, an antigen derivative or epitope derivative of the present disclosure has 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 7 or less, 8 or less, 9 or less, 10 or less, 11 or less, 12 or less, 13 or less, 14 or less, 15 or less, 16 or less, 17 or less, 18 or less, 19 or less, 20 or less, 25 or less, 30 or less, 35 or less, 40 or less, 45 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, or 200 or less amino acid deletions.

In certain embodiments, the antigen or epitope derivatives of the present disclosure are 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-15, 1-20, 1-30, 1-40, 2-3, 2-4, 2-5, 2- 6, 2-7, 2-8, 2-9, 2-10, 2-15, 2-20, 2-30, 2-40, 3-3, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-15, 3-20, 3-30, 3-40, 5-6, 5-7, 5-8, 5-9, 5- 10, 5-15, 5-20, 5-30, 5-40, 10-15, 15-20, 20-25, 20-30, 30-50, 50-100, or 100-200 amino acid deletions including loss.

In certain embodiments, antigen or epitope derivatives of the present disclosure have 1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid deletions.

One or more amino acid deletions can be at the N-terminus, C-terminus, or a combination thereof within the amino acid sequence. Amino acid deletions can be contiguous, non-contiguous, or a combination thereof.

In certain embodiments, the antigen or epitope derivative of the present disclosure has at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, Contains at least 35, at least 40, at least 45, or at least 50 amino acid insertions.

In certain embodiments, an antigen derivative or epitope derivative of the present disclosure has 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 7 or less, 8 or less, 9 or less, 10 or less, 11 or less, 12 or less, 13 or less, 14 or less, 15 or less, 16 or less, 17 or less, 18 or less, 19 or less, 20 or less, 25 or less, 30 or less, Include no more than 35, no more than 40, no more than 45, or no more than 50 amino acid insertions.

In certain embodiments, the antigen or epitope derivatives of the present disclosure are 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-15, 1-20, 1-30, 1-40, 2-3, 2-4, 2-5, 2- 6, 2-7, 2-8, 2-9, 2-10, 2-15, 2-20, 2-30, 2-40, 3-3, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-15, 3-20, 3-30, 3-40, 5-6, 5-7, 5-8, 5-9, 5- Include 10, 5-15, 5-20, 5-30, 5-40, 10-15, 15-20, or 20-25 amino acid insertions.

In certain embodiments, antigen or epitope derivatives of the present disclosure have 1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid insertions.

One or more amino acid insertions may be at the N-terminus, C-terminus, or a combination thereof within the amino acid sequence. Amino acid insertions may be consecutive, non-consecutive, or a combination thereof.

Circular Polyribonucleotides Circular polyribonucleotides comprise the elements described below as well as the coronavirus antigens or epitopes described herein.

In some embodiments, the cyclic polyribonucleotide has at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides , at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8, 000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.

In certain embodiments, the circular polyribonucleotide can be of sufficient size to accommodate the binding site for the ribosome. In certain embodiments, the maximum size of a cyclic polyribonucleotide can be any size within the technical constraints of producing and/or using cyclic polyribonucleotides. While not wishing to be bound by any particular theory, it is believed that multiple segments of RNA are composed of DNA and their 5' and 3' free ends annealed to produce a "string" of RNA ( It is possible that they can be generated from the circularization when only one 5' free end and one 3' free end are ultimately left. In certain embodiments, the maximum size of circular polyribonucleotides may be limited by the ability to package and deliver RNA to a target. In certain embodiments, the size of the cyclic polyribonucleotide is long enough to encode useful polypeptides, such as antigens and/or epitopes of the present disclosure, thus at least 20,000 nucleotides, at least 15,000 nucleotides. nucleotides, at least 10,000 nucleotides, at least 7,500 nucleotides or at least 5,000 nucleotides, at least 4,000 nucleotides, at least 3,000 nucleotides, at least 2,000 nucleotides, at least 1,000 nucleotides, at least 500 nucleotides, at least 400 Lengths of nucleotides, at least 300 nucleotides, at least 200 nucleotides, at least 100 nucleotides, or at least 70 nucleotides can be useful.

Circular Polyribonucleotide Elements In certain embodiments, the cyclic polyribonucleotides contain one or more of the elements described herein in addition to containing sequences encoding coronavirus antigens and/or epitopes. In certain embodiments, the cyclic polyribonucleotide lacks a poly-A sequence, lacks a free 3' end, lacks an RNA polymerase recognition motif, or any combination thereof. In certain embodiments, the cyclic polyribonucleotide comprises any feature or any combination of features as disclosed in WO2019/118919, which is incorporated herein by reference in its entirety. For example, a circular polyribonucleotide contains regulatory elements, eg, sequences that regulate expression of an expressed sequence within the circular polyribonucleotide. Regulatory elements can include sequences flanking an expressed sequence that encode an expression product. A regulatory element can be operably linked to an adjacent sequence. A regulatory element can increase the amount of product expressed compared to the amount of product expressed in the absence of the regulatory element. In addition, a single regulatory element can increase the amount of product expressed for multiple expression sequences linked side by side. Thus, a single regulatory element can drive expression of more than one expressed sequence. Multiple regulatory elements can also be used, eg, to differentially regulate the expression of different expressed sequences. In certain embodiments, regulatory elements provided herein can include alternative translation sequences. As used herein, the term "selectively translation sequence" selectively initiates or activates translation of sequences expressed in cyclic polyribonucleotides, such as certain riboswitch aptazymes. Refers to a nucleic acid sequence. Regulatory elements can also include selective degradation sequences. As used herein, the term "selective degradation sequence" refers to a nucleic acid sequence that initiates degradation of a cyclic polyribonucleotide or expression product of a cyclic polyribonucleotide. In certain embodiments, the regulatory element is a translational modulator. A translation modulator can regulate translation of an expressed sequence in a circular polyribonucleotide. A translational modulator may be a translational enhancer or suppressor. In certain embodiments, translation initiation sequences may function as regulatory elements. Further examples of regulatory elements are described in paragraphs [0154] to [0161] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, the cyclic polyribonucleotides encode the antigen that produces the human polyclonal antibody of interest, including translation initiation sequences, eg, initiation codons. In certain embodiments, the translation initiation sequence comprises a Kozak or Shine-Dalgarno sequence. In certain embodiments, the circular polyribonucleotide includes a translation initiation sequence, eg, a Kozak sequence, adjacent to the expressed sequence. In some embodiments, the translation initiation sequence is a non-coding initiation codon. In certain embodiments, translation initiation sequences, eg, Kozak sequences, are present on one or both sides of each expressed sequence to provide for separation of the expression products. In certain embodiments, the circular polyribonucleotide includes at least one translation initiation sequence that flanks the expressed sequence. In certain embodiments, the translation initiation sequence confers conformational flexibility to the circular polyribonucleotide. In certain embodiments, the translation initiation sequence is within a substantially single-stranded region of the circular polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs [0163] to [0165] of WO2019/118919, which is hereby incorporated by reference in its entirety.

In certain embodiments, the cyclic polyribonucleotides described herein contain an internal ribosome entry site (IRES) element. A suitable IRES element for inclusion in a circular polyribonucleotide can be an RNA sequence capable of engaging nuclear ribosomes. Further examples of IRES are described in paragraphs [0166] to [0168] of WO2019/118919, which is incorporated herein by reference in its entirety.

A circular polyribonucleotide may comprise one or more expressed sequences (eg, those encoding an antibody), each expressed sequence with or without termination elements. Further examples of terminating elements are described in paragraphs [0169] to [0170] of WO2019/118919, which is incorporated herein by reference in its entirety.

Circular polyribonucleotides of the present disclosure may contain staggered elements. The term "stagger element" refers to a portion, such as a nucleotide sequence, that induces ribosome pausing during translation. In one embodiment, the stagger element is a non-conserved sequence of amino acids with a strong alpha-helical propensity followed by the consensus sequence -D(V/I)ExNPGP (where x = any amino acid) (SEQ ID NO:52) is. In certain embodiments, stagger elements can include chemical moieties such as glycerol, non-nucleic acid linking moieties, chemical modifications, modified nucleic acids, or any combination thereof.

In certain embodiments, the circular polyribonucleotide includes at least one stagger element that flanks the expression sequence. In some embodiments, the circular polyribonucleotide includes staggered elements that flank each expressed sequence. In certain embodiments, stagger elements are present on one or both sides of each expression sequence to effect separation of expression products, eg, peptides and/or polypeptides. In certain embodiments, staggered elements are part of one or more expressed sequences. In certain embodiments, the circular polyribonucleotide comprises one or more expressed sequences, each of the one or more expressed sequences being separated from the following expressed sequence by a stagger element in the circular polyribonucleotide. In certain embodiments, the stagger element directs the production of a single polypeptide from (a) two translations of a single expressed sequence, or (b) one or more translations of two or more expressed sequences. To prevent. In certain embodiments, a staggered element is a sequence separated from one or more expressed sequences. In certain embodiments, a staggered element comprises a portion of an expressed sequence of one or more expressed sequences.

Examples of staggered elements are described in paragraphs [0172]-[0175] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, the circular polyribonucleotide comprises one or more regulatory nucleic acid sequences or one or more expression encoding regulatory nucleic acids, e.g., nucleic acids that regulate the expression of endogenous and/or exogenous genes. Contains arrays. In certain embodiments, the expressed sequences of the circular polyribonucleotides provided herein are, but are not limited to, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA , Y RNA, and hnRNA, which are antisense to regulatory nucleic acids such as non-coding RNAs.

Exemplary regulatory nucleic acids are described in paragraphs [0177] to [0194] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, the translational efficiency of a circular polyribonucleotide provided herein is higher than a reference, eg, linear equivalent, linear expression sequence, or linear circular polyribonucleotide. In certain embodiments, the cyclic polyribonucleotides provided herein have translation efficiencies at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% higher than the reference translation efficiency. %, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 70%, 800%, 900%, 1000%, 2000%, 5000%, 10000%, 100000% or higher translation efficiency . In certain embodiments, circular polyribonucleotides have a translation efficiency that is 10% higher than that of their linear counterparts. In certain embodiments, circular polyribonucleotides have a translation efficiency that is 300% higher than that of their linear counterparts.

In certain embodiments, cyclic polyribonucleotides produce stoichiometric ratios of expression products. Rolling circle translation continuously produces expression products in substantially equal proportions. In certain embodiments, cyclic polyribonucleotides have stoichiometric translation efficiencies such that expression products are produced in substantially equal proportions. In certain embodiments, the cyclic polyribonucleotide is a multiple expression product, e.g., products from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more expression sequences It has stoichiometric translation efficiency.

In certain embodiments, once translation of the cyclic polyribonucleotide is initiated, the ribosome bound to the cyclic polyribonucleotide does not detach from the cyclic polyribonucleotide before completing at least one translation of the cyclic polyribonucleotide. In certain embodiments, the cyclic polyribonucleotides described herein are capable of rolling circle translation. In certain embodiments, during rolling circle translation, once translation of the cyclic polyribonucleotide is initiated, the ribosomes bound to the cyclic polyribonucleotide are translated at least 2 times, at least 3 times, at least 4 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 11 times, at least 12 times, at least 13 times, at least 14 times, at least 15 times, at least 20 times, at least 30 times times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 250 times, at least 500 times, at least 1000 times, It does not leave the circular polyribonucleotide before completing at least 1500, at least 2000, at least 5000, at least 10000, at least 105, or at least 106 translations.

In certain embodiments, rolling circle translation of a cyclic polyribonucleotide results in the production of a translated polypeptide product (a “contiguous” expression product) from two or more translations of the cyclic polyribonucleotide. In certain embodiments, the cyclic polyribonucleotide comprises a staggered element, and rolling circle translation of the cyclic polyribonucleotide produces a polypeptide product ( resulting in the production of a "distinct" expression product). In certain embodiments, cyclic polyribonucleotides comprise at least 10%, 20%, 30%, 40%, 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% are distinct polypeptides be. In certain embodiments, the quantitative ratios of distinct products over the entire polypeptide are tested in an in vitro translation system. In certain embodiments, the in vitro translation system used for mass ratio testing comprises rabbit reticulocyte lysate. In certain embodiments, amount ratios are tested in in vivo translation systems such as eukaryotic or prokaryotic cells, cultured cells or cells within an organism.

In certain embodiments, the circular polyribonucleotide includes an untranslated region (UTR). UTRs of genomic regions containing genes can be transcribed but not translated. In certain embodiments, UTRs may be included upstream of the translation initiation sequences of the expressed sequences described herein. In certain embodiments, UTRs can be included downstream of the expression sequences described herein. In some cases, one UTR for the first expressed sequence is the same as, contiguous with, or overlapping with another UTR for the second expressed sequence. In some embodiments, the intron is a human intron. In certain embodiments, the intron is a full-length human intron, eg, ZKSCAN1.

Exemplary untranslated regions are described in paragraphs [0197]-[201] of WO2019/118919, which is incorporated herein by reference in its entirety.

In some embodiments, the cyclic polyribonucleotide comprises a poly A sequence. Exemplary polyA sequences are described in paragraphs [0202]-[0205] of WO2019/118919, which is incorporated herein by reference in its entirety. In certain embodiments, the cyclic polyribonucleotide lacks poly A sequences.

In certain embodiments, the cyclic polyribonucleotide comprises one or more riboswitches. Exemplary riboswitches are described in paragraphs [0232]-[0252] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, cyclic polyribonucleotides include aptazymes. Exemplary aptazymes are described in paragraphs [0253]-[0259] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, the circular polyribonucleotide contains one or more RNA binding sites. MicroRNAs (or miRNAs) can be short non-coding RNAs that bind to the 3'UTR of nucleic acid molecules and downregulate gene expression by reducing nucleic acid molecule stability or inhibiting translation. A circular polyribonucleotide can comprise one or more microRNA target sequences, microRNA sequences, or microRNA seeds. Such sequences can be any sequence, such as those taught in US Patent Application Publication No. 2005/0261218 and US Patent Application Publication No. 2005/0059005, the entire contents of which are incorporated herein by reference. It can correspond to a known microRNA. Further examples of RNA binding sites are described in paragraphs [0206] to [0215] of WO2019/118919, which is hereby incorporated by reference in its entirety.

In certain embodiments, the circular polyribonucleotide contains one or more protein binding sites that allow proteins, such as ribosomes, to bind to internal sites in the RNA sequence. Further examples of protein binding sites are described in paragraphs [0218] to [0221] of WO2019/118919, which is hereby incorporated by reference in its entirety.

In some embodiments, the cyclic polyribonucleotide includes a spacer sequence. In certain embodiments, the polyribonucleotide elements may be separated from each other by spacer sequences or linkers. Examples of spacer sequences are described in paragraphs [0293] to [0302] of WO2019/118919, which is hereby incorporated by reference in its entirety.

The circular polyribonucleotides described herein can also contain non-nucleic acid linkers. Exemplary non-nucleic acid linkers are described in paragraphs [0303]-[0307] of WO2019/118919, which is incorporated herein by reference in its entirety.

In some embodiments, the circular polyribonucleotide further comprises another nucleic acid sequence. In certain embodiments, circular polyribonucleotides may comprise DNA, RNA, or other sequences, including artificial nucleic acids. Other sequences include, but are not limited to, genomic DNA, cDNA, or sequences encoding tRNA, mRNA, rRNA, miRNA, gRNA, siRNA, or other RNAi molecules. In certain embodiments, the circular polyribonucleotide comprises siRNA to target different loci of the same gene expression product as the circular polyribonucleotide. In certain embodiments, the circular polyribonucleotide comprises siRNA to target a gene expression product different from that present in the circular polyribonucleotide.

In certain embodiments, the cyclic polyribonucleotide lacks a 5'-UTR. In certain embodiments, the cyclic polyribonucleotide lacks a 3'-UTR. In certain embodiments, the cyclic polyribonucleotide lacks poly A sequences. In certain embodiments, the cyclic polyribonucleotide lacks a termination element. In certain embodiments, the cyclic polyribonucleotide lacks an internal ribosome entry site. In certain embodiments, the cyclic polyribonucleotide lacks susceptibility to degradation by exonucleases. In certain embodiments, the lack of degradation susceptibility of the cyclic polyribonucleotide means that the cyclic polyribonucleotide is not degraded by an exonuclease, or is exonucleotide to a limited extent, e.g., equivalent or similar to the absence of an exonuclease. It can mean that it is degraded only in the presence of a nuclease. In certain embodiments, cyclic polyribonucleotides are not degraded by exonucleases. In certain embodiments, cyclic polyribonucleotides have reduced degradation when exposed to exonucleases. In certain embodiments, the cyclic polyribonucleotide lacks binding to a cap-binding protein. In some embodiments, the cyclic polyribonucleotide lacks a 5' cap.

In certain embodiments, the cyclic polyribonucleotide lacks a 5'-UTR and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, the cyclic polyribonucleotide lacks a 3'-UTR and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, the circular polyribonucleotide lacks poly A sequences and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, the cyclic polyribonucleotide lacks termination elements and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, a cyclic polyribonucleotide lacks an internal ribosome entry site and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, the circular polyribonucleotide lacks a cap and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, the cyclic polyribonucleotide lacks a 5'-UTR, a 3'-UTR, and an IRES and is capable of expressing protein from one or more of its expression sequences. In certain embodiments, the circular polyribonucleotide comprises one or more of the following sequences: sequences encoding one or more miRNAs, sequences encoding one or more replication proteins, sequences encoding exogenous genes, a sequence encoding a therapeutic agent, a regulatory element (e.g., translational modulator, e.g., translational enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids that target an endogenous gene (e.g., siRNA, lncRNA, shRNA); and sequences encoding therapeutic mRNAs or proteins.

As a result of its circularization, a circular polyribonucleotide may contain several features that distinguish it from linear RNA. For example, circular polyribonucleotides are less susceptible to degradation by exonucleases than linear RNA. Circular polyribonucleotides are therefore more stable than linear RNA, especially when incubated in the presence of exonucleases. The increased stability of circular polyribonucleotides compared to linear RNA makes them more useful as cell-transforming reagents to generate polypeptides (e.g., antigens and/or epitopes that elicit antibody responses). . The increased stability of circular polyribonucleotides compared to linear RNA allows circular polyribonucleotides to be stored more easily and longer than linear RNA. The stability of exonuclease-treated circular polyribonucleotides can be tested using methods standard in the art (eg, by gel electrophoresis) to determine whether RNA degradation has occurred.

Furthermore, unlike linear RNA, circular polyribonucleotides are less susceptible to dephosphorylation when the circular polyribonucleotides are incubated with a phosphatase, such as calf intestinal phosphatase.

In certain embodiments, a cyclic polyribonucleotide comprises specific sequence features. For example, a circular polyribonucleotide can contain a particular nucleotide composition. In certain such embodiments, the cyclic polyribonucleotide may contain one or more purine (adenine and/or guanosine) rich regions. In certain such embodiments, a circular polyribonucleotide may contain one or more purimpua regions. In certain embodiments, a circular polyribonucleotide may contain one or more AU-rich regions or elements (AREs). In certain embodiments, a cyclic polyribonucleotide may contain one or more adenine-rich regions.

In certain embodiments, the cyclic polyribonucleotide may contain one or more repeat elements as described elsewhere herein. In certain embodiments, the cyclic polyribonucleotides contain one or more modifications described elsewhere herein.

A circular polyribonucleotide may contain one or more substitutions, insertions and/or additions, deletions and covalent modifications relative to the reference sequence. For example, cyclic polyribonucleotides having one or more insertions, additions, deletions, and/or covalent modifications relative to the parent polyribonucleotide are included within the scope of the invention. Exemplary modifications are described in paragraphs [0310]-[0325] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, the cyclic polyribonucleotides comprise higher order structures, such as secondary or tertiary structures. In certain embodiments, complementary segments of circular polyribonucleotides are folded into double-stranded segments and joined by interpair hydrogen bonds, eg, AU and CG. In certain embodiments, a helix, also known as a stem, is formed in the molecule with double-stranded segments connected to terminal loops. In certain embodiments, a cyclic polyribonucleotide has at least one segment with a quasi-double-stranded secondary structure.

In certain embodiments, one or more sequences of circular polyribonucleotides comprise substantially single-stranded to double-stranded regions. In certain embodiments, the ratio of single to double strands can affect the functionality of circular polyribonucleotides.

In certain embodiments, one or more sequences of circular polyribonucleotides that are substantially single-stranded. In certain embodiments, one or more sequences of the substantially single-stranded circular polyribonucleotide may contain a protein- or RNA-binding site. In certain embodiments, the substantially single-stranded circular polyribonucleotide sequence can be conformationally flexible to allow for increased interactions. In certain embodiments, the circular polyribonucleotide sequence is intentionally engineered to contain such secondary structures in order to bind or increase protein or nucleic acid binding.

In some embodiments, the circular polyribonucleotide sequence is substantially double-stranded. In certain embodiments, one or more sequences of the substantially double-stranded circular polyribonucleotide may contain a conformational recognition site, eg, a riboswitch or an aptazyme. In certain embodiments, a substantially double-stranded circular polyribonucleotide sequence can be conformationally fixed. In certain such cases, the conformationally locked sequence may sterically shield the circular polyribonucleotide from protein or nucleic acid binding. In certain embodiments, the sequence of circular polyribonucleotides is deliberately engineered to contain such secondary structures to avoid or reduce protein or nucleic acid binding.

There are 16 possible base-pairings, but 6 of these (AU, GU, GC, UA, UG, CG) can form actual base-pairs. The rest, called mismatches, occur at very low frequency in the helix. In certain embodiments, the structure of the cyclic polyribonucleotide cannot be easily disrupted without affecting its function and without fatal consequences, thereby providing the option of maintaining secondary structure. In certain embodiments, the primary structure of the stems (ie their nucleotide sequences) can still change while still maintaining the helical region. The nature of bases is associated with higher order structures, and substitutions are possible as long as they preserve secondary structure. In certain embodiments, the cyclic polyribonucleotide has a pseudohelical structure. In certain embodiments, the cyclic polyribonucleotide has at least one segment with a pseudohelical structure. In certain embodiments, the cyclic polyribonucleotide comprises at least one of U-rich or A-rich sequences or combinations thereof. In certain embodiments, the U-rich and/or A-rich sequences are arranged so as to generate a triple pseudohelix structure. In certain embodiments, the cyclic polyribonucleotide has a double pseudohelical structure. In certain embodiments, a cyclic polyribonucleotide has one or more segments (eg, 2, 3, 4, 5, 6, or more) with a double pseudohelical structure. In certain embodiments, the cyclic polyribonucleotide comprises at least one of C-rich and/or G-rich sequences. In certain embodiments, the C-rich and/or G-rich sequences are arranged such that a triple pseudohelix structure can be generated. In certain embodiments, the cyclic polyribonucleotide has an intramolecular triple pseudohelical structure that facilitates stabilization.

In certain embodiments, the cyclic polyribonucleotide has two pseudohelical structures (e.g., separated by a phosphodiester bond), whose terminal base pairs are stacked and the pseudohelical structures are collinear, " It is designed to result in a "coaxially stacked" substructure.

In certain embodiments, the cyclic polyribonucleotide comprises a tertiary structure having one or more motifs, such as pseudoknots, guanine quadruplexes, helices, and coaxial stacking.

Additional examples of structures of cyclic polyribonucleotides disclosed herein are described in paragraphs [0326] to [0333] of WO2019/118919, which is hereby incorporated by reference in its entirety. there is

Stability and Half-Life In certain embodiments, the circular polyribonucleotides provided herein have increased stability over a reference, e.g., a linear polyribonucleotide having the same nucleotide sequence but not circularized (linear equivalent). It has a half-life of In certain embodiments, cyclic polyribonucleotides are substantially resistant to degradation, eg, exonuclease degradation. In certain embodiments, cyclic polyribonucleotides are resistant to autolysis. In certain embodiments, the cyclic polyribonucleotide lacks an enzymatic cleavage site, eg, a Dicer cleavage site. Further examples of stability and half-life of the cyclic polyribonucleotides disclosed herein are described in paragraphs [0308]-[0309] of WO2019/118919, which is hereby incorporated by reference in its entirety. It is described in.

Methods of Production In certain embodiments, the circular polyribonucleotides are non-naturally occurring deoxyribonucleic acid sequences that can be produced using recombinant techniques (e.g., obtained in vitro using DNA plasmids), chemical synthesis, or a combination thereof. including.

The DNA molecule used to generate the RNA circle may be a DNA sequence of the original nucleic acid sequence in nature, modified forms thereof, or synthetic polypeptides not commonly found in nature (e.g., chimeric molecules or fusion proteins, e.g., multiple It is within the scope of this disclosure to include a DNA sequence that encodes a fusion protein comprising an antigen and/or epitope of . DNA and RNA molecules are subject to, but are not limited to, site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR). Classical mutagenesis techniques such as amplification and/or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures and ligation of mixtures to "build" mixtures of nucleic acid molecules and combinations thereof. and modified using a variety of techniques, including recombinant techniques.

Circular polyribonucleotides may be prepared according to any available technique, including but not limited to chemical synthesis and enzymatic synthesis. In certain embodiments, linear primary constructs or linear mRNAs can be circularized or concatemerized to generate circular polyribonucleotides as described herein. Mechanisms for cyclization or concatemerization can be performed by methods such as, but not limited to, chemical, enzymatic, splint ligation), or ribozyme-catalyzed methods. The newly formed 5'-/3'-bond can be an intramolecular bond or an intermolecular bond.

Methods of making circular polyribonucleotides described herein are described, for example, in Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools and Applications, ( First Edition) , Academic Press (2013); and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012).

Various methods of synthesizing circular polyribonucleotides have also been described in the art (e.g., US Pat. No. 6,210,931, US Pat. No. 5,773,244, the entire contents of each of which are hereby incorporated by reference). No., US Pat. No. 5,766,903, US Pat. No. 5,712,128, US Pat. See brochure).

In certain embodiments, circular polyribonucleotides are purified, eg, to remove free ribonucleic acids, linear or nicked RNA, DNA, proteins, and the like. In certain embodiments, cyclic polyribonucleotides can be purified by any known method commonly used in the art. Non-limiting examples of purification methods include column chromatography, gel exclusion, size exclusion, and the like.

Circularization In certain embodiments, linear circular polyribonucleotides may be circularized or concatemerized. In certain embodiments, linear circular polyribonucleotides may be circularized in vitro prior to formulation and/or delivery. In certain embodiments, linear circular polyribonucleotides can be circularized intracellularly.

a. Extracellular Circularization In certain embodiments, linear circular polyribonucleotides are circularized or concatamerized using chemical methods to form circular polyribonucleotides. In one chemical method, the 5' and 3' ends of a nucleic acid (e.g., linear circular polyribonucleotide) are brought closer together to form a new covalent bond between the 5' and 3' ends of the molecule. It contains chemically reactive groups that can be The 5' end may contain an NHS ester reactive group, the 3' end may contain a 3'-amino terminal nucleotide, and in an organic solvent the 3'-amino terminus at the 3' end of a linear RNA molecule A nucleotide undergoes a nucleophilic attack on the 5'-NHS-ester moiety to form a new 5'-/3'-amide bond.

In certain embodiments, a DNA or RNA ligase is used to enzymatically ligate a 5′-phosphorylated nucleic acid molecule (eg, a linear circular polyribonucleotide) to the 3′-hydroxyl group of a nucleic acid (eg, a linear nucleic acid). to form a new phosphorodiester bond. In an example reaction, linear circular polyribonucleotides are incubated with 1-10 units of T4 RNA ligase according to the manufacturer's protocol for 1 hour at 37° C. (New England Biolabs, Ipswich, Mass.). A ligation reaction can occur in the presence of a linear nucleic acid capable of base-pairing with both the 5'- and 3'-regions aligned to support the enzymatic ligation reaction. In one embodiment, the ligation is a splint ligation. For example, a splint ligase such as SplintR® ligase can be used for splint ligation. In splint ligation, a single-stranded polynucleotide (splint), such as a single-stranded RNA, hybridizes to both ends of a linear polyribonucleotide such that the two ends can be juxtaposed upon hybridization with the single-stranded splint. Can be designed to soy. Thus, splint ligase can catalyze the ligation of the two juxtaposed ends of a linear circular polyribonucleotide to generate a circular polyribonucleotide.

In certain embodiments, DNA or RNA ligases are used to synthesize circular polynucleotides. As non-limiting examples, the ligase can be a circ ligase or a circular ligase.

In certain embodiments, either the 5' end or the 3' end of the linear circular polyribonucleotide is linearized to the 5' end of the linear circular polyribonucleotide during in vitro transcription. A ligase ribozyme sequence may be encoded to contain an active ribozyme sequence capable of ligating to the 3' end of a circular polyribonucleotide. Ligase ribozymes may be derived from group I introns, hepatitis delta virus, hairpin ribozymes, or selected by SELEX (systematic evolution of ligands by exponential enrichment). The ribozyme ligase reaction can be carried out at temperatures of 0-37° C. for 1-24 hours.

In certain embodiments, linear circular polyribonucleotides are circularized or concatemerized by using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety is a region near the 5′ end and/or near the 3′ end of the linear circular polyribonucleotide to circularize or concatemerize the linear circular polyribonucleotide. Or it can react with features. In another embodiment, the at least one non-nucleic acid moiety can be located or linked to or near the 5' and/or 3' end of the linear circular polyribonucleotide. The contemplated non-nucleic acid moieties may be homologous or heterologous. As non-limiting examples, non-nucleic acid moieties can be bonds such as hydrophobic bonds, ionic bonds, biodegradable bonds and/or cleavable bonds. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety can be an oligonucleotide or peptide moiety such as an aptamer or non-nucleic acid linker described herein.

In certain embodiments, the linear circular polyribonucleotide has interatomic, molecular surface at, near, or linked to such 5′ and 3′ ends at the 5′ and 3′ ends of the linear circular polyribonucleotide. Circularized or concatemerized with non-nucleic acid moieties that cause an attraction force between them. As a non-limiting example, one or more linear circular polyribonucleotides can be circularized or concatamerized by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces and London dispersion forces. Non-limiting examples of intramolecular forces include covalent, metallic, ionic, resonant, agnostic, dipolar, conjugation, hyperconjugation and anti-bonding.

In certain embodiments, linear circular polyribonucleotides can include ribozyme RNA sequences near the 5' end and near the 3' end. A ribozyme RNA sequence can be covalently attached to a peptide when the sequence is exposed to the remainder of the ribozyme. In one aspect, peptides covalently linked to ribozyme RNA sequences near the 5' and 3' ends can bind together to circularize or concatamerize linear circular polyribonucleotides. In another embodiment, the peptides covalently attached to the ribozyme RNA near the 5' and 3' ends are linearized for ligation using various methods known in the art, including but not limited to protein ligation. After providing the primary constructs or linear mRNAs, they may be circularized or concatemerized. A non-limiting list of methods for incorporating and/or covalently linking peptides or non-limiting examples of ribozymes for use in the linear primary constructs or linear RNAs of the invention is provided in U.S. Patent Application Publication No. 20030082768. , the entire contents of which are incorporated herein by reference.

In certain embodiments, linear circular polyribonucleotides are converted to 5' monophosphates by, for example, contacting the 5' triphosphate with RNA 5' pyrophosphohydrolase (RppH) or ATP diphosphohydrolase (apyrase). It may contain the 5' triphosphate of the nucleic acid. Alternatively, converting the 5' triphosphate of the linear circular polyribonucleotide to a 5' monophosphate can be performed by (a) converting the 5' nucleotide of the linear circular polyribonucleotide to a phosphatase (e.g., Antarctic phosphatase). , shrimp-derived alkaline phosphatase, or calf-intestinal phosphatase) to remove all three phosphates; For example, it can be carried out by a two-step reaction comprising contacting with a polynucleotide kinase).

In certain embodiments, the circularization efficiency of the circularization methods provided herein is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%. , at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In certain embodiments, the circularization efficiency of the circularization methods provided herein is at least about 40%. In certain embodiments, provided circularization methods have a circularization efficiency of about 10% to about 100%; , about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about It can be 95%, and about 99%. In some embodiments, the circularization efficiency is from about 20% to about 80%. In some embodiments, the circularization efficiency is from about 30% to about 60%. In some embodiments, the circularization efficiency is about 40%.

b. Splicing Elements In certain embodiments, the circular polyribonucleotide comprises at least one splicing element. Exemplary splicing elements are described in paragraphs [0270]-[0275] of WO2019/118919, which is incorporated herein by reference in its entirety.

In certain embodiments, the circular polyribonucleotide contains at least one splicing element. In the circular polyribonucleotides provided herein, the splicing element can be a perfect splicing element capable of mediating splicing of the circular polyribonucleotide. Alternatively, the splicing element can also be a residual splicing element from a completed splicing event. For example, in some cases, a splicing element of a linear polyribonucleotide can mediate a splicing event that results in circularization of the linear polyribonucleotide, whereby the resulting circular polyribonucleotide is such a spliced Contains residual splicing elements from mediated circularization events. In some cases, the residual splicing element is unable to mediate any splicing. In other cases, residual splicing elements can still mediate splicing under certain circumstances. In certain embodiments, the splicing element flanks at least one expression sequence. In certain embodiments, the circular polyribonucleotide includes splicing elements that flank each expressed sequence. In certain embodiments, splicing elements flank one or both sides of each expressed sequence, resulting in separation of the expression products, eg, peptides and/or polypeptides.

In certain embodiments, the circular polyribonucleotide contains internal splicing elements that, when replicated, join the spliced ends together. Some examples are splice site sequences and short inverted repeats (30-40 nt) such as AluSq2, AluJr, and AluSz, inverted sequences in flanking introns, Alu elements in flanking introns, and backsplices. ) events (suptable 4-enriched motifs) found in cis-sequence elements adjacent to the event, e.g., 200 bp before (upstream) or behind (downstream ) sequence may contain a small intron (<100nt). In certain embodiments, the circular polyribonucleotide comprises at least one repeated nucleotide sequence described elsewhere herein as an internal splicing element. In such embodiments, the repetitive nucleotide sequences may comprise repetitive sequences from the Alu family of introns. In certain embodiments, splicing repeat ribosome binding proteins can regulate circular polyribonucleotide biosynthesis (eg, Muscleblind and Quaking (QKI) splicing factors).

In certain embodiments, a cyclic polyribonucleotide can include canonical splice sites flanking the head-to-tail junction of the cyclic polyribonucleotide.

In certain embodiments, a cyclic polyribonucleotide can comprise a bulge-helix-bulge motif comprising a 4-base pair stem flanked by two 3-nucleotide bulges. Cleavage occurs at a site in the bulge region and produces a characteristic fragment with a terminal 5'-hydroxyl group and a 2',3'-cyclic phosphate. Cyclization proceeds by nucleophilic attack of the 5'-OH group onto the 2',3'-cyclic phosphate of the same molecule to form a 3',5'-phosphodiester bridge.

In certain embodiments, a circular polyribonucleotide can comprise a multimeric repeating RNA sequence with HPR elements. HPR contains a 2',3'-cyclic phosphate and a 5'-OH terminus. The HPR element self-processes the 5'- and 3' ends of linear polyribonucleotides for circularization, thereby ligating the ends together.

In certain embodiments, a circular polyribonucleotide may contain self-splicing elements. For example, a cyclic polyribonucleotide can contain introns from the cyanobacterium Anabaena.

In certain embodiments, a circular polyribonucleotide may contain sequences that mediate self-ligation. In one embodiment, the cyclic polyribonucleotide contains an HDV sequence for self-ligation (e.g., HDV replication domain conserved sequence, GGCUCAUCUCCGACAAGAGGCGGCAGUCUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (SEQ ID NO: 61) or GGCUAGA GGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO: 62)). In one embodiment, the circular polyribonucleotide may contain a loop E sequence (eg, in PSTVd) for self-ligation. In another embodiment, the circular polyribonucleotide may contain self-circularizing introns, such as 5' and 3' splice junctions, or self-circularizing catalytic introns, such as Group I, Group II or Group III introns. Non-limiting examples of Group I intron self-splicing sequences can include the self-splicing replacement intron-exon sequences from the T4 bacteriophage gene td, and the intervening sequence (IVS) rRNA of Tetrahymena.

Other Circularization Methods In certain embodiments, linear circular polyribonucleotides may comprise complementary sequences, including repeating or non-repeating nucleic acid sequences within individual introns or across adjacent introns. A repetitive nucleic acid sequence is a sequence that occurs within a segment of a circular polyribonucleotide. In some embodiments, the circular polyribonucleotide comprises repeating nucleic acid sequences. In certain embodiments, the repetitive nucleotide sequence comprises poly CA or poly UG sequences. In certain embodiments, the circular polyribonucleotide comprises at least one repeated nucleic acid sequence that hybridizes to a complementary repeated nucleic acid sequence in another segment of the circular polyribonucleotide, wherein the hybridized segment is an internal double-stranded to form In certain embodiments, the repetitive nucleic acid sequence from two separate circular polyribonucleotides and the complementary repetitive nucleic acid sequence are hybridized to produce a single circularized polyribonucleotide, wherein the hybridized segments are internal Forms a double strand. In certain embodiments, complementary sequences are found at the 5' and 3' ends of linear circular polyribonucleotides. In some embodiments, the complementary sequences are about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, Contains 100 or more paired nucleotides.

In certain embodiments, chemical methods of circularization can be used to generate circular polyribonucleotides. Such methods include, but are not limited to, click chemistry (e.g. alkyne and azide based methods or clickable bases), olefin metathesis, phosphoroamide ligation, hemiaminal-imine cross-linking, base modification and any thereof. A combination of

In certain embodiments, enzymatic methods of circularization can be used to generate circular polyribonucleotides. In certain embodiments, a ligation enzyme, such as a DNA or RNA ligase, can be used to generate a circular polyribonuclease or complement template, a complementary strand of a circular polyribonuclease, or a circular polyribonuclease.

Circularization of circular polyribonucleotides can be achieved by methods known in the art, such as "RNA circulation strategies in vivo and in vitro" by Petkovic and Muller and RNA Biol, 2017, 14(8): 1018-1027, by Muller and Appel, "In vitro circularization of RNA".

Circular polyribonucleotides can encode sequences and/or motifs useful for replication. Exemplary replication elements are described in paragraphs [0280]-[0286] of WO2019/118919, which is incorporated herein by reference in its entirety.

Linear Polyribonucleotides The linear polyribonucleotides disclosed herein comprise sequences encoding antigens and/or epitopes from coronaviruses. This linear polyribonucleotide expresses sequences encoding antigens and/or epitopes from the coronavirus in a subject (eg, a subject for immunization). In certain embodiments, linear polyribonucleotides comprising coronavirus antigens and/or epitopes are used to generate an immune response in a subject (eg, a subject for immunization). In certain embodiments, the linear polyribonucleotide is mRNA and contains coronavirus antigens and/or epitopes that are used to generate an immune response in a subject (eg, a subject for immunization). In certain embodiments, linear polyribonucleotides comprising coronavirus antigens and/or epitopes are used to generate the polyclonal antibodies described herein.

Coronavirus Antigens and Epitopes Linear polyribonucleotides comprise sequences encoding coronavirus antigens or epitopes. Antigens and/or epitopes disclosed herein are associated with coronaviruses. In certain embodiments, the antigens and/or epitopes are expressed by a coronavirus or are derived from antigens and/or epitopes expressed by a coronavirus.

An antigen is a molecule that contains one or more epitopes (either linear, conformational, or both) that elicit an adaptive immune response in a subject (eg, a subject for immunization). An epitope can be that part of an antigen that is recognized, targeted, or bound by a given antibody or T-cell receptor. An epitope can be a linear epitope, eg, a contiguous sequence of amino acids. The epitope can be a conformational epitope, eg, an epitope containing amino acids that form an epitope in the folded conformation of a protein. A conformational epitope may contain noncontiguous amino acids from the primary amino acid sequence. Ordinarily, an epitope will comprise about 3-15, generally about 5-15, amino acids. A B-cell epitope is usually about 5 amino acids, but can be as long as 3-4 amino acids. A T-cell epitope, such as a CTL epitope, will include at least about 7-9 amino acids, and a helper T-cell epitope will include at least about 12-20 amino acids. Usually an epitope will comprise about 7-15 amino acids, eg 9, 10, 12 or 15 amino acids.

Coronavirus antigens or epitopes may be proteins, peptides, glycoproteins, lipoproteins, phosphoproteins, ribonucleoproteins, carbohydrates (e.g. polysaccharides), lipids (e.g. phospholipids or triglycerides), or nucleic acids (e.g. DNA, RNA). or may include all or part thereof.

Coronavirus antigens or epitopes can include protein antigens or epitopes (eg, peptide antigens or peptide epitopes from proteins, glycoproteins, lipoproteins, phosphoproteins, or ribonucleoproteins). Antigens or epitopes can include amino acids, sugars, lipids, phosphoryl, or sulfonyl groups, or combinations thereof.

A coronavirus protein antigen or epitope may comprise post-translational modifications such as glycosylation, ubiquitination, phosphorylation, nitrosylation, methylation, acetylation, amidation, hydroxylation, sulfation, or lipidation.

The antigen and/or epitope is a coronavirus surface protein, a coronavirus membrane protein, a coronavirus envelope protein, a coronavirus capsid protein, a coronavirus nucleocapsid protein, a coronavirus spike protein, a coronavirus receptor binding domain of the spike protein, a coronavirus entry protein, coronavirus membrane fusion protein, coronavirus structural protein, coronavirus nonstructural protein, coronavirus regulatory protein, coronavirus accessory protein, secreted coronavirus protein, coronavirus polymerase protein, coronavirus RNA polymerase, coronavirus protease, coronavirus It may be derived from a glycoprotein, a coronavirus fusion, a coronavirus helical capsid protein, a coronavirus icosahedral capsid protein, a coronavirus substrate protein, a coronavirus replicase, a coronavirus transcription factor, or a coronavirus enzyme.

In certain embodiments, antigens and/or epitopes of the present disclosure are derived from predicted transcripts from the SARS-CoV genome. In certain embodiments, the antigens and/or epitopes of this disclosure are derived from proteins encoded by open reading frames from the SARS-CoV genome. Non-limiting examples of open reading frames in the SARS-CoV genome are ORF1a, ORF1b, spike (S), ORF3a, ORF3b, envelope (E), membrane (M), ORF6, ORF7a, ORF7b, ORF8, ORF8a, ORF8b , ORF9a, ORF9b, nucleocapsid (N), and ORF10. In one embodiment, the open reading frame from the SARS-CoV genome comprises SEQ ID NO:11.

In certain embodiments, the linear polyribonucleotides comprise SARS-CoV-2 antigens listed in Table 3.

In Table 3, "proline substitutions" indicates proline substitutions at residues 986 and 987 and a "GSAS" substitution at the furin cleavage site (residues 682-685). Cloning optimization made a single base substitution at coordinate 2541 to destroy a BsaI site that aids in Golden Gate Cloning construction of the plasmid DNA template. In the circularization optimization, four single nucleotides at positions 2307, 2709, 159 and 315 were replaced to destroy sites that could potentially bind to the circularization element of the splint nucleic acid sequence, thereby effectively potentially inhibits successful ligation. All single bp substitutions were designed to be translationally silent. Further, in Table 3, the 5' element is globin (SEQ ID NO:32); the 3' element: globin (SEQ ID NO:33).

In some embodiments, the coronavirus epitopes are at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 amino acids, or more or contain. In certain embodiments, the coronavirus epitopes are 18 or less, 19 or less, 20 or less, 21 or less, 22 or less, 23 or less, 24 or less, 25 or less, 26 or less, 27 or less, 28 or less, 29 or less, or 30 or less amino acids, or less or contain. In certain embodiments, the coronavirus epitopes are comprises or contains 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. In certain embodiments, the coronavirus epitope contains 5 amino acids. In certain embodiments, the coronavirus epitope contains 6 amino acids. In certain embodiments, the epitope contains 7 amino acids. In certain embodiments, the coronavirus epitope contains 8 amino acids. In certain embodiments, an epitope can be from about 8 to about 11 amino acids. In certain embodiments, an epitope can be from about 9 to about 22 amino acids.

Coronavirus antigens may include antigens recognized by B cells, antigens recognized by T cells, or a combination thereof. In certain embodiments, antigens include antigens recognized by B cells. In certain embodiments, the coronavirus antigen is an antigen recognized by B cells. In certain embodiments, coronavirus antigens include antigens recognized by T cells. In certain embodiments, the antigen is an antigen recognized by T cells.

Coronavirus epitopes include epitopes recognized by B cells, epitopes recognized by T cells, or combinations thereof. In certain embodiments, coronavirus epitopes include epitopes recognized by B cells. In certain embodiments, the epitope is an epitope recognized by B cells. In certain embodiments, coronavirus epitopes include epitopes recognized by T cells. In certain embodiments, the coronavirus epitope is an epitope recognized by T cells.

Techniques for identifying antigens and epitopes in silico are described, for example, in Sanchez-Trincado, et al. (2017), Fundamentals and methods for T-and B-cell epitope prediction, Journal of immunology research; Grifoni, Alba, et al. A Sequence Homology and Bioinformatic Approach Can Predict Candidate Targets for Immune Responses to SARS-CoV-2. Cell host & microbe (2020); Russi et al. In silico prediction of T-and B-cell epitopes in PmpD: First step to the design of a Chlamydia trachomatis vaccine. biomedical journal 41.2 (2018): 109-117; Baruah, et al. Immunoinformatics-aided identification of T cell and B cell epitopes in the surface glycoprotein of 2019-nCoV. Journal of Medical Virology (2020); each of which is hereby incorporated by reference in its entirety.

Linear polyribonucleotides of the disclosure may comprise sequences of various coronavirus antigens and/or epitopes. Linear polyribonucleotides are, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30 , at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, or more sequences of coronavirus antigens or epitopes.

In some embodiments, the linear polyribonucleotide is, for example, 1 or less, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, 20 or less, 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 or less, 350 or less , 400 or less, 450 or less, 500 or less, or less sequences of coronavirus antigens or epitopes.

In certain embodiments, linear polyribonucleotides are, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70 , 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 coronavirus antigens or epitopes.

A linear polyribonucleotide may contain a sequence for one or more coronavirus epitopes from a coronavirus antigen. For example, a coronavirus antigen may comprise an amino acid sequence that may contain multiple coronavirus epitopes (e.g., epitopes recognized by B-cells and/or T-cells) therein, and the linear polyribonucleotides are those corona virus epitopes. It may contain or encode one or more of the viral epitopes.

Linear polyribonucleotides are, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, Include a sequence of at least 350, at least 400, at least 450, at least 500, or more epitopes.

In certain embodiments, linear polyribonucleotides are, e.g., 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less , 20 or less, 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 The following includes sequences of 350 or less, 400 or less, 450 or less, or 500 or less, or less coronavirus epitopes.

In certain embodiments, linear polyribonucleotides are, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 coronavirus epitope sequences.

Linear polyribonucleotides can encode variants of coronavirus antigens or epitopes. Variants can be natural variants (e.g., variants identified in sequence data from different coronavirus genera, species, isolates, or quasispecies) or those disclosed herein generated in silico. derivative sequences (eg, antigens or epitopes having one or more amino acid insertions, deletions, substitutions, or combinations thereof as compared to the wild-type antigen or epitope).

Linear polyribonucleotides are, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20 of a coronavirus antigen or epitope. , at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, at least Include sequences of 350, at least 400, at least 450, at least 500, or more variants.

In certain embodiments, the linear polyribonucleotide is, for example, 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less of the coronavirus antigen or epitope, 20 or less, 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 or less , 350 or less, 400 or less, 450 or less, 500 or less, or less sequences of variants.

In certain embodiments, the linear polyribonucleotide is, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40 of a coronavirus antigen or epitope. , 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 variants.

Linear polyribonucleotide coronavirus antigen and/or epitope sequences may also be referred to as coronavirus expression sequences. In certain embodiments, a linear polyribonucleotide comprises one or more coronavirus expression sequences, each of which may encode a coronavirus polypeptide. Coronavirus polypeptides can be produced in substantial quantities. A coronavirus polypeptide can be a coronavirus polypeptide that is secreted from the cell or confined to the cytoplasm, nucleus or membrane compartment of the cell. Some coronavirus polypeptides include, but are not limited to, antigens disclosed herein, epitopes disclosed herein, coronavirus proteins (e.g., viral envelope protein, viral matrix protein, viral spike protein, , viral membrane proteins, viral nucleocapsid proteins, viral accessory proteins, fragments thereof, or combinations thereof). In certain embodiments, coronavirus polypeptides encoded by linear polyribonucleotides of the present disclosure comprise fragments of the coronavirus antigens disclosed herein. In certain embodiments, coronavirus polypeptides encoded by linear polyribonucleotides of the present disclosure comprise fusion proteins, or fragments thereof, comprising two or more coronavirus antigens disclosed herein. In certain embodiments, coronavirus polypeptides encoded by linear polyribonucleotides of the disclosure comprise coronavirus epitopes. In certain embodiments, a polypeptide encoded by a linear polyribonucleotide of the disclosure is a fusion protein comprising two or more coronavirus epitopes disclosed herein, e.g., one or more coronaviruses of the disclosure. Contains artificial peptide sequences containing multiple predicted epitopes from viruses.

In certain embodiments, exemplary coronavirus proteins expressed from the linear polyribonucleotides disclosed herein are secreted proteins, e.g., proteins that naturally contain signal peptides (e.g., antigens and/or epitopes) , or those that do not normally encode a signal peptide, but have been modified to include one.

Linear Polyribonucleotides Linear polyribonucleotides comprise the elements described below as well as the coronavirus antigens or epitopes described herein.

A linear polyribonucleotide as described herein is a polyribonucleotide molecule having 5' and 3' ends. In certain embodiments, linear RNAs have free 5' or 3' ends. In certain embodiments, linear RNAs have 5' or 3' ends that are modified or protected from degradation. In certain embodiments, linear RNAs have 5' or 3' ends that are non-covalently linked. In certain embodiments, the linear RNA is mRNA.

Linear RNAs can be modified at their ends to improve stability and/or reduce degradation. For example, 5′ free ends and/or 3′ free ends are caps, poly-A tails, G-quadruplexes, pseudoknots, stable terminal stem loops, U-rich expression, nuclear retention elements ( ENE), or conjugation moieties. For example, the 5′ free end and/or the 3′ free end can be treated with end blocking agents such as caps, poly-A tails, g-quadruplexes, pseudoknots, stable terminal stem loops, U-rich expression, nuclear retention elements. (ENE), or a conjugation moiety.

In some embodiments, the linear polyribonucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides. nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least About 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.

In certain embodiments, a linear polyribonucleotide can be of sufficient size to accommodate a binding site for a ribosome. In certain embodiments, the maximum size of a linear polyribonucleotide can be such that it is within the technical constraints of producing and/or using linear polyribonucleotides. While not wishing to be bound by any particular theory, multiple segments of RNA are generated from DNA and their 5' and 3' free ends are annealed to produce a "string" of RNA. It is possible that In certain embodiments, the maximum size of linear polyribonucleotides may be limited by their ability to package and deliver RNA to a target. In certain embodiments, the size of the linear polyribonucleotide is long enough to encode useful polypeptides, such as antigens and/or epitopes of the present disclosure, thus at least 20,000 nucleotides, at least 15,000 nucleotides, at least 10,000 nucleotides, at least 7,500 nucleotides, or at least 5,000 nucleotides, at least 4,000 nucleotides, at least 3,000 nucleotides, at least 2,000 nucleotides, at least 1,000 nucleotides, at least 500 nucleotides, at least 400 nucleotides, at least 300 nucleotides, at least 200 nucleotides, at least 100 nucleotides, or at least 70 nucleotides Nucleotide lengths can be useful.

Linear Polyribonucleotide Elements In certain embodiments, linear polyribonucleotides contain one or more of the elements described herein in addition to containing sequences encoding coronavirus antigens and/or epitopes. . For example, linear polyribonucleotides contain regulatory elements, eg, sequences that regulate expression of an expressed sequence within the linear polyribonucleotide. Regulatory elements can include sequences flanking an expressed sequence that encode an expression product. A regulatory element can be operably linked to an adjacent sequence. A regulatory element can increase the amount of product expressed compared to the amount of product expressed in the absence of the regulatory element. In addition, a single regulatory element can increase the amount of product expressed for multiple expression sequences linked side by side. Thus, a single regulatory element can drive expression of more than one expressed sequence. Multiple regulatory elements can also be used, eg, to differentially regulate the expression of different expressed sequences. In certain embodiments, regulatory elements provided herein can include alternative translation sequences. As used herein, the term "selectively translated sequence" refers to a sequence that selectively initiates or activates translation of expressed sequences in linear polyribonucleotides, such as certain riboswitch aptazymes. It refers to a nucleic acid sequence that Regulatory elements can also include selective degradation sequences. As used herein, the term "selective degradation sequence" refers to a nucleic acid sequence that initiates degradation of a linear polyribonucleotide or expression product of a linear polyribonucleotide. In certain embodiments, the regulatory element is a translational modulator. A translation modulator can regulate translation of an expressed sequence in a linear polyribonucleotide. A translational modulator may be a translational enhancer or suppressor. In certain embodiments, translation initiation sequences may function as regulatory elements.

In certain embodiments, the linear polyribonucleotide encodes the antigen for generating the polyclonal antibody of interest and includes translation initiation sequences, eg, initiation codons. In some embodiments, the translation initiation sequence comprises a Kozak or Shine-Dalgarno sequence. In certain embodiments, the linear polyribonucleotide includes a translation initiation sequence, eg, a Kozak sequence, adjacent to the expressed sequence. In some embodiments, the translation initiation sequence is a non-coding initiation codon. In certain embodiments, translation initiation sequences, eg, Kozak sequences, are present on one or both sides of each expressed sequence to provide for separation of the expression products. In certain embodiments, the linear polyribonucleotide includes at least one translation initiation sequence that flanks the expressed sequence. In certain embodiments, the translation initiation sequence confers conformational flexibility to the linear polyribonucleotide. In certain embodiments, the translation initiation sequence is within a substantially single-stranded region of the linear polyribonucleotide.

In certain embodiments, the linear polyribonucleotides described herein contain an internal ribosome entry site (IRES) element. A suitable IRES element for inclusion in a linear polyribonucleotide can be an RNA sequence capable of engaging eukaryotic ribosomes.

A linear polyribonucleotide can include one or more expressed sequences (eg, encoding an antigen), each expressed sequence with or without termination elements.

In certain embodiments, the linear polynucleotide comprises a 5'cap, wherein the 5'cap structure of the mRNA increases mRNA stability. The 5′ cap binds to the mRNA cap-binding protein (MBP), which contributes to intracellular mRNA stability and translational capacity through binding of CBP to poly-A binding protein, resulting in the formation of mature RNA species. to form

In certain embodiments, the linear polynucleotide is 5' end-capped and includes a 5'-ppp-5' triphosphate linkage between the linear polynucleotide terminal guanosine cap residue and the 5' terminal transcribed sense nucleotide. This 5' guanosine cap, also known as the 5' guanylated cap, can be methylated to produce the N7-methyl-guanylate cap.

In certain embodiments, linear polyribonucleotides include untranslated regions (UTRs). UTRs of genomic regions containing genes can be transcribed but not translated. In certain embodiments, UTRs may be included upstream of the translation initiation sequences of the expressed sequences described herein. In certain embodiments, UTRs can be included downstream of the expression sequences described herein. In some cases, one UTR for the first expressed sequence is the same as, contiguous with, or overlapping with another UTR for the second expressed sequence. In some embodiments, the intron is a human intron. In certain embodiments, the intron is a full-length human intron, eg, ZKSCAN1.

In some embodiments, linear polyribonucleotides comprise poly-A sequences. In certain embodiments, the length of the poly-A sequence is greater than 10 nucleotides long. In certain embodiments, the poly-A sequence is greater than 15 nucleotides in length (eg, at least or about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, greater than 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In certain embodiments, the poly-A sequence is about 10 to about 3,000 nucleotides (eg, 30-50, 30-100, 30-250, 30-500, 30-750, 30-1,000, 30-1,500, 30-2,000, 30-2,500, 50-100, 50-250, 50-500, 50-750, 50-1,000, 50-1,500, 50-2, 000, 50-2,500, 50-3,000, 100-500, 100-750, 100-1,000, 100-1,500, 100-2,000, 100-2,500, 100-3, 000, 500-750, 500-1,000, 500-1,500, 500-2,000, 500-2,500, 500-3,000, 1,000-1,500, 1,000-2, 000, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 3,000, 2,000-2,500 and 2,500-3,000).

In some embodiments, the poly-A sequence is designed to span the length of the entire linear polyribonucleotide. Designs can be based on the length of the coding region, the length of particular features or regions (such as the first or flanking regions), or the length of the final product expressed from the linear polyribonucleotides. In this regard, the poly-A sequence can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than a linear polyribonucleotide or feature thereof. A poly-A sequence can also be designed as part of a linear polyribonucleotide. In this regard, the poly-A sequence is the full length of the construct or the full length of the construct minus 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or It can be more. In addition, engineered binding sites and conjugation of linear polyribonucleotides for poly-A binding protein can facilitate expression.

In certain embodiments, linear polyribonucleotides are designed to comprise a poly AG quadruplex. A G-quadruplex is a circular, hydrogen-bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In certain embodiments, G-quadruplexes can be incorporated at the ends of poly-A sequences. The resulting linear polyribonucleotide constructs can be assayed at various time points for other parameters including stability, protein production, and/or half-life. In certain embodiments, poly A-G quadruplexes can result in protein production equivalent to at least 75% of that seen with poly-A sequences of only 120 nucleotides.

In certain embodiments, linear polyribonucleotides comprise UTRs having one or more stretches of adenosine and uridine embedded therein. AU-rich signatures can increase the turnover rate of expression products.

Introduction, removal, or modification of UTR AU-rich elements (AREs) can be useful in modulating the stability or immunogenicity of linear polyribonucleotides. When engineering a particular linear polyribonucleotide, one or more copies of the ARE can be introduced to destabilize the linear polyribonucleotide, copies of the ARE reduce translation, and/or Production of the expression product can be reduced. Similarly, AREs can be identified, removed, or mutated to enhance intracellular stability and thus increase translation and production of the resulting protein.

UTRs from any gene can be incorporated into each flanking region of a linear polyribonucleotide (eg, at the 5' or 3' terminus). In addition, multiple wild-type UTRs of any known gene can be used. In some embodiments, artificial UTRs that are not mutants of wild-type genes can be used. These UTRs, or portions thereof, can be placed in the same orientation as the transcript from which they are selected, or can be altered in orientation or position. Thus, a 5'- or 3'-UTR can be inverted, shortened, lengthened, or chimeric with one or more other 5'- or 3'-UTRs. As used herein, the term "modified" when referring to a UTR sequence means that the UTR has been altered in some way with respect to the reference sequence. For example, the 3'- or 5'-UTR can be altered relative to the wild-type or native UTR by changes in orientation or position as taught above, or inclusion of additional nucleotides, deletion of nucleotides, swapping of nucleotides. or may be modified by transposition. Any of these changes that produce an "altered" UTR (whether 3' or 5') include mutant UTRs.

In certain embodiments, double UTRs, triple UTRs, or quadruple UTRs, such as 5'- or 3'-UTRs, may be used. As used herein, a "duplex" UTR is one in which two copies of the same UTR are encoded consecutively or substantially consecutively. For example, dual β-globin 3'-UTRs may be used in certain embodiments of the invention.

In certain embodiments, the linear polyribonucleotide comprises one or more regulatory nucleic acid sequences or one or more encoding regulatory nucleic acids, e.g., nucleic acids that regulate the expression of endogenous and/or exogenous genes. contains an expression sequence for In certain embodiments, the linear polyribonucleotide expression sequences provided herein include, but are not limited to, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, It may contain sequences that are antisense to regulatory nucleic acids such as non-coding RNAs such as scaRNA, Y RNA, and hnRNA.

In certain embodiments, linear polyribonucleotides produce stoichiometric ratios of expression products. In certain embodiments, linear polyribonucleotides have stoichiometric translation efficiencies such that expression products are produced in substantially equal proportions. In certain embodiments, the linear polyribonucleotide is a multiple expression product, e.g., products from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more expressed sequences. has a stoichiometric translation efficiency of

In certain embodiments, a linear polyribonucleotide comprises one or more riboswitches.

In certain embodiments, linear polyribonucleotides include aptazymes.

In some embodiments, the linear polyribonucleotide lacks a 5'-UTR. In some embodiments, the linear polyribonucleotide lacks a 3'-UTR. In some embodiments, the linear polyribonucleotide lacks poly-A sequences. In certain embodiments, linear polyribonucleotides lack termination elements. In certain embodiments, the linear polyribonucleotide lacks an internal ribosome entry site. In certain embodiments, the linear polyribonucleotide lacks binding to a cap-binding protein. In some embodiments, the linear polyribonucleotide lacks a 5' cap.

Methods of Production In certain embodiments, the linear polyribonucleotides are non-naturally occurring deoxyribonucleic acids that can be produced using recombinant techniques (e.g., obtained in vitro using DNA plasmids), chemical synthesis, or a combination thereof. Contains arrays.

The DNA molecule used to generate the RNA may be a DNA sequence of the original nucleic acid sequence in nature, modified forms thereof, or synthetic polypeptides not commonly found in nature (e.g., chimeric molecules or fusion proteins, e.g., multiple It is within the scope of this disclosure to include DNA sequences encoding antigens and/or epitope-containing fusion proteins). DNA and RNA molecules are subject to, but are not limited to, site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR). Classical mutagenesis techniques such as amplification and/or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures and ligation of mixtures to "build" mixtures of nucleic acid molecules and combinations thereof. and modified using a variety of techniques, including recombinant techniques.

Linear polyribonucleotides may be prepared according to any available technique, including but not limited to chemical and enzymatic synthesis. In certain embodiments, linear primary constructs or linear mRNAs may be concatemerized to generate linear polyribonucleotides described herein. Mechanisms of concatemerization can be performed by methods such as, but not limited to, chemical, enzymatic, splint ligation), or ribozyme-catalyzed methods. The newly formed 5'-/3'-bond can be an intramolecular bond or an intermolecular bond.

Methods of making the linear polyribonucleotides described herein are described, for example, in Khudyakov & Fields, Artificial DNA: Methods and Applications, CRC Press (2002); Zhao, Synthetic Biology: Tools and Applications, (F First Edition) , Academic Press (2013); and Egli & Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012).

Various methods of synthesizing linear polyribonucleotides have also been described in the art (e.g., US Pat. No. 6,210,931; US Pat. No. 5,773,244; US Pat. No. 5,766,903; U.S. Patent No. 5,712,128, U.S. Patent No. 5,426,180, U.S. Patent Application Publication No. 20100137407, WO 1992001813 and WO 2010084371; the entire contents of each are incorporated herein by reference. incorporated by reference).

Methods of Producing an Immune Response The present disclosure provides immunogenic compositions comprising the cyclic polyribonucleotides described above. The disclosure provides immunogenic compositions comprising the linear polyribonucleotides described above. An immunogenic composition of the invention may comprise a diluent or carrier, an adjuvant, or any combination thereof. Immunogenic compositions of the invention can also include one or more immunomodulatory agents, eg, one or more adjuvant agents. The adjuvant may comprise a TH1 adjuvant and/or a TH2 adjuvant, further described below. In certain embodiments, an immunogenic composition comprises a carrier-free diluent and is used for naked delivery of cyclic polyribonucleotides to a subject (eg, a subject for immunization). In certain embodiments, the immunogenic composition comprises a carrier-free diluent and is used for naked delivery of linear polyribonucleotides to a subject.

Immunogenic compositions of the invention are used to enhance an immune response in a subject (eg, a subject for immunization). An immune response may include an antibody response (usually including IgG) and/or a cell-mediated immune response. In certain embodiments, immunogenic compositions are used to generate the polyclonal antibodies described herein. For example, a subject is immunized with an immunogenic composition comprising cyclic polyribonucleotides comprising coronavirus antigens and/or epitopes to stimulate the production of polyclonal antibodies that bind to coronavirus antigens and/or epitopes. . In another example, the subject is treated with an immunogenic composition comprising linear polyribonucleotides comprising coronavirus antigens and/or epitopes to stimulate the production of polyclonal antibodies that bind to coronavirus antigens and/or epitopes. immunized. In some embodiments, the subject is human. In certain embodiments, the subject is a non-human animal. In certain embodiments, the non-human animal has a humanized immune system. In certain embodiments, the subject is further immunized with an adjuvant. In certain embodiments, the subject is further immunized with a vaccine. Optionally, after immunization with an immunogenic composition comprising cyclic polyribonucleotides, the polyclonal antibodies produced are harvested from the subject and purified. Optionally, after immunization with an immunogenic composition comprising linear polyribonucleotides, the polyclonal antibodies produced are obtained from the subject and purified. In certain embodiments, the composition comprises plasma collected after administration of an immunogenic composition described herein.

Immunization In certain embodiments, the methods of the disclosure comprise immunizing a subject (e.g., a subject for immunization) with an immunogenic composition comprising a cyclic polyribonucleotide disclosed herein. include. In certain embodiments, coronavirus antigens and/or epitopes are expressed from cyclic polyribonucleotides. In certain embodiments, immunization induces an immune response in a subject against coronavirus antigens and/or epitopes expressed from cyclic polyribonucleotides. In certain embodiments, immunization induces production of polyclonal antibodies that bind to coronavirus antigens and/or epitopes expressed from cyclic polyribonucleotides. In certain embodiments, an immunogenic composition comprises a cyclic polyribonucleotide and a diluent, carrier, first adjuvant or combination thereof in a single composition. In certain embodiments, the subject is further immunized with a second adjuvant. In certain embodiments, the subject is further immunized with a vaccine.

In certain embodiments, the methods of the present disclosure comprise immunizing a subject (e.g., a subject for immunization) with an immunogenic composition comprising linear polyribonucleotides disclosed herein . In certain embodiments, coronavirus antigens and/or epitopes are expressed from linear polyribonucleotides. In certain embodiments, immunization induces an immune response in a subject against coronavirus antigens and/or epitopes expressed from linear polyribonucleotides. In certain embodiments, immunization induces production of polyclonal antibodies that bind to coronavirus antigens and/or epitopes expressed from linear polyribonucleotides. In certain embodiments, an immunogenic composition comprises linear polyribonucleotides and a diluent, carrier, first adjuvant or combination thereof in a single composition. In certain embodiments, the subject is further immunized with a second adjuvant. In certain embodiments, the subject is further immunized with a vaccine.

The cyclic polyribonucleotides disclosed herein stimulate the production of human polyclonal antibodies by stimulating an adaptive immune response after immunization of a subject (eg, a subject for immunization). In certain embodiments, the subject's adaptive immune response comprises stimulation of B lymphocytes to release polyclonal antibodies that specifically bind to coronavirus antigens expressed by cyclic polyribonucleotides. The linear polyribonucleotides disclosed herein stimulate the production of human polyclonal antibodies by stimulating an adaptive immune response after immunization of a subject. In certain embodiments, the subject's adaptive immune response comprises stimulation of B lymphocytes to release polyclonal antibodies that specifically bind to coronavirus antigens expressed by linear polyribonucleotides. In certain embodiments, the subject's adaptive immune response comprises stimulating a cell-mediated immune response.

A subject (eg, a subject for immunization) is immunized with one or more immunogenic compositions comprising a number of cyclic polyribonucleotides. A subject is immunized with, for example, one or more immunogenic compositions comprising at least one cyclic polyribonucleotide. Non-human animals having a non-humanized immune system are e.g. Immunized with one or more immunogenic compositions comprising at least 14, at least 15, at least 20 different cyclic polyribonucleotides, or more different cyclic polyribonucleotides. In certain embodiments, a subject is immunized with one or more immunogenic compositions comprising one or less cyclic polyribonucleotides. In some embodiments, the non-human animal with a humanized immune system is 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 11 or less, 12 or less, 13 or less. The following are immunized with one or more immunogenic compositions comprising 14 or fewer, 15 or fewer, 20 or fewer different cyclic polyribonucleotides, or less than 21 different cyclic polyribonucleotides. In certain embodiments, a subject is immunized with one or more immunogenic compositions comprising about one cyclic polyribonucleotide. In certain embodiments, the non-human animal with a humanized immune system is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about Immunized with one or more immunogenic compositions comprising 13, about 14, about 15, or about 20 different cyclic polyribonucleotides. In some embodiments, the subject is about 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1 ~2, 2~20, 2~15, 2~10, 2~9, 2~8, 2~7, 2~6, 2~5, 2~4, 2~3, 3~20, 3~15 , 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-20, 4-15, 4-10, 4-9, 4-8, 4 ~7, 4~6, 4~5, 4~4, 4~3, 5~20, 5~15, 5~10, 5~9, 5~8, 5~7, 5~6, 5~10 , 10-15, or 15-20 different cyclic polyribonucleotides. Different cyclic polyribonucleotides have different sequences from each other. For example, they may be different antigens and/or epitopes, overlapping antigens and/or epitopes, similar antigens and/or epitopes, or the same antigens and/or epitopes (e.g., same or different regulatory elements, initiation sequences, promoters, termination element, or together with other elements of this disclosure). When a subject is immunized with one or more immunogenic compositions comprising two or more different cyclic polyribonucleotides, the two or more different cyclic polyribonucleotides are the same or different immunogenic compositions. and can be immunized at the same time or at different times. An immunogenic composition comprising two or more different cyclic polyribonucleotides can be administered at the same anatomical location or at different anatomical locations.

The two or more different cyclic polyribonucleotides may contain or encode antigens and/or epitopes from the same coronavirus, different coronaviruses, or different combinations of coronaviruses disclosed herein. The two or more different cyclic polyribonucleotides may contain or encode antigens and/or epitopes from the same coronavirus or different coronaviruses, eg, different isolates.

A subject (eg, a subject for immunization) is immunized with one or more immunogenic compositions comprising a number of linear polyribonucleotides. A subject is immunized with, for example, one or more immunogenic compositions comprising at least one linear polyribonucleotide. Non-human animals having a non-humanized immune system are e.g. Immunized with one or more immunogenic compositions comprising at least 14, at least 15, at least 20 different linear polyribonucleotides, or more different linear polyribonucleotides. In certain embodiments, a subject is immunized with one or more immunogenic compositions comprising one or less linear polyribonucleotides. In some embodiments, the non-human animal with a humanized immune system is 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 11 or less, 12 or less, 13 or less. The following are immunized with one or more immunogenic compositions comprising 14 or fewer, 15 or fewer, 20 or fewer different linear polyribonucleotides, or less than 21 different linear polyribonucleotides. In certain embodiments, a subject is immunized with one or more immunogenic compositions comprising about one linear polyribonucleotide. In certain embodiments, the non-human animal with a humanized immune system is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about Immunized with one or more immunogenic compositions comprising 13, about 14, about 15, or about 20 different linear polyribonucleotides. In some embodiments, the subject is about 1-20, 1-15, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1 ~2, 2~20, 2~15, 2~10, 2~9, 2~8, 2~7, 2~6, 2~5, 2~4, 2~3, 3~20, 3~15 , 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-20, 4-15, 4-10, 4-9, 4-8, 4 ~7, 4~6, 4~5, 4~4, 4~3, 5~20, 5~15, 5~10, 5~9, 5~8, 5~7, 5~6, 5~10 , 10-15, or 15-20 different linear polyribonucleotides. Different linear polyribonucleotides have different sequences from each other. For example, they may be different antigens and/or epitopes, overlapping antigens and/or epitopes, similar antigens and/or epitopes, or the same antigens and/or epitopes (e.g., same or different regulatory elements, initiation sequences, promoters, termination element, or together with other elements of this disclosure). When a subject is immunized with one or more immunogenic compositions comprising two or more different linear polyribonucleotides, the two or more different linear polyribonucleotides have the same or different immunogenicity. may be in the composition and immunized at the same time or at different times. An immunogenic composition comprising two or more different linear polyribonucleotides can be administered at the same anatomical location or at different anatomical locations.

The two or more different linear polyribonucleotides may comprise or encode antigens and/or epitopes from the same coronavirus, different coronaviruses, or different combinations of coronaviruses disclosed herein. The two or more different linear polyribonucleotides may comprise or encode antigens and/or epitopes from the same coronavirus or different coronaviruses, eg different isolates.

In certain embodiments, a subject (e.g., for immunization) is administered one or more immunogenic compositions comprising a number of cyclic polyribonucleotides and a number of linear polyribonucleotides disclosed herein. immunized with one or more immunogenic compositions comprising In certain embodiments, an immunogenic composition disclosed herein comprises one or more cyclic polyribonucleotides and one or more linear polyribonucleotides disclosed herein.

In certain embodiments, an immunogenic composition comprises a cyclic polyribonucleotide and a diluent, carrier, first adjuvant, or combination thereof. In certain embodiments, an immunogenic composition comprises a cyclic polyribonucleotide described herein and a carrier, or a carrier-free diluent. In certain embodiments, an immunogenic composition comprising a cyclic polyribonucleotide with a carrier-free diluent is used for naked delivery of the cyclic polyribonucleotide to a subject. In another specific embodiment, an immunogenic composition comprises a cyclic polyribonucleotide as described herein and a first adjuvant.

In certain embodiments, the subject (eg, the subject for immunization) is further administered a second adjuvant. Adjuvants promote the innate immune response, which in turn promotes the adaptive immune response for the production of polyclonal antibodies in the subject. The adjuvant can be any adjuvant described below. In certain embodiments, adjuvants are formulated with cyclic polyribonucleotides as part of the immunogenic composition. In certain embodiments, the adjuvant is not part of an immunogenic composition comprising cyclic polyribonucleotides. In certain embodiments, the adjuvant is administered separately from the immunogenic composition comprising cyclic polyribonucleotides. In this aspect, the adjuvant is co-administered (eg, administered at the same time) or administered at different times to the subject with the immunogenic composition comprising the cyclic polyribonucleotide. For example, the adjuvant can be used for 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, 4 hours of an immunogenic composition comprising a cyclic polyribonucleotide. hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours, or any time therebetween It is administered after minutes or hours. In certain embodiments, the adjuvant is 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours of the immunogenic composition comprising a cyclic polyribonucleotide. hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours before or between administered any minute or hour before For example, the adjuvant is 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 of an immunogenic composition comprising a cyclic polyribonucleotide. , 77, or 84 days, or any number of days in between. In certain embodiments, the adjuvant is 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, or 84 days prior, or any number of days in between. The adjuvant is administered at the same anatomical location or at a different anatomical location as the immunogenic composition comprising the cyclic polyribonucleotide.

In certain embodiments, an immunogenic composition comprises a linear polyribonucleotide and a diluent, carrier, first adjuvant, or a combination thereof. In certain embodiments, an immunogenic composition comprises a linear polyribonucleotide described herein and a carrier, or a diluent without a carrier. In certain embodiments, immunogenic compositions comprising linear polyribonucleotides with a carrier-free diluent are used for naked delivery of linear polyribonucleotides to a subject (e.g., a subject for immunization). be. In another specific embodiment, an immunogenic composition comprises a linear polyribonucleotide as described herein and a first adjuvant.

In certain embodiments, the subject (eg, the subject for immunization) is further administered a second adjuvant. Adjuvants promote the innate immune response, which in turn promotes the adaptive immune response for the production of polyclonal antibodies in the subject. The adjuvant can be any adjuvant described below. In certain embodiments, adjuvants are formulated with linear polyribonucleotides as part of the immunogenic composition. In certain embodiments, the adjuvant is not part of an immunogenic composition comprising linear polyribonucleotides. In certain embodiments, the adjuvant is administered separately from the immunogenic composition comprising linear polyribonucleotides. In this embodiment, the adjuvant is co-administered (eg, administered at the same time) or administered at different times to the subject with the immunogenic composition comprising the linear polyribonucleotide. For example, the adjuvant can be used for 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, or 3 hours of an immunogenic composition comprising linear polyribonucleotides. After 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours, or any time therebetween minutes or hours later. In certain embodiments, the adjuvant is an immunogenic composition comprising linear polyribonucleotides for 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours prior to before any minute or hour in between. For example, the adjuvant may be 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, After 70, 77, or 84 days, or any number of days in between. In certain embodiments, the adjuvant is 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56 of an immunogenic composition comprising linear polyribonucleotides. , 63, 70, 77, or 84 days before, or any number of days in between. The adjuvant is administered at the same anatomical location or at a different anatomical location as the immunogenic composition comprising linear polyribonucleotides.

In certain embodiments, the subject (eg, for immunization) is further immunized with a second agent that is not a cyclic polyribonucleotide, eg, a vaccine (as described below). The vaccine is co-administered (eg, administered at the same time) or administered at different times to the subject with an immunogenic composition comprising a cyclic polyribonucleotide. For example, the vaccine may be administered for 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, 4 hours of an immunogenic composition comprising a cyclic polyribonucleotide. , 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours, or any minute therebetween Or administered after hours. In certain embodiments, the vaccine is 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours of an immunogenic composition comprising a cyclic polyribonucleotide. , 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours before, or during Any minute or hour prior to administration. For example, the vaccine is 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, After 77 or 84 days, or any number of days in between. In certain embodiments, the vaccine is 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63 of an immunogenic composition comprising a cyclic polyribonucleotide. , 70, 77, or 84 days later, or any number of days therebetween.

In certain embodiments, the subject (eg, for immunization) is further immunized with a second agent that is not a linear polyribonucleotide, eg, a vaccine (as described below). The vaccine is co-administered (eg, administered at the same time) or administered at different times to the subject with an immunogenic composition comprising linear polyribonucleotides. For example, the vaccine may be administered at 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, 4 hours of an immunogenic composition comprising linear polyribonucleotides. hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours, or any time therebetween It is administered after minutes or hours. In certain embodiments, the vaccine is 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours, an immunogenic composition comprising linear polyribonucleotides. hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, or 24 hours before or between administered any minute or hour before For example, vaccines are 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70 immunogenic compositions comprising linear polyribonucleotides. , 77, or 84 days, or any number of days in between. In certain embodiments, the vaccine is an immunogenic composition comprising linear polyribonucleotides of 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, or 84 days prior, or any number of days in between.

A subject (e.g., for immunization) may be administered the immunogenic composition, adjuvant, vaccine (e.g., protein subunit vaccine), or combination thereof any suitable number of times to obtain the desired response. can be immunized with For example, a prime-boost immunization approach can be used to generate hyperimmune plasma containing high concentrations of antibodies that bind to antigens and/or epitopes of the disclosure. Subjects are, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, immunogenic compositions, adjuvants, vaccines (e.g., protein subunit vaccines), or combinations thereof of the present disclosure. , at least 7, at least 8, at least 9, at least 10, or at least 15 times, or more.

In certain embodiments, a subject (e.g., for immunization) is administered an immunogenic composition of the present disclosure, an adjuvant, a vaccine (e.g., a protein subunit vaccine), or a combination thereof no more than twice, It may be immunized 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less, or 20 or less, or less.

In certain embodiments, the subject (eg, for immunization) is about 1, 2, 1, 2 or 3 with an immunogenic composition of the present disclosure, an adjuvant, a vaccine (eg, protein subunit vaccine), or a combination thereof. , 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 times.

In certain embodiments, a subject (e.g., for immunization) is immunized once with an immunogenic composition of the present disclosure, an adjuvant, a vaccine (e.g., protein subunit vaccine), or a combination thereof. can be In certain embodiments, a subject may be immunized twice with an immunogenic composition, adjuvant, vaccine (eg, protein subunit vaccine) of the disclosure, or a combination thereof. In certain embodiments, a subject may be immunized three times with an immunogenic composition, adjuvant, vaccine (eg, protein subunit vaccine) of the disclosure, or a combination thereof. In certain embodiments, a subject may be immunized four times with an immunogenic composition, adjuvant, vaccine (eg, protein subunit vaccine) of the disclosure, or a combination thereof. In certain embodiments, a subject can be immunized 5 times with an immunogenic composition, adjuvant, vaccine (eg, protein subunit vaccine) of the disclosure, or a combination thereof. In certain embodiments, a subject can be immunized 7 times with an immunogenic composition, adjuvant, vaccine (eg, protein subunit vaccine) of the disclosure, or a combination thereof.

Suitable time intervals may be selected to separate two or more immunizations. The time interval may apply to multiple immunizations with the same immunogenic composition, adjuvant or vaccine (e.g. protein subunit vaccine) or combinations thereof, e.g. The agents, or vaccines (eg, protein subunit vaccines), or combinations thereof can be administered in the same or different amounts via the same or different routes of immunization. The time intervals apply to immunizations with different agents, e.g., a first immunogenic composition comprising a first cyclic polyribonucleotide and a second immunogenic composition comprising a second cyclic polyribonucleotide. obtain. A time interval can be applied to a first immunogenic composition comprising a first linear polyribonucleotide and a second immunogenic composition comprising a second linear polyribonucleotide. In regimens involving three or more immunizations, the time intervals between immunizations can be the same or different. In some examples, between two immunizations, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 40, 48, or 72 hours elapse. In certain embodiments, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 20, 21 between two immunizations , 24, 28, or 30 days have passed. In certain embodiments, about 1, 2, 3, 4, 5, 6, 7, or 8 weeks elapse between two immunizations. In certain embodiments, about 1, 2, 3, 4, 5, 6, 7, or 8 months elapse between two immunizations.

In certain embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, between two immunizations; At least 24, at least 36, or at least 72 hours or more have passed. In certain embodiments, no more than 1 hour, no more than 2 hours, no more than 3 hours, no more than 4 hours, no more than 5 hours, no more than 6 hours, no more than 7 hours, no more than 8 hours, no more than 9 hours between two immunizations; 10 hours or less, 15 hours or less, 20 hours or less, 24 hours or less, 36 hours or less, or 72 hours or less, or less have passed.

In certain embodiments, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, between two immunizations; At least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 days or more have passed. In certain embodiments, no more than 2 days, no more than 3 days, no more than 4 days, no more than 5 days, no more than 6 days, no more than 7 days, no more than 8 days, no more than 9 days, no more than 10 days between two immunizations; 15 days or less, 20 days or less, 21 days or less, 22 days or less, 23 days or less, 24 days or less, 25 days or less, 26 days or less, 27 days or less, 28 days or less, 29 days or less, 30 days or less, 32 days Since then, 34 days or less, or 36 days or less, or less have passed.

In certain embodiments, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, or at least 8 weeks, or more, between two immunizations. passes. In certain embodiments, no more than 2 weeks, no more than 3 weeks, no more than 4 weeks, no more than 5 weeks, no more than 6 weeks, no more than 7 weeks, no more than 8 weeks, or no more than 8 weeks pass between two immunizations.

In certain embodiments, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, or At least 8 months or more have passed. In certain embodiments, no more than 2 months, no more than 3 months, no more than 4 months, no more than 5 months, no more than 6 months, no more than 7 months, no more than 8 months, or less than that.

In certain embodiments, a non-human animal with a humanized immune system is immunized three times at intervals of 3-4 weeks.

In certain embodiments, the method includes administering an agent to improve an immunogenic response to a non-human animal (e.g., a non-human animal with a humanized immune system) or a human subject (e.g., a non-human animal for immunization). animal or human subject). In certain embodiments, the agent is an antigen (eg, protein antigen) disclosed herein. For example, the method includes administering the protein antigen 1-7 days prior to administration of a cyclic polyribonucleotide comprising a sequence encoding the protein antigen. In certain embodiments, the protein antigen is administered 1, 2, 3, 4, 5, 6, or 7 days prior to administration of the cyclic polyribonucleotide comprising a sequence encoding the protein antigen. For example, the method includes administering a protein antigen 1-7 days prior to administration of a linear polyribonucleotide comprising a sequence encoding the protein antigen. In certain embodiments, a protein antigen is administered 1, 2, 3, 4, 5, 6, or 7 days prior to administration of a linear polyribonucleotide comprising a sequence encoding the protein antigen. Protein antigens can be administered as protein formulations, encoded in plasmids (pDNA), displayed in virus-like particles (VLPs), formulated in lipid nanoparticles, and the like.

A subject (e.g., for immunization) may be administered at any suitable number of anatomical sites with an immunogenic composition, adjuvant, or vaccine (e.g., protein subunit vaccine), or combinations thereof. can be immunized. The same immunogenic composition, adjuvant, vaccine (e.g., protein subunit vaccine), or combination thereof, can be administered to multiple anatomical sites, and the same or different cyclic polyribonucleotide, adjuvant, vaccine (e.g., protein subunit vaccines) or combinations thereof can be administered to different anatomical sites, and the same or different cyclic polyribonucleotides, adjuvants, vaccines (e.g., protein subunit vaccines) can be administered to different anatomical sites. Different immunogenic compositions, including unit vaccines) or combinations thereof, may be administered at the same anatomical site, or any combination thereof. For example, an immunogenic composition comprising cyclic polyribonucleotides can be administered to two different anatomical sites and/or an immunogenic composition comprising cyclic polyribonucleotides can be administered to one anatomical site. adjuvant may be administered at different anatomical sites. The same immunogenic composition, adjuvant, vaccine (e.g., protein subunit vaccine), or combination thereof can be administered to multiple anatomical sites, and the same or different linear polyribonucleotide, adjuvant, Different immunogenic compositions comprising vaccines (e.g. protein subunit vaccines) or combinations thereof can be administered to different anatomical sites, using the same or different linear polyribonucleotides, adjuvants, vaccines (e.g. Different immunogenic compositions, including protein subunit vaccines) or combinations thereof, may be administered to the same anatomical site, or any combination thereof. For example, an immunogenic composition comprising linear polyribonucleotides can be administered to two different anatomical sites and/or an immunogenic composition comprising linear polyribonucleotides can be administered to one anatomical site. Sites may be administered, and adjuncts may be administered at different anatomical sites.

Immunization in any two or more anatomical routes can be via the same route of immunization (eg, intramuscular) or by two or more routes of immunization. In certain embodiments, an immunogenic composition comprising a cyclic polyribonucleotide of the present disclosure, an adjuvant, or a vaccine (e.g., protein subunit vaccine), or combination thereof, is administered to a subject (e.g., a subject for immunization). ) at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 anatomical sites. In certain embodiments, an immunogenic composition comprising a cyclic polyribonucleotide of the disclosure, an adjuvant, or a vaccine (e.g., a protein subunit vaccine), or a combination thereof, is administered to a subject no more than 2, no more than 3, No more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, or no more anatomical sites are inoculated. In certain embodiments, an immunogenic composition comprising a cyclic polyribonucleotide of the disclosure or an adjuvant is administered to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 anatomical sites of a subject. site is inoculated. In certain embodiments, immunogenic compositions comprising linear polyribonucleotides, adjuvants, or vaccines (e.g., protein subunit vaccines) of the present disclosure, or combinations thereof, are administered to at least one, at least two subjects. , at least 3, at least 4, at least 5, or at least 6 anatomical sites. In certain embodiments, immunogenic compositions comprising linear polyribonucleotides, adjuvants, or vaccines (e.g., protein subunit vaccines) of the present disclosure, or combinations thereof, are administered to no more than 2, no more than 3 subjects. , no more than 4, no more than 5, no more than 6, no more than 7, no more than 8, no more than 9, no more than 10, or no more than 10 anatomical sites. In certain embodiments, an immunogenic composition comprising a linear polyribonucleotide or adjuvant of the present disclosure is administered to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 anatomy of a subject. inoculated at the target site.

Immunization may be by any suitable route. Non-limiting examples of routes of immunization include intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, joint. Intracapsular, subarachnoid, intraspinal, epidural, intrasternal, intracerebral, intraocular, intralesional, intracerebroventricular, intracapsular, or intraparenchymal, including injection and infusion. In some cases, immunization may be by inhalation. Two or more immunizations can be performed by the same route or by different routes.

Any suitable amount of cyclic polyribonucleotides can be administered to a subject of the present disclosure (eg, a subject for immunization). For example, a subject may receive at least about 1 ng, at least about 10 ng, at least about 100 ng, at least about 1 μg, at least about 10 μg, at least about 100 μg, at least about 1 mg, at least about 10 mg, at least about 100 mg, or at least about 1 g of cyclic polyribonucleotides. can be immunized with In certain embodiments, the subject administers about 1 ng or less, about 10 ng or less, about 100 ng or less, about 1 μg or less, about 10 μg or less, about 100 μg or less, about 1 mg or less, about 10 mg or less, about 100 mg or less, or about 1 g or less of a cyclic It can be immunized with polyribonucleotides. In certain embodiments, a subject can be immunized with about 1 ng, about 10 ng, about 100 ng, about 1 μg, about 10 μg, about 100 μg, about 1 mg, about 10 mg, about 100 mg, or about 1 g of cyclic polyribonucleotides.

Any suitable amount of linear polyribonucleotide can be administered to a subject of the present disclosure (eg, a subject for immunization). For example, a subject may receive at least about 1 ng, at least about 10 ng, at least about 100 ng, at least about 1 μg, at least about 10 μg, at least about 100 μg, at least about 1 mg, at least about 10 mg, at least about 100 mg, or at least about 1 g of linear polyribonucleotide. It can be immunized with nucleotides. In certain embodiments, the subject has a linear can be immunized with polyribonucleotides. In certain embodiments, a subject can be immunized with about 1 ng, about 10 ng, about 100 ng, about 1 μg, about 10 μg, about 100 μg, about 1 mg, about 10 mg, about 100 mg, or about 1 g of linear polyribonucleotide.

In certain embodiments, the method further comprises evaluating the non-human animal or human subject (eg, subject for immunization) for an antibody response to the antigen. In certain embodiments, evaluating is before and/or after administration of a cyclic polyribonucleotide comprising a sequence encoding a coronavirus antigen. In certain embodiments, evaluating is before and/or after administration of a linear polyribonucleotide comprising a sequence encoding a coronavirus antigen.

Diluent In certain embodiments, an immunogenic composition of the invention comprises a cyclic polyribonucleotide and a diluent. In certain embodiments, an immunogenic composition of the invention comprises linear polyribonucleotides and a diluent.

A diluent can be a non-carrier excipient. Non-carrier excipients serve as vehicles or vehicles for the compositions, such as the cyclic polyribonucleotides described herein. Non-carrier excipients serve as a vehicle or medium for the compositions, such as the linear polyribonucleotides described herein. Non-limiting examples of non-carrier excipients include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersants, suspension aids, surfactants, isotonic agents, thickeners, emulsifiers , preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersing agents, granulating agents, disintegrating agents, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and Mixtures thereof are included. Non-carrier excipients can be any of the non-active ingredients listed in the Inactive Ingredient Database approved by the United States Food and Drug Administration (FDA) and that do not exhibit cell penetrating effects. A non-carrier excipient can be, for example, any inert ingredient suitable for administration to non-human animals suitable for veterinary use. Modification of compositions suitable for administration to humans so that the compositions are suitable for administration to a variety of animals is well understood and the ordinarily skilled veterinary pharmacologist, if any, Such changes can be designed and/or made using only routine experimentation.

In certain embodiments, cyclic polyribonucleotides can be delivered as naked delivery formulations, such as those containing diluents. Naked delivery formulations deliver cyclic polyribonucleotides to cells without modification or partial or complete encapsulation of cyclic polyribonucleotides, capped polyribonucleotides, or complexes thereof, without a carrier.

Naked delivery formulations are carrier-free formulations in which the cyclic polyribonucleotides have no covalent modifications attached to moieties that aid in delivery to cells, or partial or complete cyclic polyribonucleotides. No packaging. In certain embodiments, a cyclic polyribonucleotide without a covalent modification attached to a moiety that aids in delivery to a cell is a polyribonucleotide that is not covalently attached to a protein, small molecule, particle, polymer, or biopolymer. Cyclic polyribonucleotides without covalent modifications attached to moieties that aid in delivery to cells do not contain modified phosphate groups. For example, cyclic polyribonucleotides without covalent modifications attached to moieties that aid in delivery to cells include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphates, hydrogen phosphonates, phosphoramidates, phosphorodilates. Contains no amidates, alkyl or aryl phosphonates, or phosphotriesters.

In certain embodiments, linear polyribonucleotides can be delivered as naked delivery formulations, such as those containing diluents. Naked delivery formulations deliver linear polyribonucleotides to cells without modification or partial or complete encapsulation of linear polyribonucleotides, capped polyribonucleotides, or complexes thereof without a carrier. .

Naked delivery formulations are carrier-free formulations in which the linear polyribonucleotides have no covalent modifications attached to moieties that aid in delivery to cells, or partial or without complete encapsulation. In certain embodiments, linear polyribonucleotides without covalent modifications attached to moieties that aid in delivery to cells are polyribonucleotides that are not covalently attached to proteins, small molecules, particles, polymers, or biopolymers. . Linear polyribonucleotides without covalent modifications attached to moieties that aid in delivery to cells do not contain modified phosphate groups. For example, linear polyribonucleotides without cocovalent modifications attached to moieties that aid in delivery to cells include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphates, hydrogen phosphonates, phosphoramidates, Contains no phosphorodiamidates, alkyl or aryl phosphonates, or phosphotriesters.

In certain embodiments, the naked delivery formulation does not include any or all of transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. In certain embodiments, the naked delivery formulation is phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin, lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine) , polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-β-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, Dendrimers, chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) , 1-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2 (sperminecarboxamide) Ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N,N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HCl), Heptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl -N-hydroxyethylammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL) , or globulin-free.

In certain embodiments, the naked delivery formulation includes non-carrier excipients. In certain embodiments, non-carrier excipients comprise inert ingredients that do not exhibit cell penetration effects. In certain embodiments, non-carrier excipients include buffers, such as PBS. In certain embodiments, non-carrier excipients include solvents, non-aqueous solvents, diluents, suspending aids, surfactants, isotonic agents, thickeners, emulsifiers, preservatives, polymers, peptides, proteins, cell , hyaluronidase, dispersing agents, granulating agents, disintegrating agents, binders, buffers, lubricants, or oils.

In certain embodiments, the naked delivery formulation includes a diluent. The diluent can be a liquid diluent or a solid diluent. In certain embodiments, the diluent is an RNA solubilizing agent, a buffer, or a tonicity agent. Examples of RNA solubilizers include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of buffers include 2-(N-morpholino)ethanesulfonic acid (MES), Bis-Tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N -(2-acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-[[1,3-dihydroxy-2-(hydroxy methyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3-(N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), Tris, tricine, Gly-Gly, bicine, or phosphate. Examples of isotonic agents include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose.

Carriers In certain embodiments, an immunogenic composition of the invention comprises a cyclic polyribonucleotide and a carrier. In certain embodiments, an immunogenic composition of the invention comprises a linear polyribonucleotide and a carrier.

In certain embodiments, immunogenic compositions comprise the cyclic polyribonucleotides described herein in vesicles or other membrane-based carriers. In certain embodiments, immunogenic compositions comprise linear polyribonucleotides described herein in vesicles or other membrane-based carriers.

In other embodiments, the immunogenic composition comprises cyclic polyribonucleotides in or via cells, vesicles or other membrane-based carriers. In other embodiments, the immunogenic composition comprises linear polyribonucleotides in or via cells, vesicles or other membrane-based carriers. In one embodiment, the immunogenic composition comprises cyclic polyribonucleotides in liposomes or other similar vesicles. In one embodiment, the immunogenic composition comprises linear polyribonucleotides in liposomes or other similar vesicles. Liposomes are spherical vesicle structures composed of a unilamellar or multilamellar lipid bilayer surrounding an inner aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be anionic, neutral or cationic. Liposomes are biocompatible, non-toxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, biomembrane and blood-brain barrier (BBB) ) (see, e.g., for a review, Spuch and Navarro, Journal of Drug Delivery, vol. 2011, Article ID 469679, 12 pages, 2011. doi: 10.1155/2011/469679). sea bream).

Vesicles can be made from several different types of lipids; however, phospholipids are most commonly used as drug carriers to produce liposomes. Methods for the preparation of multilamellar vesicle lipids are known in the art (e.g., U.S. Pat. No. 6, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference). , 693,086). Vesicle formation can occur spontaneously when a lipid film is mixed with an aqueous solution, but it can also be facilitated by applying a force in the form of shaking by using a homogenizer, a sonicator, or an extrusion device (e.g. , for a review, see Spuch and Navarro, Journal of Drug Delivery, vol. Extruded lipids are prepared by Templeton et al. , Nature Biotech, 15:647-652, 1997, by extrusion through filters of reduced size.

In certain embodiments, immunogenic compositions of the invention comprise cyclic polyribonucleotides and lipid nanoparticles, eg, lipid nanoparticle formulations, described herein. In certain embodiments, immunogenic compositions of the invention comprise linear polyribonucleotides and lipid nanoparticles. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for the cyclic polyribonucleotide molecules described herein. Lipid nanoparticles are another example of carriers that provide a biocompatible and biodegradable delivery system for the linear polyribonucleotide molecules described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the properties of SLNs, improve drug stability and loading capacity, and prevent drug leakage. Polymeric nanoparticles (PNPs) are important components for drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. A new type of carrier that combines liposomes and polymers, lipid-polymer nanoparticles (PLNs), can also be used. These nanoparticles have complementary advantages of PNPs and liposomes. PLNs are composed of a core-shell structure; the polymer core provides a stable structure and the phospholipid shell provides good biocompatibility. Thus, the two components increase drug encapsulation efficiency, promote surface modification, and prevent leakage of water-soluble drugs. For reviews, see, eg, Li et al. 2017, Nanomaterials 7, 122; doi: 10.3390/nano7060122.

Further non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), protein carriers (e.g., proteins covalently attached to cyclic polyribonucleotides or covalently attached to linear polyribonucleotides). conjugated proteins), or cationic carriers such as cationic lipopolymers or transfection reagents. Non-limiting examples of carbohydrate carriers include phytoglycogen octenylsuccinate, phytoglycogen β-dextrin, and anhydride-modified phytoglycogen β-dextrin. Non-limiting examples of cationic carriers include lipofectamine, polyethyleneimine, poly(trimethyleneimine), poly(tetramethyleneimine), polypropyleneimine, aminoglycoside-polyamines, dideoxy-diamino-b-cyclodextrin, spermine, spermidine. , poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, l,2-dioleoyl-3-trimethylammonium-propane (DOTAP), N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), l-[2-(oleoyloxy)ethyl]-2-oleyl-3- (2-Hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA) , 3B-[N-(N\N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol HC1), diheptadecylamidoglycylspermidine (DOGS), N,N-distearyl-N,N -dimethylammonium bromide (DDAB), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), and N,N-dioleyl-N, N-dimethylammonium chloride (DODAC) can be mentioned. Non-limiting examples of protein carriers include human serum albumin (HSA), low density lipoprotein (LDL), high density lipoprotein (HDL), or globulin.

Exosomes can also be used as carriers or drug delivery vehicles for the circular polyribonucleotide molecules described herein. Exosomes can also be used as carriers or drug delivery vehicles for the linear polyribonucleotide molecules described herein. For a review, see Ha et al. July 2016. Acta Pharmaceutica Sinica B. Volume 6, Issue 4, Pages 287-296; https://doi. org/10.1016/j. apsb. See 2016.02.001.

Ex vivo differentiated erythrocytes can also be used as carriers for the circular polyribonucleotide molecules described herein. Ex vivo differentiated erythrocytes can also be used as carriers for the linear polyribonucleotide molecules described herein. For example, WO2015073587; WO2017123646; WO2017123644; WO2018102740; WO2016183482; WO2015153102; WO2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136; US Pat. No. 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131-10136.

For example, fusosomal compositions such as those described in WO2018208728 can also be used as carriers to deliver the circular polyribonucleotide molecules described herein. For example, fusosomal compositions such as those described in WO2018208728 can also be used as carriers to deliver the linear polyribonucleotide molecules described herein.

Virosomes and virus-like particles (VLPs) can also be used as carriers to deliver the circular polyribonucleotide molecules described herein to target cells. Virosomes and virus-like particles (VLPs) can also be used as carriers to deliver the linear polyribonucleotide molecules described herein to target cells.

For example, plant nanovesicles and plant messenger packs (PMPs) as described in International Patent Publication No. WO2011097480, WO2013070324, WO2017004526, or WO2020041784. ) can also be used as carriers to deliver the cyclic polyribonucleotides described herein. Plant nanovesicles and plant messenger packs (PMPs) can also be used as carriers to deliver the linear polyribonucleotide molecules described herein.

Microbubbles can also be used as carriers to deliver the circular polyribonucleotide molecules described herein. Microbubbles can also be used as carriers to deliver the linear polyribonucleotides described herein. See, eg, US Pat. No. 7,115,583; Beeri, R.; et al. , Circulation. 2002 Oct 1;106(14):1756-1759; et al. , Nat Protoc. 2019 Apr;14(4):1015-1026; et al. , Adv Drug Deliv Rev. 2008 Jun 30;60(10):1153-1166; J. et al. , Adv Drug Deliv Rev. 2014 Jun;72:82-93. In some embodiments, the microbubbles are albumin-coated perfluorocarbon microbubbles.

Lipid Nanoparticles The compositions, methods, and delivery systems provided by the present invention may employ any suitable carrier or delivery modality, including, in certain embodiments, lipid nanoparticles (LNPs). Lipid nanoparticles are, in certain embodiments, one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic, or amphoteric lipids); one or more conjugated lipids (PEG-conjugated lipids or lipids conjugated to polymers described in Table 5 of WO2019217941, which is incorporated herein by reference in its entirety); one or more sterols (eg, cholesterol).

Lipids (e.g., lipid nanoparticles) that can be used in nanoparticle formation include, for example, those listed in Table 4 of WO2019217941, which is incorporated by reference - It may include one or more of the lipids in Table 4 of Publication No. 2019217941. The lipid nanoparticles may comprise additional elements, such as polymers, such as those listed in Table 5 of WO2019217941, incorporated by reference.

In certain embodiments, the conjugated lipid, if present, is PEG-diacylglycerol (DAG) (such as l-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkyl Oxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-0-(2',3 '-di(tetradecanoyloxy)propyl-1-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl-methoxy polyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those listed in Table 2 of WO2019051289 (incorporated by reference), and the above may include one or more of a combination of

In certain embodiments, sterols that can be incorporated into lipid nanoparticles include cholesterol, such as those described in WO 2009/127060 or US Patent Application Publication No. 2010/0130588, incorporated by reference. or one or more cholesterol derivatives. Further exemplary sterols include Eygeris et al. (2020), dx. doi. org/10.1021/acs. nanolett. 0c01386, including plant sterols.

In certain embodiments, the lipid particles comprise ionizable lipids, non-cationic lipids, conjugated lipids that inhibit particle aggregation, and sterols. The amounts of these components can be varied independently to achieve desired properties. For example, in some embodiments, the lipid nanoparticles are ionizable lipids in an amount of about 20 mol % to about 90 mol % of the total lipids (in other embodiments, it is 20 to 20 mol % of the total lipids present in the lipid nanoparticles). 70% (mol), 30-60% (mol) or 40-50% (mol); lipids, conjugated lipids in an amount of about 0.5 mol % to about 20 mol % of total lipids, and sterols in an amount of about 20 mol % to about 50 mol % of total lipids. The total lipid to nucleic acid ratio can be varied as desired. For example, the total lipid to nucleic acid (mass or weight) ratio can be from about 10:1 to about 30:1.

In certain embodiments, the lipid to nucleic acid ratio (mass/mass ratio; w/w ratio) is from about 1:1 to about 25:1, from about 10:1 to about 14:1, from about 3:1 to about 15:1. 1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or from about 6:1 to about 9:1. The amount of lipid and nucleic acid can be adjusted to obtain a desired N/P ratio, eg, an N/P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or more. Generally, the total lipid content of lipid nanoparticle formulations can range from about 5 mg/ml to about 30 mg/mL.

Compositions described herein, e.g., forming lipid nanoparticles for delivery of nucleic acids described herein (e.g., RNA (e.g., circular polyribonucleotides, linear polyribonucleotides)) Some non-limiting examples of lipid compounds that can be used (eg, in combination with other lipid components) to:

ある実施形態において、式（ｉ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (i) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotides, linear polyribonucleotides) compositions described herein to cells. be.

ある実施形態において、式（ｉｉ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (ii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、式（ｉｉｉ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (iii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、式（ｖ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (v) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotides, linear polyribonucleotides) compositions described herein to cells. be.

ある実施形態において、式（ｖｉ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (vi) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、式（ｖｉｉｉ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (viii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、式（ｉｘ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

式中、
Ｘ^１が、Ｏ、ＮＲ^１、又は直接結合であり、Ｘ^２が、Ｃ２～５アルキレンであり、Ｘ^３が、Ｃ（＝Ｏ）又は直接結合であり、Ｒ^１が、Ｈ又はＭｅであり、Ｒ^３が、Ｃ１～３アルキルであり、Ｒ^２が、Ｃ１～３アルキルであり、又はＲ^２が、それが結合される窒素原子及びＸ^２の１～３個の炭素原子と一緒になって、４員、５員、若しくは６員環を形成し、又はＸ^１が、ＮＲ^１であり、Ｒ^１及びＲ^２が、それらが結合される窒素原子と一緒になって、５員若しくは６員環を形成し、又はＲ^２が、Ｒ^３及びそれらが結合される窒素原子と一緒になって、５員、６員、若しくは７員環を形成し、Ｙ^１が、Ｃ２～１２アルキレンであり、Ｙ^２が、

から選択され、
ｎが、０～３であり、Ｒ^４が、Ｃ１～１５アルキルであり、Ｚ^１が、Ｃ１～６アルキレン又は直接結合であり、
Ｚ^２が

であるか又は非存在であり、ただし、Ｚ^１が直接結合であり、Ｚ^２が非存在である場合；
Ｒ^５が、Ｃ５～９アルキル又はＣ６～１０アルコキシであり、Ｒ^６が、Ｃ５～９アルキル又はＣ６～１０アルコキシであり、Ｗが、メチレン又は直接結合であり、Ｒ^７が、Ｈ又はＭｅ、又はその塩であり、ただし、Ｒ^３及びＲ^２が、Ｃ２アルキルであり、Ｘ^１が、Ｏであり、Ｘ^２が、直鎖状Ｃ３アルキレンであり、Ｘ^３が、Ｃ（＝０）であり、Ｙ^１が、直鎖状Ｃｅアルキレンであり、（Ｙ^２）ｎ－Ｒ^４が、

であり、Ｒ^４が、直鎖状Ｃ５アルキルであり、Ｚ^１が、Ｃ２アルキレンであり、Ｚ^２が、非存在であり、Ｗが、メチレンであり、Ｒ^７が、Ｈである場合、Ｒ^５及びＲ^６が、Ｃｘアルコキシでない。

In certain embodiments, LNPs comprising formula (ix) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

During the ceremony,
X ¹ is O, NR ¹ or a direct bond, X ² is C2-5 alkylene, X ³ is C(=O) or a direct bond, R ¹ is H or Me , R ³ is C1-3 alkyl and R ² is C1-3 alkyl, or R ² together with the nitrogen atom to which it is attached and 1-3 carbon atoms of X ² together form a 4-, 5- or 6-membered ring, or X ¹ is NR ¹ and R ¹ and R ² together with the nitrogen atom to which they are attached form a 5- or 6-membered ring. form a membered ring, or R ² together with R ³ and the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered ring, and Y ¹ is C2-12 alkylene; Yes, Y ² is

is selected from
n is 0-3, R ⁴ is C1-15 alkyl, Z ¹ is C1-6 alkylene or a direct bond;
^Z2 is

or absent, provided that Z ¹ is a direct bond and Z ² is absent;
R ⁵ is C5-9 alkyl or C6-10 alkoxy, R ⁶ is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, R ⁷ is H or Me, or a salt thereof, where R ³ and R ² are C2 alkyl, X ¹ is O, X ² is linear C3 alkylene, and X ³ is C(=0) is, Y ¹ is a linear Ce alkylene, and (Y ² )nR ⁴ is

and R ⁴ is linear C5 alkyl, Z ¹ is C2 alkylene, Z ² is absent, W is methylene and R ⁷ is H, then R ⁵ and ^R6 are not Cxalkoxy.

In certain embodiments, LNPs comprising formula (xii) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、式（ｘｉ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (xi) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、ＬＮＰは、式（ｘｉｉｉ）の化合物及び式（ｘｉｖ）の化合物を含む。

In certain embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

ある実施形態において、式（ｘｖ）を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formula (xv) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. be.

ある実施形態において、式（ｘｖｉ）の製剤を含むＬＮＰが、本明細書に記載されるポリリボヌクレオチド（例えば、環状ポリリボヌクレオチド、線状ポリリボヌクレオチド）組成物を、細胞に送達するのに使用される。

In certain embodiments, LNPs comprising formulations of formula (xvi) are used to deliver the polyribonucleotide (e.g., cyclic polyribonucleotide, linear polyribonucleotide) compositions described herein to cells. used.

In certain embodiments, lipids for delivery of the compositions described herein, e.g., nucleic acids described herein (e.g., RNA (e.g., cyclic polyribonucleotides, linear polyribonucleotides)) Lipid compounds used to form nanoparticles are made by one of the following reactions:

In certain embodiments, compositions (eg, nucleic acids or proteins) described herein are provided in LNPs comprising ionizable lipids. In certain embodiments, the ionizable lipid is heptadecane-9, for example, as described in Example 1 of US Pat. No. 9,867,888, which is incorporated herein by reference in its entirety. -yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102). In certain embodiments, the ionizable lipid is 9Z, 12Z)-3, for example, as synthesized in Example 13 of WO2015/095340, which is incorporated herein by reference in its entirety. -((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate (LP01) . In certain embodiments, the ionizable lipid is synthesized, for example, in Examples 7, 8, or 9 of U.S. Patent Application Publication No. 2012/0027803 (incorporated herein by reference in its entirety). di((Z)-non-2-en-1-yl)9-((4-dimethylamino)butanoyl)oxy)heptadecanedioate (L319). In certain embodiments, the ionizable lipid is a 1,1' -((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecane -2-ol) (C12-200). In certain embodiments, the ionizable lipid is imidazole cholesterol ester (ICE) lipid (3S, 10R, 13R, 17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl) -2,3,14,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-lH-cyclopenta[a]phenanthren-3-yl 3-(1H-imidazole -4-yl)propanoate, for example structure (I) from WO2020/106946, which is hereby incorporated by reference in its entirety.

In certain embodiments, the ionizable lipid is a cationic lipid, an ionizable cationic lipid, such as a cationic lipid that can exist in a positively charged or neutral form depending on pH, or an amine that can be readily protonated. It may be contained lipids. In certain embodiments, cationic lipids are lipids that can be positively charged, eg, under physiological conditions. Exemplary cationic lipids contain one or more positively charged amine groups. In certain embodiments, the lipid particles comprise neutral lipids, ionizable amine-containing lipids, biodegradable alkyne lipids, steroids, phospholipids including polyunsaturated lipids, structured lipids (e.g., sterols), PEG, cholesterol and including cationic lipids in formulation with one or more of the polymer-conjugated lipids. In certain embodiments, the cationic lipid can be an ionizable cationic lipid. Exemplary cationic lipids disclosed herein can have an effective pKa greater than 6.0. In embodiments, the lipid nanoparticles can include a second cationic lipid that has a different effective pKa (eg, higher than the first effective pKa) than the first cationic lipid. Lipid nanoparticles include 40-60 mol percent cationic lipids, neutral lipids, steroids, polymer-conjugated lipids, and therapeutic agents, such as those described herein encapsulated within or associated with the lipid nanoparticles. can include nucleic acids such as RNA (eg, circular polyribonucleotides, linear polyribonucleotides). In certain embodiments, nucleic acids are co-formulated with cationic lipids. Nucleic acids can be adsorbed to the surface of LNPs, such as LNPs containing cationic lipids. In certain embodiments, nucleic acids can be encapsulated within LNPs, such as LNPs containing cationic lipids. In certain embodiments, lipid nanoparticles can include targeting moieties coated, for example, with a targeting agent. In embodiments, the LNP formulation is biodegradable. In certain embodiments, one or more lipids described herein, e.g., lipid nanoparticles comprising formulas (i), (ii), (ii), (vii) and/or (ix), comprise at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95% , encapsulating at least 97%, at least 98% or 100% of the RNA molecules.

Exemplary ionizable lipids that can be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of WO2019051289, incorporated herein by reference. Further exemplary lipids include, but are not limited to, one or more of the following formulas: X of US Patent Application Publication No. 2016/0311759; I of 2016/0376224; I, II or III of U.S. Patent Application Publication No. 20160151284; I, IA, II or IIA of U.S. Patent Application Publication No. 20170210967; A of US Patent Application Publication No. 2013/0178541; I of US Patent Application Publication No. 2013/0303587 or US Patent Application Publication No. 2013/0123338; I of Published Application No. 2015/0141678; II, III, IV, or V of U.S. Published Application No. 2015/0239926; I of U.S. Published Application No. 2017/0119904; I or II of 2017/117528; A of U.S. Patent Application Publication No. 2012/0149894; A of U.S. Patent Application Publication No. 2015/0057373; A of WO 2013/116126; A of US Patent Application Publication No. 2013/0090372; A of US Patent Application Publication No. 2013/0274523; A of US Patent Application Publication No. 2013/0274504; A of the specification; A of WO2013/016058; A of WO2012/162210; I of US2008/042973; I, II, III, or IV of the specification; I or II of U.S. Patent Application Publication No. 2014/0200257; I, II, or III of U.S. Patent Application Publication No. 2015/0203446; I or III of Publication No. 2015/0005363; I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID, or III-XXIV of U.S. Patent Application Publication No. 2014/0308304; I, II, III, or IV of WO2009/132131; A of U.S. Patent Application Publication No. 2012/01011478; I or XXXV of US2012/0027796; XIV or XVII of US2012/0058144; US2013/0323269; US2011/0117125 I, II, or III of U.S. Patent Application Publication No. 2011/0256175; I, II, III, IV, V, VI, VII, VIII of U.S. Patent Application Publication No. 2012/0202871; , IX, X, XI, XII; I, II, III, IV, V, VI, VII, VIII, X, XII, XIII, XIV, XV, or XVI of U.S. Patent Application Publication No. 2011/0076335; I or II of US Patent Application Publication No. 2006/008378; I of US Patent Application Publication No. 2013/0123338; I or XAY- of US Patent Application Publication No. 2015/0064242 Z; XVI, XVII, or XVIII of U.S. Patent Application Publication No. 2013/0022649; I, II, or III of U.S. Patent Application Publication No. 2013/0116307; I, II, or III of US Patent Application Publication No. 2010/0062967; I or II of US Patent Application Publication No. 2010/0062967; IX of US Patent Application Publication No. 2013/0189351; I of U.S. Patent Application Publication No. 2018/0028664; I of U.S. Patent Application Publication No. 2016/0317458; I of U.S. Patent Application Publication No. 2013/0195920; 5, 6 or 10 of Publication No. 10,221,127; III-3 of WO2018/081480; I-5 or I-8 of WO2020/081938; 18 or 25 of Published Application No. 9,867,888; A of U.S. Patent Application Publication No. 2019/0136231; II of WO 2020/219876; OF-02 of U.S. Patent Application Publication No. 2019/0240349; 23 of U.S. Patent Application Publication No. 10,086,013; cKK-E12/A6 of Miao et al (2020); C12-200 of WO2010/053572; 7C1 of Dahlman et al (2017); 304-O13 or 503-O13 of Whitehead et al; TS-P4C2 of US Patent No. 9,708,628; I of WO2020/106946; I of WO2020/106946.

In certain embodiments, the ionizable lipid is MC3 (6Z, 9Z, 28Z, 3lZ)-heptatriacont-6,9,28,3l-tetraen-l9-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA or MC3). In certain embodiments, the ionizable lipid is lipid ATX-002, eg, as described in Example 10 of WO2019051289A9, which is incorporated herein by reference in its entirety. In certain embodiments, the ionizable lipid is (l3Z,l6Z)-A, for example, as described in Example 11 of WO2019051289A9, which is incorporated herein by reference in its entirety. A-dimethyl-3-nonyldocosa-l3,l6-dien-l-amine (Compound 32). In certain embodiments, the ionizable lipid is compound 6 or compound 22, for example, as described in Example 12 of WO2019051289A9, which is hereby incorporated by reference in its entirety.

Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoyl Phosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4-(N -maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanol amines (such as 16-O-monomethyl PE), dimethyl-phosphatidylethanolamine (such as 16-O-dimethyl PE), l8-l-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogen Soybean phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearoylphosphatidylglycerol (DSPG) , dierucoyl phosphatidylcholine (DEPC), palmitoyl oleoyl phosphatidylglycerol (POPG), dielaidoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingo Myelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetyl phosphate, lysophosphatidylcholine, dilinoleoyl phosphatidylcholine, or mixtures thereof. It is understood that other diacylphosphatidylcholines and diacylphosphatidylethanolamine phospholipids can also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids having C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Additional exemplary lipids include, in certain embodiments, but are not limited to, lipids described in Kim et al. (2020) dx. doi. org/10.1021/acs. nanolett. 0c01386. Such lipids include, in certain embodiments, plant lipids known to improve liver transfection with mRNA (eg, DGTS).

Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, Hexadecyl stearate, isopropyl myristate, amphoteric acrylic polymer, triethanolamine lauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amide, dioctadecyldimethylammonium bromide, ceramide, sphingomyelin and the like. Other non-cationic lipids are described in WO2017/099823 or US2018/0028664, the entire contents of which are incorporated herein by reference.

In certain embodiments, the non-cationic lipid is oleic acid or a compound of Formula I, II, or IV of US Patent Application Publication No. 2018/0028664, incorporated herein by reference in its entirety. . Non-cationic lipids can, for example, account for 0-30% (mol) of the total lipids present in the lipid nanoparticles. In certain embodiments, the non-cationic lipid content is 5-20% (mol) or 10-15% (mol) of the total lipid present in the lipid nanoparticles. In embodiments, the molar ratio of ionizable lipid to neutral lipid ranges from about 2:1 to about 8:1 (e.g., about 2:1, 3:1, 4:1, 5:1, 6: 1, 7:1, or 8:1).

In some embodiments, the lipid nanoparticles do not contain any phospholipids.

In some embodiments, lipid nanoparticles may further comprise components such as sterols to provide membrane integrity. One exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2 ^, -hydroxy)-ethyl ether, cholesteryl-(4′-hydroxy)-butyl ether, and 6-ketocholestanol; non-polar analogues such as 5a-cholestane, cholestenone, 5a-cholestanone, 5p-cholestanone, and cholesteryl decanoate; and mixtures thereof. In certain embodiments, the cholesterol derivative is a polar analogue, such as cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication No. WO 2009/127060 and US Patent Application Publication No. 2010/0130588, each of which is hereby incorporated by reference in its entirety. .

In certain embodiments, components that provide membrane integrity, such as sterols, comprise 0-50% (mol) of total lipids present in the lipid nanoparticles (eg, 0-10%, 10-20%, 20-50%, 30%, 30-40%, or 40-50%). In certain embodiments, such components are 20-50% (mol) 30-40% (mol) of the total lipid content of the lipid nanoparticles.

In certain embodiments, lipid nanoparticles may comprise polyethylene glycol (PEG) or conjugated lipid molecules. Generally, these are used to inhibit aggregation and/or provide steric stabilization of lipid nanoparticles. Exemplary conjugated lipids include, but are not limited to, PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymeric lipids (CPL ) conjugates, and mixtures thereof. In certain embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, eg, a (methoxypolyethyleneglycol) conjugated lipid.

から選択される構造を含む。 Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as l-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG -dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (4-0-(2' , 3′-di(tetradecanoyloxy)propyl-1-0-(w-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEG dialkoxypropylcarbam, N-(carbonyl -methoxypolyethylene glycol 2000)-l,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof Further exemplary PEG-lipid conjugates are described, for example, in US Patent Nos. 5,885,613, US Pat. 2005/0175682, US2008/0020058, US2011/0117125, US2010/0130588, US2016/0376224 , U.S. Patent Application Publication No. 2017/0119904, and U.S. Patent Application No. 099823, all of which are hereby incorporated by reference in their entireties. , PEG-lipids are represented by Formulas III, III-a-I, III-a-2, III-b of US Patent Application Publication No. 2018/0028664, the entire contents of which are incorporated herein by reference. -1, III-b-2, or V. In certain embodiments, the PEG-lipid is described in US Patent Application Publication No. 20150376115 or US Patent Application Publication No. 2016/0376224, which are PEG-DAA conjugates are, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxy It can be propyl, PEG-dipalmityloxypropyl, or PEG-distearyloxypropyl. PEG-lipids include PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-disterylglycerol, PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, PEG- Disterylglycamide, PEG-cholesterol (l-[8′-(cholest-5-ene-3[β]-oxy)carboxamide-3′,6′-dioxaoctanyl]carbamoyl-[ω]-methyl- Poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzyl-[ω]-methyl-poly(ethylene glycol) ether), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanol can be one or more of amine-N-[methoxy(polyethylene glycol)-2000] In certain embodiments, the PEG-lipid is PEG-DMG, 1,2-dimyristoyl-sn-glycero-3- Phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] In certain embodiments, the PEG-lipid is

including structures selected from

In some embodiments, lipids conjugated with molecules other than PEG can also be used in place of PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), and cationic polymer lipid (GPL) conjugates have been used in place of or in addition to PEG-lipids. obtain.

Exemplary conjugated lipids, namely PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates and cationic polymer-lipids are described in WO2019051289A9 (all of which are incorporated by reference in their entirety). and in the PCT and LIS patent applications listed in Table 2, which are incorporated herein by reference.

In certain embodiments, PEG or conjugated lipids can account for 0-20% (mol) of the total lipids present in the lipid nanoparticles. In certain embodiments, the PEG or conjugated lipid content is 0.5-10% or 2-5% (mol) of the total lipid present in the lipid nanoparticles. The molar ratios of ionizable lipid, non-cationic lipid, sterol, and PEG/conjugated lipid can be varied as desired. For example, the lipid particles may contain 30-70% ionizable lipid per mole or total weight of the composition, 0-60% cholesterol per mole or total weight of the composition, 0-30% per mole or total weight of the composition. % non-cationic lipid and 1-10% conjugated lipid per mole or total weight of the composition. Preferably, the composition comprises 30-40% ionizable lipid per mole or total weight of the composition, 40-50% cholesterol per mole or total weight of the composition, and 10% per mole or total weight of the composition. Contains ~20% non-cationic lipids. In certain other embodiments, the composition comprises 50-75% ionizable lipid per mole or total weight of the composition, 20-40% cholesterol per mole or total weight of the composition, and Or 5-10% non-cationic lipid by total weight and 1-10% conjugated lipid per mole or total weight of the composition. The composition comprises 60-70% ionizable lipid per mole or total weight of the composition, 25-35% cholesterol per mole or total weight of the composition, and 5-10% per mole or total weight of the composition. of non-cationic lipids. The composition may also contain up to 90% ionizable lipid per mole or total weight of the composition and 2-15% non-cationic lipid per mole or total weight of the composition. The formulation may also contain, for example, 8-30% ionizable lipid per mole or total weight of the composition, 5-30% non-cationic lipid per mole or total weight of the composition, and molar or total weight of the composition. 4-25% ionizable lipids per mole or total weight of the composition; 4-25% non-cationic lipids per mole or total weight of the composition; 2-25% cholesterol by weight, 10-35% conjugated lipid per mole or total weight of the composition, and 5% cholesterol per mole or total weight of the composition; or 2 per mole or total weight of the composition. ~30% ionizable lipid, 2-30% non-cationic lipid per mole or total weight of composition, 1-15% cholesterol per mole or total weight of composition, per mole or total weight of composition 2-35% conjugated lipid and 1-20% cholesterol per mole or total weight of the composition; or up to 90% ionizable lipid per mole or total weight of the composition and moles or total of the composition Lipid nanoparticle formulations may contain 2-10% non-cationic lipids by weight, or 100% cationic lipids by mole or total weight of the composition. In certain embodiments, the lipid particle formulation comprises ionizable lipid, phospholipid, cholesterol and pegylated lipid in a molar ratio of 50:10:38.5:1.5. In certain other embodiments, the lipid particle formulation comprises ionizable lipid, cholesterol and pegylated lipid in a molar ratio of 60:38.5:1.5.

In certain embodiments, the lipid particles comprise ionizable lipids, non-cationic lipids (e.g., phospholipids), sterols (e.g., cholesterol) and PEGylated lipids, wherein the molar ratio of lipids is ranged from 20 to 70 mole percent with a target of 40 to 60; non-cationic lipid mole percent ranged from 0 to 30 with a target of 0 to 15; The range is 20-70 with a target of 30-50 and the PEGylated lipid mole percent ranges from 1-6 with a target of 2-5.

In certain embodiments, the lipid particles comprise ionizable lipid/non-cationic lipid/sterol/conjugated lipid in a molar ratio of 50:10:38.5:1.5.

In one aspect, the present disclosure provides lipid nanoparticle formulations comprising phospholipids, lecithin, phosphatidylcholine and phosphatidylethanolamine.

In some embodiments, one or more additional compounds may also be included. Those compounds can be administered separately or additional compounds can be included in the lipid nanoparticles of the invention. In other words, the lipid nanoparticles may contain other compounds in addition to the nucleic acid or at least a second nucleic acid different from the first nucleic acid. Other additional compounds include, but are not limited to, small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogues and derivatives thereof, peptidomimetics, nucleic acids, It may be selected from the group consisting of nucleic acid analogues and derivatives, extracts made from biological materials, or any combination thereof.

In certain embodiments, LNPs comprise biodegradable, ionizable lipids. In certain embodiments, LNP is (9Z,l2Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl ) propyl octadeca-9,12-dienoate (3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl ( 9Z,12Z)-octadeca-9,12-dienoate)) or another ionizable lipid. For example, WO2019/067992, WO/2017/173054, WO2015/095340, and WO2014/136086 and references provided therein. See lipids. In certain embodiments, the terms cationic and ionizable with respect to LNP lipids are synonymous, eg, an ionizable lipid is cationic depending on pH.

In certain embodiments, the average LNP diameter of a LNP formulation can be tens of nm to hundreds of nm, eg, measured by dynamic light scattering (DLS). In certain embodiments, the average LNP diameter of the LNP formulation is from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, It can be 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In certain embodiments, the LNP formulation has an average LNP diameter of about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm can be to about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation can be from about 70 nm to about 100 nm. In certain embodiments, the average LNP diameter of the LNP formulation can be about 80 nm. In certain embodiments, the average LNP diameter of the LNP formulation can be about 100 nm. In certain embodiments, the LNP formulation has an average LNP diameter of about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about It ranges from 35 mm to about 50 mm, or from about 38 mm to about 42 mm.

LNPs can be relatively homogeneous in some cases. The polydispersity index can be used to indicate the homogeneity of LNPs, eg, the size distribution of lipid nanoparticles. A small (eg, less than 0.3) polydispersity index generally indicates a narrow particle size distribution. LNP is from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0 .10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22 , 0.23, 0.24, or 0.25. In certain embodiments, the polydispersity index of LNPs can be from about 0.10 to about 0.20.

The zeta potential of LNPs can be used to indicate the electrokinetic potential of a composition. In certain embodiments, the zeta potential can represent the surface charge of the LNP. Lipid nanoparticles with relatively low positive or negative charges are generally desirable because more highly charged species can interact unnecessarily with cells, tissues, and other elements in the body. In certain embodiments, the LNP has a zeta potential of about −10 mV to about +20 mV, about −10 mV to about +15 mV, about −10 mV to about +10 mV, about −10 mV to about +5 mV, about −10 mV to about 0 mV, about −10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV , about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

Efficiency of protein and/or nucleic acid encapsulation refers to the amount of protein and/or nucleic acid that is encapsulated or otherwise associated with the LNP after preparation relative to the initial amount provided. A high encapsulation efficiency (eg, near 100%) is desirable. Encapsulation efficiency can be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing the lipid nanoparticles before and after degrading the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid (eg, RNA) in solution. Fluorescence can be used to measure the amount of free protein and/or nucleic acid (eg, RNA) in solution. For the lipid nanoparticles described herein, the protein and/or nucleic acid encapsulation efficiency is at least 50%, e.g. %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%. In some embodiments, the encapsulation efficiency can be at least 95%.

LNPs may optionally include one or more coatings. In certain embodiments, LNPs can be formulated into capsules, films, or tablets with coatings. Capsules, films, or tablets containing the compositions described herein can have any useful size, tensile strength, hardness or density.

Further exemplary lipids, formulations, methods, and characterization of LNPs are taught by WO2020061457, which is hereby incorporated by reference in its entirety.

In certain embodiments, in vitro or ex vivo cell lipofection is performed using Lipofectamine MessengerMax (Thermo Fisher) or TransIT-mRNA Transfection Reagent (Mirus Bio). In certain embodiments, LNPs are formulated with the GenVoy_ILM ionizable lipid mixture (Precision NanoSystems). In certain embodiments, the LNP is 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or dilinoleylmethyl-4-dimethylaminobutyrate (DLin- MC3-DMA or MC3), the formulation and in vivo use of which are described in Jayaraman et al. Angew Chem Int Ed Engl 51(34):8529-8533 (2012), incorporated herein by reference in its entirety.

CRISPR-Cas systems, such as Cas9-gRNA RNP, gRNA, LNP formulations optimized for delivery of Cas9 mRNA have been described in WO2019067992 and WO2019067910 (both incorporated by reference ) and is useful for delivery of cyclic polyribonucleotides and linear polyribonucleotides described herein.

Additional specific LNP formulations useful for delivery of nucleic acids (e.g., circular polyribonucleotides, linear polyribonucleotides) are described in US Pat. Nos. 8,158,601 and 8,168,775, both incorporated by reference. ), which includes the formulation used in Patisiran sold under the name ONPATTRO.

Exemplary dosages of polyribonucleotide (eg, cyclic polyribonucleotide, linear polyribonucleotide) LNP are about 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4 , 5, 6, 8, 10, or 100 mg/kg of RNA. Exemplary doses of AAV containing polyribonucleotides described herein can include MOIs of about 10 ¹¹ , 10 ¹² , 10 ¹³ , and 10 ¹⁴ vg/kg.

Adjuvants Adjuvants can reduce the immune response (humoral and/or cellular) elicited in a subject (e.g., a subject for immunization) to which the adjuvant and/or an immunogenic composition comprising the adjuvant is administered. Facilitate. In certain embodiments, adjuvant agents are administered to a subject (eg, a subject for immunization) for the production of polyclonal antibodies from cyclic polyribonucleotides disclosed herein. In certain embodiments, adjuvant agents are administered to a subject for the production of polyclonal antibodies from the linear polyribonucleotides disclosed herein. In certain embodiments, adjuvants are used in the methods described herein to produce the polyclonal antibodies described herein. In certain embodiments, adjuvant agents are used to facilitate the production of polyclonal antibodies in a subject against coronavirus antigens and/or epitopes expressed from cyclic polyribonucleotides. In certain embodiments, the adjuvant and the cyclic polyribonucleotide are co-administered in separate compositions. In certain embodiments, the adjuvant is mixed or blended with the cyclic polyribonucleotide in a single composition to obtain an immunogenic composition to be administered to the subject. In certain embodiments, adjuvant agents are used to facilitate the production of polyclonal antibodies in a subject against coronavirus antigens and/or epitopes expressed from linear polyribonucleotides. In certain embodiments, the adjuvant and linear polyribonucleotide are co-administered in separate compositions. In certain embodiments, the adjuvant is mixed or blended with the linear polyribonucleotide in a single composition to obtain an immunogenic composition to be administered to the subject.

The adjuvant can be a TH1 adjuvant and/or a TH2 adjuvant. Preferred adjuvants include, but are not limited to, one or more of the following:
Mineral-containing composition. Mineral-containing compositions suitable for use as adjuvants in the present invention include inorganic salts such as aluminum salts and calcium salts. The present invention includes inorganic salts such as hydroxides (e.g., oxyhydroxides), phosphates (e.g., hydroxyphosphates, orthophosphates), sulfates, or mixtures of various inorganic compounds, wherein the compound is It takes any suitable form (eg gel, crystalline, amorphous, etc.). Calcium salts include calcium phosphate (eg, "CAP"). Aluminum salts include hydroxides, phosphates, sulfates, and the like.

Oil emulsion composition. Oil emulsion compositions suitable for use as adjuvants in the present invention are squalene-water emulsions such as MF59 (5% squalene, 0.5% Tween 80 and 0.5% Span, Microfluidizer ), AS03 (alpha-tocopherol, squalene and polysorbate 80 in an oil-in-water emulsion), Montanide formulations (e.g. Montanide ISA 51, Montanide ISA 720), Incomplete Freund's Adjuvant (IFA ), complete Freund's adjuvant (CFA), and incomplete Freund's adjuvant (IFA).

small molecule. Small molecules suitable for use as adjuvant agents in the present invention include imiquimod or 847, resiquimod or R848, or gardiquimod.

polymer nanoparticles. Polymer nanoparticles suitable for use as adjuvants in the present invention include poly(a-hydroxy acids), polyhydroxybutyric acid, polylactones (including polycaprolactone), polydioxanone, polyvalerolactone, polyorthoesters, polyanhydrides , polycyanoacrylates, tyrosine-derived polycarbonates, polyvinyl-pyrrolidinones or polyester-amides, and combinations thereof.

Saponins (ie, glycosides, polycyclic aglycones attached to one or more sugar side chains). Saponin formulations suitable for use as adjuvants in the present invention include purified formulations such as QS21, and lipid formulations such as ISCOMs and ISCOM matrices. QS21 is marketed as STIMULON™. Saponin formulations may also contain sterols such as cholesterol. Combinations of saponins and cholesterols can be used to form unique particles called immunostimulating complexes (ISCOMs). ISCOMs typically also include a phospholipid such as phosphatidylethanolamine or phosphatidylcholine. Any known saponin can be used in ISCOMs. Preferably, the ISCOM includes one or more of QuilA, QHA and QHC. Optionally, the ISCOMS may be free of additional cleaning agents.

Lipopolysaccharide. Adjuvants suitable for use in the present invention include non-toxic derivatives of enterobacterial lipopolysaccharide (LPS). Such derivatives include monophosphoryl lipid A (MPLA), glucopyranosyl lipid A (GLA) and 3-O-deacylated MPL (3dMPL). 3dMPL is a mixture of 3 De-O-acylated monophosphoryl lipid A with 4, 5 or 6 acylated chains. Other non-toxic LPS derivatives include monophosphoryl lipid A mimics such as aminoalkyl glucosaminide phosphate derivatives such as RC-529.

Liposomes. Liposomes suitable for use as adjuvants in the present invention include virosomes and CAF01.

lipid nanoparticles. Adjuvants suitable for use in the present invention include lipid nanoparticles (LNPs) and their components.

Lipopeptides (ie, compounds comprising one or more fatty acid residues and two or more amino acid residues). Lipopeptides suitable for use as adjuvants in the present invention include Pam2 (Pam2CSK4) and Pam3 (Pam3CSK4).

Glycolipid. Suitable glycolipids for use as adjuvants in the present invention include code factor (trehalose dimycolate).

Peptides and peptidoglycans derived from Gram-negative or Gram-positive bacteria (synthetic or purified) such as MDP (N-acetyl-muramyl-L-alanyl-D-isoglutamine) are suitable for use as adjuvants in the present invention. be.

Carbohydrates (carbohydrate-containing) or polysaccharides suitable for use as adjuvants include dextran (eg, branched microbial polysaccharides), dextran sulfate, lentinan, zymosan, beta-glucan, deltin, mannan, and chitin.

RNA-based adjuvants. RNA-based supplements suitable for use in the present invention include poly IC, poly IC:LC, hairpin RNA with or without a 5′ triphosphate, viral sequences, poly U-containing sequences, dsRNA natural or Synthetic RNA sequences, and nucleic acid analogs (eg, cyclic GMP-AMP or other cyclic dinucleotides, such as cyclic di-GMP, immunostimulatory base analogs, such as C8-substituted and N7,C8-disubstituted guanine ribonucleotides). is.

DNA-based adjuncts. DNA-based adjuvants suitable for use in the present invention include CpGs, dsDNA, and natural or synthetic immunostimulatory DNA sequences.

protein or peptide. Proteins and peptides suitable for use as adjuvants in the present invention include flagellin-fusion proteins, MBL (mannose binding lectin), cytokines and chemokines.

virus particles. Viral particles suitable for use as adjuvants include virosomes (phospholipid cell membrane bilayers).

Adjuvants for use in the present invention may be of bacterial origin, such as flagellin, LPS, or bacterial toxins (eg, enterotoxins (proteins) such as heat-labile toxin or cholera toxin). Auxiliary agents for use in the present invention can be hybrid molecules such as CpG conjugated to imiquimod. Adjuvants for use in the present invention may be fungal or oomycete MAMPs, such as chitin or β-glucan. In some embodiments, the adjuvant is an inorganic nanoparticle such as gold nanorods or silica-based nanoparticles (eg, mesoporous silica nanoparticles (MSN)). In certain embodiments, the adjuvant is a multicomponent adjuvant or adjuvant system, e.g., AS01, AS03, AS04 (MLP5 + Alum), CFA (Complete Freund's Adjuvant: IFA + Peptidoglycan + Trehalose Dimycolate), Glycolipid Immunomodulators ( CAF01 (a binary system of cationic liposome vehicles (dimethyldioctadecyl-ammonium (DDA)) stabilized with trehalose 6,6-dibehenate (TDB), which can be a synthetic variant of mycobacterial cell wall-located coding factors. is.

Cytokine. Adjuvants are cytokines such as inflammatory cytokines (eg GM-CSF, IL-1α, IL-1β, TGF-β, TNF-α, TNF-β), Th-1 inducing cytokines (eg IFN- gamma, IL-2, IL-12, IL-15, IL-18), or Th-2-induced cytokines (eg, IL-4, IL-5, IL-6, IL-10, IL-13) It can be a coding portion or the full length DNA.

chemokines. The adjuvant can be partial or full-length DNA encoding a chemokine, such as MCP-1, MIP-1α, MIP-1β, Rantes, or TCA-3.

The adjuvant can be partial or full-length DNA encoding a co-stimulatory molecule such as CD80, CD86, CD40-L, CD70, or CD27.

The adjuvant is an innate immune sentinel (partial, full length, or mutated) or a constitutively active (ca) innate immune sentinel, such as caTLR4, casting, caTLR3, caTLR3, caTLR9, caTLR7, caTLR8, caTLR7 , caRIG-I/DDX58, or caMDA-5/IFIH1.

Auxiliary agents are adapters or signaling molecules such as STING, TRIF, TRAM, MyD88, IPS1, ASC, MAVS, MAPK, IKK-α, IKK complex, TBK1, β-catenin, and caspase-1 encoding portions or It can be full-length DNA.

The adjuvant can be a partial or full-length DNA encoding a transcriptional activator, such as a transcriptional activator that can upregulate an immune response (eg, AP1, NF-κB, IRF3, IRF7, IRF1, or IRF5). . The adjuvant can be partial or full-length DNA encoding cytokine receptors such as IL-2β, IFN-γ, or IL-6.

The adjuvant can be partial or full length DNA encoding a bacterial component such as flagellin or MBL.

The adjuvant can be partial or full-length DNA encoding any component of the innate immune system.

In certain embodiments, the adjuvant used in the present invention is SAB's proprietary adjuvant formulation, SAB-adj-1 or SAB-adj-2.

Vaccines In certain embodiments of the methods described herein, a second agent is also administered to the subject (e.g., the subject for immunization), e.g., a second vaccine is also administered to the subject (e.g., subject for immunization). In certain embodiments, the composition administered to the subject comprises a cyclic polyribonucleotide described herein and a second vaccine. In certain embodiments, the vaccine and cyclic polyribonucleotide are co-administered in separate compositions. The vaccine is administered simultaneously with the cyclic polyribonucleotide immunization, administered prior to the cyclic polyribonucleotide immunization, or administered after the cyclic polyribonucleotide immunization.

For example, in certain embodiments, a subject (e.g., for immunization) is immunized with an immunogenic composition comprising an acyclic polyribonucleotide coronavirus vaccine (e.g., a protein subunit vaccine) and a cyclic polyribonucleotide. become. In certain embodiments, a subject is immunized with an immunogenic composition comprising a non-polyribonucleotide vaccine for a first microorganism (e.g., pneumococcus) and a cyclic polyribonucleotide disclosed herein . The vaccine can be any bacterial or viral infection vaccine. In certain embodiments, the vaccine is a pneumococcal polysaccharide vaccine such as PCV13 or PPSV23. In certain embodiments, the vaccine is an influenza vaccine. In certain embodiments, the vaccine is an RSV vaccine (eg Palivizumab).

In certain embodiments, the composition administered to the subject comprises linear polyribonucleotides and a vaccine. In certain embodiments, the vaccine and linear polyribonucleotide are co-administered in separate compositions. The vaccine is administered concurrently with the linear polyribonucleotide immunization, administered prior to the linear polyribonucleotide immunization, or administered after the linear polyribonucleotide immunization.

For example, in certain embodiments, a subject (e.g., for immunization) encodes a polyribonucleotide (e.g., non-linear polyribonucleotide) coronavirus vaccine (e.g., protein subunit vaccine) and a coronavirus antigen. is immunized with an immunogenic composition comprising a linear polyribonucleotide disclosed herein comprising a sequence that In certain embodiments, the subject comprises a non-polyribonucleotide vaccine for a first microorganism (e.g., pneumococcus) and a linear polyribonucleotide disclosed herein comprising a sequence encoding a coronavirus antigen Immunized with an immunogenic composition. The vaccine can be any bacterial or viral infection vaccine. In certain embodiments, the vaccine is a pneumococcal polysaccharide vaccine such as PCV13 or PPSV23. In certain embodiments, the vaccine is an influenza vaccine. In certain embodiments, the vaccine is an RSV vaccine (eg Palivizumab).

Subjects for Immunization The present disclosure administers to a subject (e.g., a subject for immunization) an immunogenic composition comprising cyclic polyribonucleotides comprising sequences encoding coronavirus antigens and/or epitopes. or immunizing with such an immunogenic composition. The present disclosure provides a subject (e.g., a subject for immunization) with or administering an immunogenic composition comprising linear polyribonucleotides comprising sequences encoding coronavirus antigens and/or epitopes. Immunizing with an immunogenic composition is provided. In certain embodiments, the subject (eg, for immunization) is an animal. In certain embodiments, the subject (eg, for immunization) is a mammal. In certain embodiments, the subject (eg, for immunization) is human. In certain embodiments, the subject (eg, for immunization) is a non-human animal. In certain embodiments, the non-human animal has a humanized immune system. The subject's plasma or blood is used to generate hyperimmune plasma, eg, plasma containing high concentrations of antibodies that bind to the coronavirus antigens and/or epitopes of interest.

Non-Human Animals for Immunization The present disclosure provides non-human animals (e.g., non-human animals for immunization) with immunogens comprising cyclic polyribonucleotides comprising sequences encoding coronavirus antigens and/or epitopes. administering a sexual composition or immunizing with such an immunogenic composition. The present disclosure describes how to administer to a non-human animal (e.g., a non-human animal for immunization) an immunogenic composition comprising linear polyribonucleotides comprising sequences encoding coronavirus antigens and/or epitopes. or provide immunization with such an immunogenic composition.

In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a pet. In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a livestock animal. In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a farm animal. In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a zoo animal (eg, tiger, lion, wolf, etc.).

In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a mammal. Non-human animals (eg, non-human animals for immunization) include ungulates such as donkeys, goats, horses, cows, or pigs. Non-human animals (eg, non-human animals for immunization) also include rabbits, rats, or mice. In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a bovine (bovine subfamily). In other embodiments, the non-human animal is a goat.

In certain embodiments, the non-human animal (eg, non-human animal for immunization) is a chicken.

In certain embodiments, a non-human animal (eg, a non-human animal for immunization) has a humanized immune system and is used to produce human polyclonal antibodies.

Humanized Immune System Non-human animals with a humanized immune system (e.g., non-human animals for immunization with a humanized immune system) may be ungulates such as donkeys, goats, horses, cows, or pigs. include. Non-human animals with humanized immune systems also include rabbits, rats, or mice. In certain embodiments, the non-human animal with a humanized immune system is a bovine (animal of the subfamily Bovidae). In certain embodiments, the non-human animal with humanized immune system is a goat. In certain embodiments, the non-human animal with a humanized immune system is a chicken.

A non-human animal with a humanized immune system (eg, a non-human animal for immunization with a humanized immune system) is an animal that produces human antibodies, or antibody variants, fragments, and derivatives thereof. A humanized immune system comprises a humanized immunoglobulin locus, or a plurality of humanized immunoglobulin loci.

In certain embodiments, a humanized immunoglobulin locus contains the germline sequences of a human immunoglobulin, and enables a non-human animal to produce a humanized antibody (eg, a fully human antibody).

In certain embodiments, non-human animals having a humanized immune system of the present disclosure comprise non-human B-cells having humanized immunoglobulin loci. Humanized immunoglobulin loci undergo VDJ recombination during B-cell development, thereby allowing the generation of B-cells with a great diversity of antigen-binding specificities.

Antibody binding specificities are generated by the process of VDJ recombination. Exons encoding antigen-binding portions (variable regions) are assembled by chromosomal breaks and recombination during B-cell development. Exons encoding antigen-binding domains are assembled from so-called V (variable), D (diversity) and J (joining) gene segments by "cut and paste" DNA rearrangement. This process, called V(D)J recombination, selects a pair of segments, introduces a double-strand break flanking each segment, and removes the intervening DNA (or reverses, if selected). ), ligating the segments together. Reconstruction can occur in an orderly manner such that the D to J coupling proceeds before the V segment is coupled to the reconstructed DJ segment. This process of combinatorial assembly--selecting one segment of each type from several (possibly many) possibilities--is the basic engine that drives antigen receptor diversity in mammals. Diversity is greatly amplified by the characteristic variability (decrease or increase of a few nucleotides) at the junctions between the various segments. This process yields a nearly unlimited repertoire of potential antigen binding specificities with relatively little investment in germline coding capacity.

In certain embodiments, a non-human animal with a humanized immune system comprises a plurality of B cells of diverse specificity generated, for example, by VDJ recombination of humanized immunoglobulin loci. B-cells encoding B-cell receptors (and antibodies) that specifically bind antigens and/or epitopes of the disclosure encounter antigens and/or epitopes expressed, e.g., from cyclic polyribonucleotides of the disclosure Later, it is activated when it confronts alloantigens. B cells encoding B cell receptors (and antibodies) that specifically bind antigens and/or epitopes of the disclosure encounter antigens and/or epitopes expressed, for example, from linear polyribonucleotides of the disclosure. After that, it is activated when it confronts alloantigens. Activated B cells produce antibodies that specifically bind antigens and/or epitopes of the present disclosure. Activated B cells proliferate. In certain embodiments, activated non-human B cells differentiate into memory B cells and/or plasma cells. In certain embodiments, activated non-human B cells undergo class switching to generate antibodies of different isotypes disclosed herein. In certain embodiments, non-human B cells undergo somatic hypermutation to generate antibodies that bind antigens and/or epitopes with higher affinity.

Upon immunization with one or more immunogenic compositions comprising one or more cyclic polyribonucleotides of the present disclosure that express multiple antigens and/or epitopes, multiple B cell clones are isolated from their respective cognate This results in the generation of polyclonal antibodies with multiple binding specificities in response to the antigen. In certain embodiments, immunization of a non-human animal of the disclosure with one or more immunogenic compositions comprising one or more cyclic polyribonucleotides of the disclosure is performed for at least 1, at least 2, at least 3, at least 4 , at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 non-human B cell clones are activated. In certain embodiments, immunization of a non-human animal of the disclosure with one or more immunogenic compositions comprising one or more cyclic polyribonucleotides of the disclosure is performed for at least 1, at least 2, at least 3, at least 4 , at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least Resulting in the production of polyclonal antisera comprising antibodies that specifically bind to 50, at least 60, at least 70, at least 80, at least 90, or at least 100 antigens and/or epitopes of the present disclosure.

Upon immunization with one or more immunogenic compositions comprising one or more linear polyribonucleotides of the present disclosure that express multiple antigens and/or epitopes, multiple B cell clones are isolated from their respective Resulting in the generation of polyclonal antibodies with multiple binding specificities in response to alloantigens. In certain embodiments, immunization of a non-human animal of this disclosure with one or more immunogenic compositions comprising one or more linear polyribonucleotides of this disclosure results in at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, At least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 non-human B cell clones are activated. In certain embodiments, immunization of a non-human animal of the disclosure with one or more immunogenic compositions comprising one or more linear polyribonucleotides of the disclosure results in at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, Resulting in the production of polyclonal antisera comprising antibodies that specifically bind to at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 antigens and/or epitopes of the present disclosure.

Various techniques for modifying the genome of non-human animals (eg, non-human animals for immunization) can be used to generate animals capable of producing humanized antibodies. A non-human animal can be a transgenic animal, eg, a transgenic animal that contains all or a substantial portion of one or more humanized immunoglobulin loci. A non-human animal can be an artificially transchromosomal animal, such as a non-human animal comprising a human artificial chromosome or a yeast artificial chromosome.

A humanized immunoglobulin locus may be present on a vector, such as a human artificial chromosome or a yeast artificial chromosome (YAC). Human artificial chromosomes (HACs) containing humanized immunoglobulin loci can be introduced into animals. The vector (e.g., HAC) contains a human antibody heavy chain gene (from human chromosome 14) and one or both of the human antibody light chain genes, e.g., kappa (from human chromosome 2) and lambda (from human chromosome 22). can contain a germline repertoire of HACs can be introduced into cells of non-human animal species and transgenic animals can be produced by somatic cell nuclear transfer. Transgenic animals can also be bred to produce non-human animals that contain humanized immunoglobulin loci.

In certain embodiments, the humanized immunoglobulin loci are integrated into the genome of the non-human animal. For example, techniques involving homologous recombination or homologous recombination repair can be used to modify an animal's genome to introduce human nucleotide sequences. Tools such as CRISPR/Cas, TALENs, and zinc finger nucleases can be used for integration purposes.

Methods of generating non-human animals with humanized immune systems (eg, non-human animals for immunization with humanized immune systems) are disclosed. For example, human artificial chromosomes can be generated and introduced into cells containing additional genomic modifications of interest (e.g., deletion of endogenous non-human immune system genes), and the cells generate transgenic non-human animals. can be used as a nuclear donor for

In certain embodiments, the humanized immune system comprises one or more human antibody heavy chains, wherein each gene encoding an antibody heavy chain is operably linked to a class switch regulatory element. Operably linked can mean that a first DNA molecule (e.g., heavy chain gene) is linked to a second DNA molecule (e.g., class switch regulatory element), where , the first and second DNA molecules are arranged such that the first DNA molecule affects the function of the second DNA molecule. The two DNA molecules may or may not be part of a single contiguous DNA molecule and may or may not be contiguous. For example, a promoter is operably linked to a transcribable DNA molecule such that the promoter is capable of affecting transcription or translation of the transcribable DNA molecule.

In certain embodiments, a humanized immune system comprises one or more human antibody light chains. In certain embodiments, a humanized immune system comprises one or more human antibody surrogate light chains.

In certain embodiments, a humanized immune system comprises amino acid sequences, eg, constant regions, eg, heavy chain constant regions or portions thereof, that are derived from non-human animals. In certain embodiments, a humanized immune system comprises an IgM heavy chain constant region from a non-human animal (eg, an IgM heavy chain constant region derived from an ungulate). In certain embodiments, at least one class-switching regulatory element of a gene encoding one or more human antibody heavy chains, e.g., an antibody is directed against an antigen and/or epitope of the present disclosure in a non-human animal Occasionally, non-human (eg, from an ungulate) class-switching regulatory element is substituted to allow antibody class-switching.

A humanized immunoglobulin locus may contain non-human elements incorporated for compatibility with non-human animals. In certain embodiments, non-human elements may be present in a humanized immunoglobulin locus to reduce recognition by any remaining elements of the non-human animal's immune system). In certain embodiments, an immunoglobulin gene (eg, IgM) can be partially replaced with an amino acid sequence from a non-human animal. In certain embodiments, a non-human regulatory element present in a humanized immunoglobulin locus to facilitate expression and regulation of the locus within the non-human animal.

A humanized immunoglobulin locus may comprise a human DNA sequence. A humanized immunoglobulin locus can be codon-optimized to facilitate expression of the involved genes (eg, antibody genes) in a non-human animal.

A non-human animal with a humanized immune system (eg, a non-human animal with a humanized immune system for immunization) may contain or lack endogenous non-human immune system components. In certain embodiments, a non-human animal having a humanized immune system may lack non-human antibodies (eg, lack the ability to produce non-human antibodies). A non-human animal having a humanized immune system can lack, for example, one or more non-human immunoglobulin heavy chain genes, one or more non-human immunoglobulin light chain genes, or a combination thereof.

A non-human animal with a humanized immune system (eg, a non-human animal with a humanized immune system for immunization) can carry, for example, non-human immune cells. A non-human animal having a humanized immune system may retain non-human innate immune system components (eg, cells, complement, antimicrobial peptides, etc.). In certain embodiments, a non-human animal with a humanized immune system can harbor non-human T cells. In certain embodiments, a non-human animal with a humanized immune system can carry non-human B cells. In certain embodiments, a non-human animal with a humanized immune system can carry non-human antigen-presenting cells. In certain embodiments, a non-human animal with a humanized immune system can carry non-human antibodies.

In certain embodiments, the humanized immune system comprises human innate immune proteins, such as complement proteins.

In certain embodiments, the humanized immune system comprises humanized T cells and/or antigen presenting cells.

In certain embodiments, the compositions and methods of this disclosure comprise T cells. For example, the cyclic polyribonucleotides of the present disclosure can contain antigens recognized by B cells and T cells, which, upon immunization of a non-human animal with a humanized immune system, provide T cell help. , thereby increasing antibody production in non-human animals. In another example, the linear polyribonucleotides of this disclosure can comprise antigens recognized by B cells and T cells, and upon immunization of a non-human animal with a humanized immune system, the T cells Help may be provided thereby increasing antibody production in the non-human animal.

In certain embodiments, a non-human animal with a humanized immune system (e.g., a non-human animal for immunization with a humanized immune system) may be any characteristic or any combination of characteristics or the entirety of which is herein incorporated by reference. including any method of fabrication as disclosed in US Patent Application Publication No. 20170233459, which is incorporated herein by reference. In certain embodiments, a non-human animal with a humanized immune system (eg, a non-human animal for immunization with a humanized immune system) has any characteristic or any combination of characteristics or characteristics described in Kuroiwa, Y et al. Nat Biotechnol, 2009 Feb;27(2):173-81; Matsushita, H.; et al. PLos ONE, 2014 Mar 6;9(3):e90383; Hooper, J.; W. et al. Sci Transl Med, 2014 Nov 26;6(264):264ra162; Matsushit, H.; et al. , PLoS ONE 2015 Jun 24;10(6):e0130699; et al. Sci Transl Med, 2016 Feb 17;8(326):326ra21; Dye, J.; et al. , Sci Rep. 2016 Apr 25;6:24897; Gardner, C.; et al. J Virol. 2017 Jun 26;91(14); Stein, D.; et al. , Antiviral Res 2017 Oct;146:164-173; Silver, J.; N. , Clin Infect Dis. 2018 Mar 19;66(7):1116-1119; H. et al. , Lancet Infect Dis, 2018 Apr;18;(4):410-418; et al. , J Inf Dis. 2018 Nov 33;218(suppl_5):S636-S648, each of which is incorporated herein by reference in its entirety.

Plasma Collection Plasma comprising polyclonal antibodies generated from immunogenic compositions comprising cyclic polyribonucleotides encoding coronavirus antigens and/or epitopes expressed from the cyclic polyribonucleotides disclosed herein is cyclically It can be obtained from a subject immunized with polyribonucleotides (eg, after immunization of the subject for immunization). These polyclonal antibodies can be used in the prevention or treatment of coronaviruses associated with antigens and/or epitopes expressed from cyclic polyribonucleotides. Plasma comprising polyclonal antibodies generated from immunogenic compositions comprising linear polyribonucleotides encoding coronavirus antigens and/or epitopes expressed from the linear polyribonucleotides disclosed herein is can be obtained from a subject immunized with a polyribonucleotide (eg, after immunization of the subject for immunization). These polyclonal antibodies can be used in the prevention or treatment of coronaviruses associated with antigens and/or epitopes expressed from linear polyribonucleotides. Plasma may be collected by plasmapheresis. Plasma may be collected once or multiple times from the same subject (e.g., after immunization of the subject for immunization), e.g. multiple times after , multiple times during immunization, or any combination thereof.

Plasma is collected from the subject (e.g., after immunization of the subject for immunization) after any suitable time of immunization, e.g., the first immunization, the most recent immunization, or an intermediate immunization. can be The plasma is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 21, at least 22, at least 23 , at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 days later, or more. In certain embodiments, the plasma is 2 or less, 3 or less, 4 or less, 5 or less, 6 or less, 7 or less, 8 or less, 9 or less, 10 or less, 15 or less days of immunization, 20 days or less, 21 days or less, 22 days or less, 23 days or less, 24 days or less, 25 days or less, 26 days or less, 27 days or less, 28 days or less, 29 days or less, 30 days or less, 35 days or less, 42 days or less , 49 days or less, or 56 days or less later. In certain embodiments, the plasma is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 16, 17, 18, 20, 21, 22, Collected from the subject after 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 days or longer be done. In certain embodiments, the composition comprises plasma collected after administration of an immunogenic composition described herein.

Plasma can be frozen (eg, stored or shipped frozen). In certain embodiments, plasma is kept fresh or antibodies are purified from fresh plasma.

In certain embodiments, the composition comprises harvested plasma. For example, a composition includes plasma from a subject and a circular polyribonucleotide comprising sequences encoding an antigen. In certain embodiments, the composition comprises plasma from a subject and a cyclic polyribonucleotide comprising a sequence encoding an antigen, and an antigen. In one example, the composition comprises plasma from a subject and a linear polyribonucleotide comprising a sequence encoding an antigen. In certain embodiments, the composition comprises plasma from the subject and a linear polyribonucleotide comprising a sequence encoding the antigen, and the antigen.

Polyclonal Antibody Purification The present disclosure provides a method for treating coronavirus-associated disease by administering to a subject (e.g., treating a subject) a polyclonal antibody specific for a coronavirus antigen and/or epitope of the present invention, as well as an effective amount of the polyclonal antibody. or provide a method of treating or preventing an infectious disease. Polyclonal antibodies are produced as disclosed herein and purified after plasma collection from a subject (e.g., the subject for immunization) immunized with an immunogenic composition comprising cyclic polyribonucleotides. be. Polyclonal antibodies are produced as disclosed herein and purified after plasma collection from a subject (e.g., subject for immunization) immunized with an immunogenic composition comprising linear polyribonucleotides. be done.

Polyclonal antibodies are purified from plasma using techniques well known to those of skill in the art. For example, plasma is pH adjusted to 4.8 (e.g., by dropwise addition of 20% acetic acid), fractionated with caprylic acid at a caprylic acid/total protein ratio of 1.0, and then centrifuged (e.g., , at 10,000 g for 20 minutes at room temperature). Supernatants containing polyclonal antibodies (e.g., IgG polyclonal antibodies) are neutralized to pH 7.5 using 1 M Tris, 0.22 μM filtered, and applied to an anti-human immunoglobulin-specific column (e.g., anti-human IgG light chain specific column). Polyclonal antibodies are further purified by passage over an affinity column that specifically binds impurities, such as non-human antibodies from non-human animals. Polyclonal antibodies are stored in a suitable buffer, eg, a sterile filtered buffer consisting of 10 mM glutamic acid monosodium salt, 262 mM D-sorbitol, and Tween (0.05 mg/ml), pH 5.5. be. The amount and concentration of purified polyclonal antibody is determined. HPLC size exclusion chromatography is performed to determine if aggregates or multimers are present.

In certain embodiments, the human polyclonal antibody is the antibody described in Beigel, JH et al. (Lancet Infect. Dis., 18:410-418 (2018), including package insert) from non-human animals with humanized immune systems. Briefly, humanized IgG polyclonal antibodies from non-human animals with humanized immune systems are purified using chromatography. Fully human IgG is separated from non-human animal IgG using a human IgG kappa chain specific affinity column (eg KappaSelect from GE healthcare) as a capture step. A human IgG kappa chain specific affinity column specifically binds fully human IgG with minimal cross-reactivity to non-human animal IgG Fc and IgG. Additional non-human animal IgG is removed using an IgG Fc-specific affinity column that specifically binds non-human animal IgG (e.g. Capto HC15 from GE healthcare for bovine), which binds non-human animal IgG. Used as a negative affinity step to specifically remove. Anion exchange chromatography steps are also used to further reduce contaminants such as host DNA, endotoxins, IgG aggregates and leached affinity ligands.

Polyclonal Antibodies Polyclonal antibodies produced as disclosed bind to coronavirus antigens and/or epitopes (eg, SARS-CoV-2 antigens and/or epitopes). These polyclonal antibodies are used in methods of treatment or prevention of coronavirus-related diseases or infections (e.g., COVID-19 or SARS-CoV-2 infections), e.g., the antibodies are antigen and/or epitope or It may provide protection from coronaviruses that express similar antigens and/or epitopes.

Polyclonal antibodies of the present disclosure are, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30 , at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least 250, at least 300, at least 350, at least 400, at least Binds 450, at least 500, or more coronavirus antigens or epitopes.

In certain embodiments, the polyclonal antibodies of the present disclosure, e.g. 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 or less, 350 or less, 400 or less, 450 or less, 500 or less, or more Binds to the following coronavirus antigens or epitopes:

In certain embodiments, polyclonal antibodies of the present disclosure are, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, , 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 coronavirus antigens or epitopes.

Polyclonal antibodies of the disclosure bind to one or more epitopes from a coronavirus antigen. For example, a coronavirus antigen comprises an amino acid sequence containing multiple epitopes therein (e.g., epitopes recognized by B cells and/or T cells), and antibody clones bind to one or more of those epitopes. .

In certain embodiments, the polyclonal antibodies of the present disclosure are, e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 , at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least Binds 250, at least 300, at least 350, at least 400, at least 450, at least 500, or more epitopes.

In certain embodiments, the polyclonal antibodies of the present disclosure, e.g. , 20 or less, 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 It binds to 350 or less, 400 or less, 450 or less, or 500 or less, or less epitopes.

In certain embodiments, the polyclonal antibodies of the present disclosure contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, Binds 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 epitopes.

Polyclonal antibodies of the disclosure bind to variants of coronavirus antigens or epitopes. Variants can be natural variants (e.g., variants identified in sequence data from different coronavirus species, isolates, or quasispecies) or derivatives disclosed herein produced in silico. It may be a sequence (eg, an antigen or epitope that has one or more amino acid insertions, deletions, substitutions, or combinations thereof compared to a wild-type antigen or epitope).

In certain embodiments, the polyclonal antibodies of the present disclosure, e.g. , at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 120, at least 140, at least 160, at least 180, at least 200, at least Binds 250, at least 300, at least 350, at least 400, at least 450, at least 500, or more variants.

In certain embodiments, the polyclonal antibodies of the present disclosure, e.g. , 20 or less, 25 or less, 30 or less, 40 or less, 50 or less, 60 or less, 70 or less, 80 or less, 90 or less, 100 or less, 120 or less, 140 or less, 160 or less, 180 or less, 200 or less, 250 or less, 300 Below, 350 or less, 400 or less, 450 or less, 500 or less, or less variants bind.

In certain embodiments, the polyclonal antibodies of the present disclosure, e.g. Binds 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, or 500 variants.

In certain embodiments, the antibodies of this disclosure are neutralizing antibodies, non-neutralizing antibodies, or combinations thereof.

A humanized antibody, or variants, fragments, and derivatives thereof, can be an antibody that can be formulated for administration to humans. A humanized antibody can be a chimeric humanized antibody or a fully human antibody.

A humanized antibody can be, for example, a chimeric humanized antibody comprising amino acid sequences having similarity from or to human antibody amino acid sequences and non-human amino acid sequences. For example, a portion of the heavy and/or light chain of a chimeric humanized antibody can be identical or similar to the corresponding sequences in a human antibody, while the remainder of the chains can be non-human, e.g. identical or similar to the corresponding sequence in an antibody from the same species or belonging to another antibody class or subclass. Non-human sequences can be humanized to reduce potential immunogenicity while retaining target specificity, for example, by the incorporation of human DNA into the gene sequences of genes that produce antibodies in non-human animals.

A humanized antibody can be, for example, a fully human antibody that contains amino acid sequences that are human antibody amino acid sequences.

In certain embodiments, a non-human animal with a humanized immune system produces only fully human antibodies.

An antibody of the present disclosure can be an antibody comprising the basic four chain antibody unit. A basic four chain antibody unit may comprise two heavy chain (H) polypeptide sequences and two light chain (L) polypeptide sequences. Each of the heavy chains can include one N-terminal variable (V _H ) region and three or four C-terminal constant (C _H 1, C _H 2, C _H 3, and C _H 4) regions. Each light chain may comprise one N-terminal variable (V _L ) region and one C-terminal constant (C _L ) region. The light chain variable region is aligned with the heavy chain variable region and the light chain constant region is aligned with the first heavy chain constant region _CH1 . The pairing of heavy and light chain variable regions together form a single antigen-binding site. Each light chain is linked to a heavy chain by one covalent disulfide bond. The two heavy chains are linked together by one or more disulfide bonds, depending on the heavy chain isotype. Each heavy and light chain can also contain regularly spaced intrachain disulfide bridges. The C-terminal constant region of the heavy chain comprises the Fc region of an antibody, which can mediate effector functions, for example, by interacting with Fc receptors or complement proteins.

Light chains can be designated kappa or lambda, based on the amino acid sequence of the constant region. Heavy chains can be designated α, δ, ε, γ, or μ, based on the amino acid sequence of the constant region. Antibodies are divided into five immunoglobulin classes, or isotypes, based on their heavy chains. IgA contains alpha heavy chains, IgD contains delta heavy chains, IgE contains epsilon heavy chains, IgG contains gamma heavy chains and IgM contains mu heavy chains. The IgG, IgD, and IgE classes of antibodies contain monomers of the four chain units (two heavy and two light chains) described above, while the IgM and IgA classes contain multimers of four chain units. obtain. The α and γ classes are further divided into subclasses based on differences in heavy chain constant region sequence and function. Subclasses of IgA and IgG expressed by humans include IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.

Exemplary amino acid sequences of human constant domain sequences are shown in Table 4. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgG1 constant domain sequence, eg, SEQ ID NO:34, or a variant, derivative, or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgG2 constant domain sequence, eg, SEQ ID NO:35 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgG3 constant domain sequence, eg, SEQ ID NO:36 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgG4 constant domain sequence, eg, SEQ ID NO:37 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgE constant domain sequence, eg, SEQ ID NO:38 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgA1 constant domain sequence, eg, SEQ ID NO:39 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgA2 constant domain sequence, eg, SEQ ID NO:40 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgM constant domain sequence, eg, SEQ ID NO:41 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgD constant domain sequence, eg, SEQ ID NO: 42 or a variant, derivative or fragment thereof.

The antibodies of this disclosure comprise human light chain constant domain sequences, eg, kappa (IgK) or lambda (IgL) chains. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgK constant domain sequence, eg, SEQ ID NO:43 or a variant, derivative or fragment thereof. In certain embodiments, an antibody, non-human animal, or non-human B-cell of the disclosure comprises a human IgL constant domain sequence, eg, SEQ ID NO:44 or a variant, derivative or fragment thereof.

Table 5 provides example light chain constant domain sequences.

Signal peptides can lead to higher protein expression and/or secretion by cells. In certain embodiments, an antibody of this disclosure includes a signal peptide. A signal peptidase can cleave the signal peptide from the protein, eg, during the secretory process, to produce a mature protein without the signal peptide sequence. In certain embodiments, the signal peptide is cleaved from the compounds or antibodies of this disclosure. In certain embodiments, the mature compounds or antibodies of this disclosure do not contain a signal peptide.

Constant regions may mediate various effector functions and may be minimally involved in antigen binding. Different IgG isotypes or subclasses may be associated with different effector functions or therapeutic properties, for example due to interactions with different Fc receptors and/or complement proteins. Antibodies comprising Fc regions that engage activating Fc receptors are used, for example, for antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), complement-dependent cytotoxicity (CDC), immunoreceptor It may be involved in the induction of signaling by somatic tyrosine-based activation motifs (ITAMs) and in the induction of cytokine secretion. Antibodies comprising Fc regions that engage inhibitory Fc receptors can induce signaling through, for example, immunoreceptor tyrosine-based inhibition motifs (ITIMs).

Different antibody subclasses contain different abilities to elicit immune effector functions. For example, IgG1 and IgG3 can effectively mobilize complement and activate CDC, and IgG2 causes minimal ADCC. IgG4 has a lower ability to elicit immune effector functions. Modifications to the constant region may also enhance or reduce antibody properties, e.g., enhance or reduce Fc receptor ligation, enhance or reduce ADCC, enhance or reduce ADCP, enhance or reduce CDC, enhance or reduce ITAM-mediated signaling, It may affect enhancing or reducing cytokine induction, enhancing or reducing ITIM-mediated signaling, enhancing or reducing half-life, or enhancing or reducing antigen co-engagement with Fc receptors. Modifications can include, for example, amino acid mutations, post-translational modifications (eg, glycosylation), combining domains from different isotypes or subclasses, or combinations thereof.

Antibodies of the present disclosure may comprise constant or Fc regions that are selected or modified to provide suitable antibody properties, for example properties suitable for treating the diseases or conditions disclosed herein. In certain embodiments, IgG1 can be used to promote inflammation, immune activation, and immune effector function, eg, for the treatment of infectious diseases. In certain embodiments, IgG4 can be used when antagonistic properties of antibodies with reduced immune effector function are desired, such as neutralizing coronavirus antigens without promoting inflammation and immune activation. and to inhibit viral entry into cells).

Non-limiting examples of antibody modifications and their effects are shown in Table 6.

The variable (V) region mediates antigen binding and may define the specificity of a particular antibody for antigen. The variable region includes relatively invariant sequences, called framework regions, and hypervariable regions, which vary considerably in sequence among antibodies of different binding specificities. Each antibody heavy or light chain variable region contains four framework regions separated by three hypervariable regions. The variable regions of the heavy and light chains are folded so that the hypervariable regions are in close proximity together to create the antigen binding site. The four framework regions predominantly adopt the f3-sheet form, while the three hypervariable regions link the f3-sheet structure and, in some cases, loops that form part of the f3-sheet structure. Form.

Within the hypervariable regions are the amino acid residues that primarily determine the binding specificity of an antibody. Sequences containing these residues are known as complementarity determining regions (CDRs). One antigen-binding site of an antibody can comprise six CDRs, three in the hypervariable region of the light chain and three in the hypervariable region of the heavy chain. The CDRs in the light chain can be designated LCDR1, LCDR2, LCDR3, while the CDRs in the heavy chain can be designated HCDR1, HCDR2, and HCDR3.

In certain embodiments, the antibodies of this disclosure include variants, derivatives and antigen-binding fragments thereof. For example, non-human animals can be genetically engineered to produce antibody variants, derivatives, and antigen-binding fragments. In certain embodiments, the antibody may be a single domain antibody (sdAb), eg, a heavy chain only antibody (HCAb) VHH, or a nanobody. Non-limiting examples of antigen binding fragments include Fab, Fab′, F(ab′) ₂ , dimers and trimers of Fab conjugates, Fv, scFv, minibodies, double-, triple-, and tetraspecific antibodies, and linear antibodies. Fab and Fab' are antigen-binding fragments that may comprise the _VH and _CHI domains of the heavy chain linked via disulfide bonds to the _VL and _CL domains of the light chain. F(ab') ₂ may comprise two Fabs or Fab's linked by disulfide bonds. An Fv can comprise V _H and V _L domains that are held together by non-covalent interactions. A scFv (single-chain variable fragment) is a fusion protein that may comprise the _VH and _VL domains joined by a peptide linker. Through manipulation of _VH and _VL domain orientation and linker length, different forms of molecules can be produced. Minibodies are scFv-C _H3 fusion proteins that assemble into bivalent dimers.

In certain embodiments, antibodies of the present disclosure can be obtained by administering an immunogenic composition disclosed herein to a non-human animal or human subject (e.g., non-human animal or human subject for immunization). is an anti-coronavirus antibody produced by In certain embodiments, multiple antibodies of the present disclosure are used to immunize a non-human animal or human subject (e.g., non-human animal or human subject for immunization) with an immunogenic composition disclosed herein. multiple anti-coronavirus polyclonal antibodies produced by In certain embodiments, the anti-coronavirus antibody or anti-coronavirus polyclonal antibodies further comprise a pharmaceutically acceptable carrier or excipient. In certain embodiments, a non-human animal (eg, a non-human animal subject for immunization) is a non-human animal with a humanized immune system.

Pharmaceutical Compositions In certain embodiments, an immunogenic composition administered to a subject (eg, a subject for immunization) is a pharmaceutical composition. The pharmaceutical compositions envisioned by this invention may also contain pharmaceutically acceptable excipients.

The disclosure also provides pharmaceutical compositions comprising a plurality of polyclonal antibodies or polyclonal antibody formulations against the coronaviruses disclosed herein and a pharmaceutically acceptable excipient.

A pharmaceutically acceptable excipient can be a non-carrier excipient. Non-carrier excipients serve as vehicles or vehicles for the compositions, such as the cyclic polyribonucleotides described herein. Non-carrier excipients serve as a vehicle or medium for the compositions, such as the linear polyribonucleotides described herein. Non-limiting examples of non-carrier excipients include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersants, suspension aids, surfactants, isotonic agents, thickeners, emulsifiers , preservatives, polymers, peptides, proteins, cells, hyaluronidase, dispersing agents, granulating agents, disintegrating agents, binders, buffers (e.g., phosphate buffered saline (PBS)), lubricants, oils, and Mixtures thereof are included. The non-carrier excipient can be any one of the non-active ingredients listed in the Inactive Ingredient Database approved by the United States Food and Drug Administration (FDA) and not exhibiting cell-penetrating effects. . Pharmaceutical compositions may optionally comprise one or more additional active substances, eg therapeutically and/or prophylactically active substances. Pharmaceutical compositions of the invention may be sterile and/or pyrogen-free. A general discussion on the formulation and/or manufacture of pharmaceuticals can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed. , Lippincott Williams & Wilkins, 2005, incorporated herein by reference.

A pharmaceutical composition of the disclosure may comprise a polyclonal antibody of the disclosure, a cyclic polyribonucleotide of the disclosure, or a combination thereof. A pharmaceutical composition of the disclosure may comprise a polyclonal antibody of the disclosure, a linear polyribonucleotide of the disclosure, or a combination thereof. A pharmaceutical composition of the disclosure may comprise a polyclonal antibody of the disclosure, a cyclic polyribonucleotide of the disclosure, a linear polyribonucleotide of the disclosure, or a combination thereof.

In certain embodiments, the pharmaceutical compositions provided herein are suitable for administration to humans. In certain embodiments, the pharmaceutical compositions provided herein (e.g., comprising cyclic polyribonucleotides, linear polyribonucleotides, or immunogenic compositions described herein) are administered to a subject (e.g., , subject for immunization), wherein the subject is a human. In certain embodiments, pharmaceutical compositions provided herein (e.g., comprising a plurality of polyclonal antibodies or polyclonal antibody formulations described herein) are administered to a subject (e.g., a subject for immunization). where the subject is a human.

In certain embodiments, the pharmaceutical compositions provided herein (e.g., comprising cyclic polyribonucleotides, linear polyribonucleotides, or immunogenic compositions described herein) are administered to a subject (e.g., , subject for immunization), where the subject is, for example, a non-human animal suitable for veterinary use. Modification of a pharmaceutical composition suitable for administration to humans so that the composition is suitable for administration to a variety of animals is well understood and the ordinarily skilled veterinary pharmacologist, if any, can design and/or make such changes with no more than routine experimentation. Subjects to which the pharmaceutical compositions are contemplated for administration include, but are not limited to, humans and/or other primates; commercially relevant mammals such as bovine, porcine, equine, ovine, feline, canine, and murine and/or pets and livestock animals such as rats; and/or birds, including commercially relevant birds such as parrots, poultry, chickens, ducks, geese, hens or roosters, and/or turkeys; Examples include mammals, including felines; non-mammals, such as reptiles, fish, amphibians, and any other animals.

In certain embodiments, pharmaceutical compositions provided herein (e.g., comprising a plurality of polyclonal antibodies or polyclonal antibody formulations described herein) are administered to a subject (e.g., a subject for immunization). where the subject is, for example, a non-human animal suitable for veterinary use. Modification of a pharmaceutical composition suitable for administration to humans so that the composition is suitable for administration to a variety of animals is well understood and the ordinarily skilled veterinary pharmacologist, if at all, can design and/or make such changes with no more than routine experimentation. Subjects to which the pharmaceutical compositions are contemplated for administration include, but are not limited to, humans and/or other primates; commercially relevant mammals such as bovine, porcine, equine, ovine, feline, canine, and murine and/or pets and livestock animals such as rats; and/or birds, including commercially relevant birds such as parrots, poultry, chickens, ducks, geese, hens or roosters, and/or turkeys; Examples include mammals, including felines; non-mammals, such as reptiles, fish, amphibians, and any other animals.

Subjects (eg, subjects for immunization or subjects for treatment) envisioned for administration of the pharmaceutical composition include any ungulate.

The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such methods of preparation involve combining the active ingredient with the excipients and/or one or more other adjunct ingredients, and then dividing, shaping and/or dividing the product as necessary and/or desired. Or include the step of packaging.

Pharmaceutical compositions can be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other ordered structure suitable to high drug concentration. Examples of suitable aqueous and non-aqueous compositions that can be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils such as olive oil. , and injectable organic acid esters such as ethyl oleate. Proper fluidity can be maintained, for example, by use of a coating material such as lecithin, by maintenance of the required particle size in the case of dispersions, and by use of surfactants.

Sterile injectable solutions are formulated, for example, with one or a combination of the ingredients listed above in the required amount of the active compound (e.g., cyclic polyribonucleotides, linear polyribonucleotides, or agents, such as antibodies), followed by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients such as those from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying (freezing), which yields a powder of the active ingredient along with any additional desired ingredients from a previously sterile-filtered solution thereof. dry).

Agents of the present disclosure (eg, cyclic polyribonucleotides, linear polyribonucleotides, or antibodies) can be prepared in compositions that protect them from rapid release, such as implants, transdermal patches, and microcapsules. controlled release formulations, including controlled delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations are generally known to those skilled in the art. See, for example, Sustained and Controlled Release Drug Delivery Systems, J. Am. R. Robinson, ed. , Marcel Dekker, Inc.; , New York, 1978. Compositions of the present disclosure can be, for example, in immediate release form or in controlled release formulations. Immediate release formulations may be formulated to allow a compound (eg, a cyclic polyribonucleotide, linear polyribonucleotide or drug such as an antibody) to act rapidly. Non-limiting examples of immediate release formulations include readily dissolvable formulations. Controlled-release formulations are adapted so that the release rate and release profile of the active agent can be matched to physiological and chronotherapeutic requirements, or are formulated to provide release of the active agent at a programmed rate. pharmaceutical formulations. Non-limiting examples of controlled release formulations include granules, delayed release granules, hydrogels (e.g. synthetic or naturally derived), other gelling agents (e.g. gel-forming dietary fibers), matrix-based formulations (e.g. , formulations comprising polymeric materials with at least one active ingredient dispersed therein), granules in matrices, polymer mixtures, and granular masses.

Pharmaceutical formulations for administration may include aqueous solutions of active compounds in water-soluble form (eg, cyclic polyribonucleotides, linear polyribonucleotides, or agents such as antibodies). Suspensions of the active compounds may be prepared as oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. The suspension may also contain suitable stabilizers or agents that increase the solubility of the drugs to allow for the preparation of highly concentrated solutions. The active ingredient may be in powder form for constitution with a sterile vehicle, eg, sterile pyrogen-free distilled water, before use.

Methods for the preparation of compositions containing the agents described herein involve formulating the agent with one or more inert pharmaceutically acceptable excipients or carriers to form a solid, semisolid, or forming a liquid composition. Solid compositions include, for example, powders, dispersible granules, and cachets. Liquid compositions include, for example, a solution in which the drug is dissolved, an emulsion containing the drug, or a solution containing liposomes, micelles, or nanoparticles containing the drug disclosed herein. Semi-solid compositions include, for example, gels, suspensions and creams. The compositions can be in liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to use, or as emulsions. These compositions may also contain minor amounts of nontoxic, auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and other pharmaceutically acceptable additives.

Non-limiting examples of dosage forms suitable for use in the present disclosure include liquids, powders, gels, nanosuspensions, nanoparticles, microgels, aqueous or oily suspensions, emulsions, and any of these. A combination is included.

In certain embodiments, formulations of the present disclosure contain heat stabilizers, such as sugars or sugar alcohols such as sucrose, sorbitol, glycerol, trehalose, or mannitol, or any combination thereof. In some embodiments, the stabilizer is sugar. In some embodiments, the sugar is sucrose, mannitol or trehalose.

Pharmaceutical compositions described herein can be formulated to include, for example, a pharmaceutical excipient or carrier. Pharmaceutical carriers can be membranes, lipid bilayers, and/or polymeric carriers, such as liposomes or particles, such as nanoparticles, such as lipid nanoparticles, known to those skilled in the art, such as by partial or complete encapsulation of cyclic polyribonucleotides. A subject (e.g., a subject for immunization or a subject for immunization) in need thereof (e.g., a human or non-human agricultural or livestock animal, e.g., cattle, dog, cat, horse, poultry) by the method of ).

Methods of Delivery The cyclic polyribonucleotides described herein or pharmaceutical compositions thereof described herein are administered to cells in vesicles or other membrane-based carriers described herein. obtain. Linear polyribonucleotides described herein or pharmaceutical compositions thereof described herein can be administered to cells in vesicles or other membrane-based carriers described herein.

In certain embodiments, the cells are eukaryotic cells. In some embodiments, the cells are mammalian cells. In certain embodiments, the cells are ungulate cells. In certain embodiments, the cells are animal cells. In some embodiments, the cells are immune cells. In some embodiments, the tissue is connective tissue, muscle tissue, nerve tissue, or epithelial tissue. In certain embodiments, the tissue is an organ (eg, liver, lung, spleen, kidney, etc.). In certain embodiments, the subject (eg, the subject for immunization) is a mammal. In certain embodiments, the subject (eg, the subject for immunization) is an ungulate.

In certain embodiments, the pharmaceutical formulations disclosed herein comprise (i) a compound disclosed herein (e.g., a cyclic polyribonucleotide or antibody); (ii) a buffer; (iii) a non-ionic (iv) a tonicity agent; and (v) a stabilizer. In certain embodiments, the pharmaceutical formulations disclosed herein comprise (i) a compound (e.g., linear polyribonucleotide or antibody) disclosed herein; (ii) a buffer; (iii) a non-ionic (iv) a tonicity agent; and (v) a stabilizer. In certain embodiments, the pharmaceutical formulations disclosed herein are stable liquid pharmaceutical formulations.

Methods of Treatment The present disclosure can be used in compositions and methods useful as a treatment or prophylaxis, e.g., to protect a subject (e.g., a subject for immunization or a subject for treatment) from the effects of coronavirus infection. Compositions and methods comprising antibodies are provided. For example, cyclic polyribonucleotides of the present disclosure can be administered to a subject (e.g., for immunization) to stimulate the production of antibodies (e.g., human polyclonal antibodies) that bind to desired coronavirus antigens and/or epitopes. can be administered to Linear polyribonucleotides of the present disclosure may be administered to a subject (e.g., a subject for immunization) to stimulate the production of antibodies (e.g., human polyclonal antibodies) that bind to desired coronavirus antigens and/or epitopes. can be administered. Antibodies are obtained from a subject (e.g., after immunization of a subject for immunization), e.g., to a subject (e.g., a subject for immunization, e.g., a human subject for therapy), e.g., as a treatment or prophylaxis. can be formulated for administration of Antibodies may, for example, provide protection from coronavirus expressing antigens and/or epitopes. In another example, cyclic polyribonucleotides are administered to a human subject (e.g., a human subject for immunization) to stimulate the production of antibodies in the human subject that bind to the desired antigen/and or epitope. obtain. In another example, linear polyribonucleotides are administered to a human subject (e.g., a human subject for immunization) to stimulate the production of antibodies in the human subject that bind to the desired antigen/and or epitope. can be In certain embodiments, the present disclosure provides compositions for use in treating or preventing coronavirus infection.

Non-limiting examples of conditions and diseases that can be treated by the compositions and methods of this disclosure include those caused by or associated with the coronaviruses disclosed herein, such as coronavirus infections. . In certain embodiments, the condition is caused by or associated with SARS-CoV. In certain embodiments, the condition is caused by or associated with SARS-CoV-2. In certain embodiments, the condition is coronavirus disease 2019 (COVID-19). In certain embodiments, the condition is caused by or associated with MERS-CoV.

In certain embodiments, polyclonal antibodies are generated by immunizing a non-human animal or human subject (e.g., non-human animal or human subject for immunization) with a cyclic polyribonucleotide of the present disclosure, and the plasma is , from a non-human animal or human subject (eg, after immunization of the non-human animal or human subject for immunization), and polyclonal antibodies are purified from the plasma. In certain embodiments, polyclonal antibodies are generated by immunizing a non-human animal or human subject (e.g., non-human animal or human subject for immunization) with linear polyribonucleotides of the present disclosure and plasma is obtained from a non-human animal or human subject (eg, after immunization of the non-human animal or human subject for immunization) and polyclonal antibodies are purified from plasma. Optionally, purified polyclonal antibodies from two or more non-human animals or human subjects (e.g., after immunization of two or more non-human animals or human subjects for immunization), the same non-human animal or human subject ( A plurality of purified polyclonal antibody samples from, e.g., a non-human animal for immunization or post-immunization of a human subject, or a combination thereof, are pooled together and used in a subject in need thereof (e.g., immunization subject for treatment), eg, to a human subject in need thereof (eg, a human subject for treatment). In certain embodiments, polyclonal antibodies are formulated in a polyclonal antibody formulation, eg, a polyclonal antibody formulation against coronavirus. A method of producing a human polyclonal antibody preparation against coronavirus, comprising: (a) introducing into an animal capable of producing antibodies (e.g., an animal for immunization) a polyribonucleotide comprising sequences encoding a coronavirus antigen; administering an immunogenic composition comprising nucleotides (e.g., cyclic polyribonucleotides or linear polyribonucleotides); (b) collecting blood or plasma from a mammal; (c) removing coronavirus from blood or plasma; and (d) as a therapeutic or pharmaceutical formulation for human use (e.g., administration for human subjects for therapy) or for non-human animal use (e.g., for non-human animal therapy). administering to a subject for administration), a method comprising formulating a polyclonal antibody as a veterinary formulation.

In certain embodiments, the method tests for the presence of polyclonal antibodies to coronavirus antigens in subjects with coronavirus infection (e.g., subjects for treatment), subjects at risk of exposure to coronavirus infection (e.g., treatment for treatment), or in need thereof (eg, for treatment). In certain embodiments, the monitoring is before administration of the polyclonal antibody and/or after administration of the polyclonal antibody.

In practicing the methods or uses of treatment provided herein, a therapeutically effective amount of a compound described herein (e.g., an agent such as a cyclic polyribonucleotide or an antibody) is used to treat the disease or disease to be treated. It is administered in a pharmaceutical composition to a subject having a condition or in need of prophylaxis (eg, a subject for immunization or a subject for treatment). In practicing the methods or uses of treatment provided herein, a therapeutically effective amount of a compound described herein (e.g., an agent such as a linear polyribonucleotide or an antibody) is used to treat the disease or administered in a pharmaceutical composition to a subject having a condition or in need of prophylaxis (eg, a subject for immunization or a subject for treatment). In certain embodiments, a subject (eg, a subject for immunization or a subject for treatment) is a mammal, such as a human. A therapeutically effective amount depends on the severity of the disease, the age and associated health of the subject (e.g., the subject for immunization or the subject for treatment), the potency of the compound used, the characteristics of the given coronavirus, and It can vary widely, depending on other factors.

Methods and Routes of Administration The compositions (eg, pharmaceutical compositions) disclosed herein can be administered in therapeutically effective amounts by a variety of forms and routes, including, for example, oral or topical administration. In certain embodiments, the composition is parenteral, intravenous, subcutaneous, intramuscular, intradermal, intraperitoneal, intracerebral, intrathecal, intraocular, intrasternal, intraocular, endothelial, topical, intranasal, intrapulmonary. , rectal, intraarterial, intrathecal, inhalation, intralesional, intradermal, epidural, intracapsular, subcapsular, intracardiac, intratracheal, subepidermal, intrathecal, or intrathecal administration, e.g., injection or may be administered by injection. In certain embodiments, compositions may be administered by absorption through epithelial or mucocutaneous linings (eg, oral mucosal, rectal and intestinal mucosal administration). In certain embodiments, the composition is delivered by multiple routes of administration.

In certain embodiments, the composition is administered by intravenous injection. In certain embodiments, the composition is administered by slow continuous infusion over an extended period of time, such as greater than 24 hours. In certain embodiments, the composition is administered as an intravenous injection or brief infusion.

Pharmaceutical compositions may be administered locally, eg, by injection of the drug directly into an organ, optionally in a depot or sustained release formulation or implant. The pharmaceutical compositions may be provided in the form of immediate release formulations, sustained release formulations, or intermediate release formulations. Immediate release forms may provide immediate release. Sustained-release formulations may provide controlled release or sustained delayed release. In certain embodiments, a pump may be used for delivery of the pharmaceutical composition. In certain embodiments, a pen-type delivery device can be used, for example, for subcutaneous delivery of the compositions of the present disclosure.

The pharmaceutical compositions provided herein can be administered with other therapies such as antiviral therapy, antibiotics, cell therapy, cytokine therapy, or anti-inflammatory agents. In certain embodiments, the cyclic polyribonucleotides or antibodies described herein can be used alone or in combination with one or more therapeutic agents as components of mixtures. In certain embodiments, the linear polyribonucleotides or antibodies described herein can be used alone or in combination with one or more therapeutic agents as components of mixtures.

Dosage and Frequency The therapeutic agents described herein can be administered before, during, or after the onset of a disease or condition, and the timing of administering compositions containing therapeutic agents can vary. In some cases, the compositions can be used as prophylactic agents in subjects with susceptibility to coronavirus or predisposition to conditions or diseases associated with coronavirus (e.g., subjects for immunization or subjects for treatment). can be administered continuously for Prophylactic administration may reduce the likelihood of developing an infection, disease or condition or may reduce the severity of an infection, disease or condition.

The composition can be administered to a subject (eg, for immunization or for treatment) after the onset of symptoms (eg, as soon as possible after the onset of symptoms). The composition may be used in a test result, e.g., a test result that provides a diagnosis, a test that indicates the presence of coronavirus in a subject (e.g., a subject for immunization or a subject for treatment), or a disease course, e.g., a reduction can be administered to a subject (eg, for immunization or for treatment) after a test indicating the blood oxygen level determined (eg, as soon as possible after the test results). A therapeutic agent can be administered after occurrence of a disease or condition is detected or suspected (eg, as soon as possible after being detected or suspected). Therapeutic agents are administered after potential exposure to a coronavirus (e.g., as soon as practicable after exposure), e.g., when a subject (e.g., for immunization or for treatment) becomes infected It can be administered after contact with a subject or after being found in contact with a potentially infectious infected subject.

The cyclic polyribonucleotides, antibodies, or therapeutic agents described herein are administered at any desired interval. Linear polyribonucleotides, antibodies, or therapeutic agents described herein are administered at any desired interval.

The actual dosage level of an agent (e.g., cyclic polyribonucleotide, linear polyribonucleotide, antibody, or therapeutic agent) of the disclosure will depend on the subject (e.g., subject for immunization or treatment). may be varied to obtain the amount of drug to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without toxicity to the patient. The selected dosage level will depend on the activity of the particular composition of the invention employed, route of administration, timing of administration, excretion rate, duration of treatment, other drugs used in combination with the particular composition employed, It may depend on various pharmacokinetic factors, including the compound and/or material, the age, sex, weight, medical condition, general health and previous medical history of the patient being treated, and similar factors well known in the medical arts. .

Dosage regimens may be adjusted to provide the optimum desired response (eg, a therapeutic and/or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time, or the dose may be proportionally decreased or increased as indicated by the exigencies of the therapeutic situation. . It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for a subject (e.g., a subject for immunization or a subject for treatment); A unit contains a predetermined quantity of active agent calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The dosage unit form specifications of the present disclosure are based on (a) the unique properties of the active agent and the particular therapeutic effect to be achieved, and (b) the ability to formulate such an active agent for treatment of susceptibility in an individual. It can be determined by and directly in accordance with constraints inherent in the art. Dosages can be determined by reference to plasma or local concentrations of cyclic polyribonucleotides or antibodies. Dosages can be determined by reference to plasma or local concentrations of linear polyribonucleotides or antibodies.

The pharmaceutical compositions described herein may be in unit dosage forms suitable for single administration of precise dosages. In unit dosage form, the formulation may be divided into unit doses containing appropriate quantities of one or more cyclic polyribonucleotides, antibodies, and/or therapeutic agents. In unit dosage form, the formulation may be divided into unit doses containing appropriate quantities of one or more linear polyribonucleotides, antibodies, and/or therapeutic agents. The unit dose can be in the form of a package containing discrete quantities of the formulation. Non-limiting examples are packaged injections, vials, and ampoules. Aqueous suspension compositions disclosed herein can be packaged in single-dose non-reclosable containers. Multi-dose resealable containers may be used, for example, with or without preservatives. Formulations for injection disclosed herein may be presented in unit dosage form, eg, in ampoules or in multi-dose containers, containing a preservative.

Dosages can be based on the amount of agent per kilogram of body weight of a subject (eg, a subject for immunization or a subject for treatment). The dose of the agent (eg, antibody) is 10-3000 mg/kg, such as 100-2000 mg/kg, such as 300-500 mg/kg/day for 1-10 days or 1-5 days; 400 mg/kg/day for over 3 days; eg, 1 g/kg/day over 2-3 days.

Subject Compositions are provided for use in treating or preventing the conditions disclosed herein, such as infection by coronavirus. The composition can be administered to a subject (eg, for immunization or for treatment) with a coronavirus infection or an associated disease or condition. The composition may be used to reduce the likelihood of an infection, disease or condition, or reduce the severity of an infection, disease or condition in a subject having a predisposition to coronavirus infection or a susceptibility to a related condition or disease. It can be administered as a prophylactic agent (eg, to a subject for immunization or for treatment).

A subject (eg, a subject for immunization or a subject for treatment) can be a subject infected with a coronavirus. A subject (eg, a subject for immunization or a subject for treatment) can be a subject who tests positive for coronavirus. A subject (eg, a subject for immunization or a subject for treatment) can be a subject exposed to a coronavirus. A subject (eg, a subject for immunization or a subject for treatment) can be a subject who may have been exposed to a coronavirus. A subject (eg, a subject for immunization or a subject for treatment) can be a subject who exhibits one or more signs and/or symptoms consistent with infection with a coronavirus.

In certain embodiments, a subject (eg, a subject for immunization or a subject for treatment) is a subject at high risk of contact with a coronavirus of the disclosure. For example, subjects (e.g., subjects for immunization or subjects for treatment) are more likely to come into contact with the coronaviruses of the present disclosure (e.g., SARS-CoV2), health care workers, laboratory researchers , or a first responder. A subject (e.g., a subject for immunization or a subject for treatment) may be a medical facility, e.g. Or you may work in a nursing home.

In certain embodiments, a subject (eg, a subject for immunization or a subject for treatment) is a subject at high risk of complications if infected with a coronavirus of the disclosure. For example, a subject (e.g., a subject for immunization or a subject for treatment) may have comorbidities, age over 50, type 1 diabetes, type 2 diabetes, insulin resistance, or a combination thereof. . In certain embodiments, the subject is an immunocompromised subject. In certain embodiments, the subject (eg, the subject for immunization or the subject for treatment) is taking an immunosuppressant. In certain embodiments, a subject (eg, a subject for immunization or a subject for treatment) is a transplant recipient taking an immunosuppressant. In certain embodiments, a subject (eg, a subject for immunization or a subject for therapy) is undergoing cancer treatment, eg, chemotherapy, which can impair the function of the immune system.

A subject (eg, a subject for immunization or a subject for treatment) can be a mammal. A subject (eg, a subject for immunization or a subject for treatment) can be human. A subject (eg, a subject for immunization or a subject for treatment) can be a non-human animal. A non-human animal can be a farm animal, such as a cow, pig, sheep, horse, or goat; a pet, such as a cat or dog; or a zoo animal, such as a feline.

The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.

Example 1: Circular RNA Constructs This example describes the design of novel SARS-CoV-2 open reading frames (ORFs) and circular RNA constructs.

In this example, the SARS-CoV-2 ORF and circular RNA constructs encoding the SARS-CoV-2 ORF were designed as described in Table 2.

Example 2: In Vitro Production of Circular RNA Encoding SARS-CoV-2 Antigen This example demonstrates in vitro production of circular RNA.

Circular RNAs were designed to contain an IRES, an ORF encoding a modified SARS-CoV-2 spike antigen or RBD antigen (as described in Example 1), and two spacer elements flanking the IRES-ORF. . Circularization enables rolling circle translation, multiple ORFs with alternating staggered elements for distinct ORF expression and controlled protein stoichiometry, and an IRES targeting RNA for ribosome entry. . An exemplary drawing of a circular polyribonucleotide containing sequences encoding coronavirus antigens is shown in FIG.

In this example, circular RNA was generated as follows. Unmodified linear RNA was synthesized from the DNA segment by in vitro transcription using T7 RNA polymerase. Transcribed RNA was purified using the RNA Purification System (New England Biolabs, Inc.), treated with RNA 5' phosphohydrolase (RppH) (New England Biolabs, M0356) according to the manufacturer's instructions, and the RNA Purification System was purified. Purified again using RppH-treated linear RNA was circularized with splinted DNA. Alternatively or in addition to treatment with 5'RppH, RNA was transcribed under conditions with excess GMP over GTP.

Splint ligations were performed as follows: circular RNA was transcribed using T4 DNA ligase 1 (New England Bio, Inc., M0437M), linear RNA and DNA splints (5′-GTTTTTCGGCCTATTCCCAATAGCCGTTTTG-3′). (SEQ ID NO:47). To purify the circular RNAs, the ligation mixture was resolved on 4% denaturing PAGE to excise the RNA corresponding to each of the circular RNAs. Excised RNA gel fragments were crushed and RNA was eluted with gel elution buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA) for 1 hour at 37°C. The eluted buffer was collected and RNA was eluted again by adding gel elution buffer to the crushed gel and incubated for 1 hour. Gel debris was removed by centrifugation filters and RNA was precipitated with ethanol. Agarose gel electrophoresis was used as a quality control measure to confirm purity and circularization. Additionally or alternatively, circular RNA was purified using column chromatography.

Example 3: mRNA Constructs This example describes the design of novel mRNA constructs encoding the SARS-CoV-2 ORF.

In this example, linear RNA constructs encoding the SARS-CoV-2 ORFs were designed as described in Table 3.

Example 4 In Vitro Production of mRNA Encoding SARS-CoV-2 Antigen This example demonstrates in vitro production of mRNA.

In this example, mRNA was engineered with ORFs encoding the modified SARS-CoV-2 spike antigen or RBD as described in Example 3.

In this example, modified mRNA was generated by in vitro transcription. The RNA was fully substituted with pseudouridine and 5-methyl-C, capped with CleanCap™ AG, contained 5' and 3' human α-globin UTRs, and polyadenylated. mRNA was Urea-PAGE purified, eluted in buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA), ethanol precipitated, and RNA storage solution (ThermoFisher Scientific, cat# AM7000). ). Agarose gel electrophoresis was used as a quality control measure to confirm purity and circularization.

Example 5 Expression of Secreted SARS-CoV-2 Antigens from Circular RNA in Mammalian Cells This example demonstrates the ability to express viral antigens from circular RNA in mammalian cells.

In this example, circular RNA encoding the SARS-CoV-2 RBD antigen was designed, produced and purified by the methods described herein.

Expression of circular RNA encoding RBD was examined by immunoprecipitation (IP-Western) combined with Western blot. Briefly, circular RNA (0.1 pmoles) encoding RBD was isolated from BJ fibroblasts and HeLa cells (10,000 per well in 96-well plates) using Lipofectamine MessengerMax (ThermoFisher, LMRNA015). cells). MessengerMax alone was used as a control. Supernatants were collected at 24 hours and immunoprecipitated on SARS-CoV-2 RBD-spike glycoprotein (Sino Biologicals, Cat: 40592-T62) coupled to protein G-Dynabeads (Invitrogen, 10003D). A specific rabbit antibody was used and the same antibody was used to detect immunoprecipitated products resolved by PAGE. Recombinant RBD (42 ng) immunoprecipitation was used as a control to quantify cellular protein expression. Membrane chemiluminescence was quantified using Image Studio™ Lite Western blot quantification software (Li-COR Biosciences).

RBD antigen encoded by circular RNA was detected in BJ fibroblasts and HeLa cell supernatants, but not in controls (Fig. 3).

This example shows that the SAR-CoV-2 RBD antigen, which is a secreted protein, was expressed from circular RNA in mammalian cells.

Example 6 Expression of Non-Secreted SARS-CoV-2 Antigen from RNA in Mammalian Cells In this example, circular RNA or mRNA encoding the SARS-CoV-2 spike antigen was expressed using the methods described herein. Designed, produced and refined by Circular RNA and mRNA are formulated in MessengerMax and 0.1 picomoles of circular RNA are transfected into HEK293 cells (10 000 cells per well) according to the manufacturer's instructions.

Spike antigen expression is measured using a SARS-CoV-2 spike antigen-specific ELISA at 24, 48, and 72 hours. To measure expression, cells are lysed in each well at appropriate time points using lysis buffer and protease inhibitors. Cell lysates are harvested and centrifuged at 12,000 rpm for 10 minutes. Supernatants are collected. In this example, the SARS-CoV-2 2019 Spike Antigen Detection Sandwich ELISA Kit is used according to the manufacturer's instructions (SARS-CoV-2 (2019-nCoV) Spike Detection ELISA Kit, Sino Biological, KIT40591).

Example 7: Formulation of RNA for Administration to Non-Human Animals In this example, circular RNA or mRNA encoding the SARS-CoV-2 RBD antigen was designed by the methods described herein, Produced and purified.

After purification, circular RNA or mRNA was formulated as follows:
A. Circular RNA or mRNA was diluted in PBS to a final concentration of 2.5 or 25 picomoles in 50 uL to give circular or linear RNA formulations (unformulated).

B. Circular RNA or mRNA was formulated according to the manufacturer's instructions (15% TransIT, 5% boost) with a lipid carrier (e.g. TransIT (Mirus Bio)) and mRNA boost reagent (Mirus Bio) at 2 in 50 uL. A final RNA concentration of .5 or 25 pmoles was obtained to obtain circular or linear RNA preparations.

C. Circular RNA or mRNA was formulated with a cationic polymer (eg, protamine). Briefly, circular RNA or mRNA was diluted in pure water. Protamine sulfate was dissolved in lactated Ringer's solution (4000 ng/uL). With stirring, protamine-lactated Ringer's solution was added to half of the circular RNA or mRNA solution until the weight ratio of RNA:protamine was 2:1. The solution was stirred for an additional 10 minutes to ensure stable complex formation. The remaining circular RNA or mRNA was then added (ie, the remaining circular RNA was added to the circular RNA solution and the remaining mRNA was added to the mRNA solution), and the solution was stirred briefly. The final concentration of the mixture (i.e. circular RNA mixture or mRNA mixture) was adjusted using lactated Ringer's solution to give circular or linear RNA formulations with final RNA concentrations of 2.5 or 25 pmoles per 50 uL. .

D. Circular RNA or mRNA was formulated with lipid nanoparticles. Briefly, circular RNA or mRNA was diluted to a concentration of 0.2 ug/uL in 25 mM acetate buffer pH=4 (filtered through a 0.2 um filter). Lipid nanoparticles (LNPs) in a molar ratio of 50/38.5/10/1.5 mol % ionizable lipid (eg ALC0315), cholesterol, DSPC, and DMG-PEG2000 in ethanol (0.2 um sterile It was formulated by first dissolving in (filtered through a filter). The final ionizable lipid/RNA weight ratio was 8/1 w/w. Lipid and RNA solutions were mixed in a micromixer chip using a microfluidic system at a flow ratio of 3/1 buffer/ethanol and a total flow rate of 1 ml/min. LNPs were then dialyzed in PBS pH=7.4 for 3 hours to remove ethanol. RNA concentrations and encapsulation efficiencies inside LNPs were measured using the Ribogreen assay. If necessary, LNPs were concentrated to the desired RNA concentration using Amicon centrifugal filters, 100 kDa cutoff. Particle size, concentration and charge were measured using a Zetasizer Ultra (Malvern Pananaytical). RNA concentration was adjusted with PBS to a final concentration of 0.1 or 0.2 ug/ul. For formulations containing two RNA sequences, the RNAs were mixed before formulation in LNPs or after each RNA was formulated separately. For in vivo experiments, the final RNA formulated in LNP was filtered through a sterile 0.2um regenerated cellulose filter.

Example 8: Administration of RNA to Non-Human Animals In this example, mice were injected with each circular RNA formulation or linear RNA by either a single intramuscular injection into the hind leg or a single intradermal injection into the back. A 50 uL injection of formulation was given.

Example 9 Detection of Secreted Antigens in Blood A blood sample (approximately 25 μL) was taken from each mouse for analysis by submandibular gland extraction. Blood is collected in EDTA tubes at 0, 6 hours, 24, 48 hours and 7 days after administration of circular RNA. Plasma is isolated by centrifugation at 1300 g for 30 minutes at 4°C. Expression of secreted antigens is assessed using methods such as those described in Example 5, eg, for RBD antigen, using ELISA or Western blot.

Example 10 Detection of Antibodies to Antigen This example describes a method for determining the presence of antibodies to an antigen.

ELISA has been described by Chen X et al. (medRxiv, doi:doi.org/10.1101/2020.04.06.20055475 (2020)). Briefly, 100 uL per well of SARS-CoV-2 protein in PBS is coated onto the ELISA plate overnight at 4°C. The ELISA plate is then blocked with blocking buffer (5% FBS and 0.05% Tween 20) for 1 hour. Ten-fold diluted plasma is then added to each well in 100 uL of blocking buffer for 1 hour. After washing with 1× Phosphate Buffered Saline with Tween® Detergent (PBST), the bound antibody was incubated with an anti-mouse IgG HRP detection antibody (Invitrogen) for 30 minutes, followed by PBST, followed by PBS and tetramethylbenzene is added. ELISA plates are allowed to react for 5 minutes and then quenched with 1M HCl stop buffer. Optical density (OD) values are determined at 450 nm.

A. For antibodies to the SARS-CoV-2 RBD antigen, the SARS-CoV-2 protein used is SARS-CoV-2 RBD (Sino Biological, 40592-V08B).

B. For antibodies against the SARS-CoV-2 spike antigen, the SARS-CoV-2 protein used is SARS-CoV-2 spike protein (Sino Biological, 40591-V08H).

Example 11 Evaluation of Neutralizing Antibodies Against SARS-CoV-2 A SARS-CoV-2 virus neutralization assay is used to test the ability of antibodies to neutralize SARS-CoV-2 infection. An example of such an assay is described by Okba NMA et al. (Emerg Infect Dis., doi: 10.3201/eid2607.200841 (2020)). This assay detects the production of antibodies that functionally inhibit viral infection as evidenced by a reduction in the number of viral plaques. Slight modifications of this assay have been described by Gauger PC & Vincent AL (in Animal Influenza Virus: Methods and Protocols, 3rd edition, ed. E. Spackman, pp. 311-320 (2014)) and Wilson HL et al. (J. Clin. Microbiol., 55(10):3104-3112 (2017)). Briefly, the SARS-CoV-2 virus neutralization assay is a plasma containing anti-SARS-CoV-2 antibody produced by mice in response to immunization with circular RNA encoding the SARS-CoV-2 antigen. determine the neutralization capacity of Plasma from untreated mice injected with vehicle only (no circular RNA) is used as a control.

Example 12: Immunogenicity of SARS-CoV-2 RBD Antigen in Mouse Model evaluated in the model. Production of antibodies to the SARS-CoV-2 RBD antigen formulated with cationic polymers was also evaluated in a mouse model.

In this example, circular RNAs were designed with ORFs encoding the IRES and SARS-CoV-2 RBD antigens by the methods described herein. Unmodified linear RNA was synthesized from the DNA segment by in vitro transcription with excess guanosine 5' monophosphate using T7 RNA polymerase. Transcribed RNA was purified using the RNA purification system (New England Biolabs, Inc.) according to the manufacturer's instructions. Purified linear RNA was circularized with splinted DNA.

Circular RNA was generated by splint ligation as follows: transcribed linear RNA and DNA splint (5'-GTTTTTCGGCCTATTCCCAATAGCCGTTTTTG-3') (SEQ ID NO: 47) were mixed, annealed and treated with RNA ligase. To purify the circular RNA, the ligation mixture was resolved by reversed-phase chromatography. Circular RNA was selectively eluted from linear RNA by increasing the organic content of the mobile phase. Eluted RNA was partially harvested and assayed for circular RNA purity. Selected fractions were combined and buffer exchanged to remove mobile phase salts and solvent. Acrylamide gel electrophoresis was used as a quality control measure to confirm purity and circularization.

Purified circular RNA was diluted in pure water to a concentration of 1100 ng/uL. Protamine sulfate was dissolved in lactated Ringer's solution (4000 ng/uL). With stirring, protamine-lactated Ringer's solution was added to half the circular RNA solution until the RNA:protamine weight ratio was 2:1. The solution was stirred for an additional 10 minutes to ensure stable complex formation. The remaining circular RNA was then added (ie, the remaining circular RNA was added to the circular RNA:protamine solution) and the solution was stirred briefly. The final concentration of the mixture (ie, the circular RNA mixture) was adjusted using lactated Ringer's solution to give circular RNA formulations with a final RNA concentration of 2 ug or 10 ug RNA in 50 uL.

Three mice per group were inoculated intramuscularly or intradermally on days 0 and 21 with 2 ug or 10 ug doses of circular RNA formulations or protamine vehicle controls. Addavax™ adjuvant (Invivogen) was administered intramuscularly or intradermally to each mouse once 24 hours after administration of the circular RNA formulations on days 0 and 21. Addavax™ adjuvant was administered at 50% in 1×PBS in 50 uL according to the manufacturer's instructions.

Blood collection from each mouse was performed by submandibular gland extraction. Blood was collected in dry anticoagulant-free tubes at 7, 14, 21, 23, 28, 35, 41, 49, 56, 63, 69, 77, 84, 108 and 115 days after administration of circular RNA. Taken. Serum was separated from whole blood by centrifugation at 1200 g for 30 min at 4C. Serum was heat-inactivated by heating at 56° C. for 1 hour. Individual heat-inactivated serum samples were assayed for the presence of RBD-specific IgG by enzyme-linked immunosorbent assay (ELISA). ELISA plates (MaxiSorp 442404 96-well, Nunc) were coated with SARS-CoV-2 RBD (Sino Biological, 40592-V08B; 100 ng) in 100 uL PBS overnight at 4°C. Plates were then blocked with blocking buffer (TBS containing 2% FBS and 0.05% Tween 20) for 1 hour. Serum dilutions were then added to each well in 100 uL of blocking buffer and incubated for 1 hour at room temperature. After washing three times with 1× Tris-buffered saline containing Tween® detergent (TBS-T), plates were incubated with anti-mouse IgG HRP detection antibody (Jackson 115-035-071) for 1 hour. After incubation, it was washed three times with TBS-T and then tetramethylbenzene (Pierce 34021) was added. ELISA plates were reacted for 5 minutes and then quenched with 2N sulfuric acid. Optical density (OD) values were determined at 450 nm.

The optical density of each serum sample was divided by background (RBD-coated plate incubated with secondary antibody only). The fold over background for each sample was plotted.

Results showed that anti-RBD antibodies were obtained at 14, 21, 23, 28, 35, 41, 49, 56, 63, 69, 77, 84, 108 and 115 days after injection with the circular RNA formulation. (Fig. 4). No anti-RBD antibodies were obtained after injection with protamine vehicle. These results also showed that circular RNA encoding RBD antigens induced antigen-specific immune responses in mice.

Serum samples were assayed for the presence of spike-specific IgG using a similar ELISA. ELISA plates (MaxiSorp 442404 96-well, Nunc) were coated with SARS-CoV-2 spikes (Sino Biological, 40589-V08B1; 100 ng) in 100 uL PBS overnight at 4°C. Plates were then blocked with blocking buffer (TBS containing 2% FBS and 0.05% Tween 20) for 1 hour. Serum dilutions were then added to each well in 100 uL of blocking buffer and incubated for 1 hour at room temperature. After washing three times with 1× Tris-buffered saline containing Tween® detergent (TBS-T), plates were incubated with anti-mouse IgG HRP detection antibody (Jackson 115-035-071) for 1 hour. After incubation, it was washed three times with TBS-T and then tetramethylbenzene (Pierce 34021) was added. ELISA plates were reacted for 5 minutes and then quenched with 2N sulfuric acid. Optical density (OD) values were determined at 450 nm.

Results showed that anti-spike antibodies were obtained 35 days after injection with the circular RNA formulation (Figure 5). Anti-spike antibodies were not obtained after injection with vehicle.

Serum antibodies at the 14-day post-dose time point were characterized using assays to measure relative IgG1 versus IgG2a isotypes (FIG. 6), and the ability of serum antibodies to neutralize virus was assessed using the PRNT neutralization assay. was characterized using The results showed that 2ug of RBD eRNA administered intramuscularly with adjuvant had neutralizing capacity.

Example 13: Modulation of in vivo production of Gaussia luciferase from circular RNA in mice using timed adjuvant delivery Demonstrate protein expression from RNA.

In this example, circular RNAs were designed with ORFs encoding IRES and Gaussia luciferase (GLuc) polypeptides. In this example, circular RNA was produced and purified by the methods described herein. Circular RNA was formulated as described in Example 7 to yield circular RNA formulations (eg, TransIT formulated, protamine formulated, PBS/un formulated). Mice are administered each circular RNA formulation intramuscularly as described in Example 8.

To stimulate the immune response, Addavax™ adjuvant (Invivogen), a squalene-based oil-in-water nanoemulsion with a similar formulation to MF59® adjuvant, was administered for 0 hours (simultaneously with the circular RNA formulation). delivery) or mice were injected into the hind limbs at 24 hours. Addavax™ adjuvant was administered at 50 uL according to the manufacturer's instructions.

A blood sample (approximately 25 μL) was collected from each mouse by submandibular gland extraction. Blood was collected into EDTA tubes at 0, 6, 24 and 48 hours after administration of circular RNA. Plasma was isolated by centrifugation at 1300 g for 30 minutes at 4° C. and the activity of Gaussia luciferase, a secreted enzyme, was tested using the Gaussia luciferase activity assay (Thermo Scientific Pierce). A GLuc luciferase activity assay was performed by adding 50 μL of 1×GLuc substrate to 5 μL of plasma. Plates were read immediately after mixing in a luminometer (Promega).

This example demonstrates (a) intramuscular administration of TransIT-, protamine-, and non-compounded circular RNA formulations without adjuvant (Figure 7) and with adjuvant delivered at 0 and 24 hours (Figure 8). and (b) intradermal injections of protamine-loaded circular RNA formulations (FIG. 9) without adjuvant and with adjuvant delivered at 24 hours. demonstrated successful protein expression of

Example 14: Administration of RNA Encoding SARS-CoV-2 Antigens to Artificial Chromosome Transferred (Tc) Cattle The production of fully human neutralizing polyclonal antibodies to coronavirus antigens in mammals is described.

In this example, circular RNA or mRNA encoding the SARS-CoV-2 antigen was designed, produced and purified by the methods described herein.

In this example, in one approach, RNA is formulated as described in Example 7 (e.g., formulated with a lipid carrier (e.g., TransIT), formulated with a cationic polymer (e.g., protamine), or or unformulated), obtaining a first set of circular RNA formulations or a first set of linear RNA formulations. In a second approach, Addavax™ adjuvant (Invivogen), MF59® adjuvant, complete Freund's adjuvant, AS03 or a proprietary adjuvant formulation of SAB (SAB-adj-1) was administered to Beigel JH et al. . (Lancet Infect. Dis., 18:410-418 (2018)), in combination with RNA-lipid carrier mixtures or unformulated RNA formulations (e.g., circular or linear RNA formulations), Obtain a second set of circular RNA formulations or a second set of linear RNA formulations with a final RNA concentration of 25 pmoles in 100 uL. For each procedure, a total volume of 8 mL is generated corresponding to 2 nmoles of circular or linear RNA. Circular or linear RNA is formulated to give a circular or linear RNA preparation just prior to injection into the animal.

In this example, Tc cows were given a circular RNA formulation (i.e., the first circular RNA formulation or the second circular RNA formulation), a linear RNA formulation (i.e., the first circular RNA formulation) by intramuscular or intradermal injection. formulation or second circular RNA formulation) or vehicle only control (ie, no RNA control).

A. Intramuscular Injections: A total of 4 injections will be administered at each time point at the following sites: 1 injection of 2 mL (each) behind each ear; and 1 injection of 2 mL (each) on each side of the neck. injection.

B. Intradermal Injections: A total of 4 injections are administered at each time point at the following sites: 4 injections of 2 mL at each site at the neck-shoulder junction.

A total of 8 time points are used: 0, 3, 6, 9, 12, 15, 18 and 21 weeks.

Addavax™ adjuvant (Invivogen), MF59® adjuvant, complete Freund's adjuvant, AS03 or SAB if the first set of RNA formulations (e.g., circular or linear RNA formulations) is administered of SAB-adj-1 is administered separately (1-2 cm) adjacent to each injection site (2 mL total) for the first three time points. Prior to the first injection (V1), a volume of pre-injection plasma is taken from each test Tc cow to serve as a negative control. Blood samples up to 2.1% of the cow's body weight were taken by jugular puncture at 8, 9, 10, 11, 12 and 14 days after injection at each time point and at additional time points 60 days after the last injection. be done. Plasma is collected using an automated plasmapheresis system (Baxter Healthcare, Autopheresis C Model 200). Plasma is then checked for antigen-specific antibodies using an antigen-based ELISA. Human polyclonal antibodies are purified from plasma using Cohn-Oncley purification and caprylate fractionation for antigen-specific polyclonal antibodies as described below in Example 21).

Example 15 Detection of Secreted Antigen Expressed from Circular RNA Administered to Tc Cattle SARS-CoV-2 RBD Antigen from Circular RNA, To detect the expression of the secreted protein, the body weight of the cattle was measured at 2.5 psi. Up to 1% blood samples are taken by jugular puncture at 1, 3, 5, 7, 14 and 21 days after injection. Plasma is collected using an automated plasmapheresis system (Baxter Healthcare, Autopheresis C Model 200). Plasma is then checked for SARS-CoV-2 RBD antigen expression. Expression of RBD antigen is assessed as described in Example 5. An anti-human IgG HRP detection antibody (Invitrogen) is used in these assays.

Example 16: Detection of Non-Secreted Antigens Expressed from Circular RNA Administered to Tc Cattle SARS-CoV-2 spike antigen from circular RNA, To detect expression of non-secreted proteins, tissues were tested for protein expression. Taken for analysis. At 0, 2, 5, 7, and 21 days after dosing, Tc cows are sacrificed and liver, spleen and muscle (from the site of injection) are harvested. Spike antigen expression is assessed as described in Example 6 in proteins extracted from each tissue. In these ELISAs, an anti-human IgG HRP detection antibody (Invitrogen) is used instead of an anti-mouse IgG HRP detection antibody.

Example 17: Production of Human Polyclonal Antibodies Specific to SARS-CoV-2 Antigen from Circular RNA Administered to Tc Cattle Up to 2.1% blood samples are taken by jugular puncture at 8, 9, 10, 11, 12, 14, 20, 40, and 60 days after injection. Plasma is collected using an automated plasmapheresis system (Baxter Healthcare, Autopheresis C Model 200). Plasma is then checked for antigen-specific antibodies. The presence of antibodies to the SARS-CoV-2 antigen is determined as described in Example 10. An anti-human IgG HRP detection antibody (Invitrogen) is used in these assays.

Example 18: Production of Human Neutralizing Polyclonal Antibodies Against SARS-CoV-2 from Circular RNA Administered to Tc Cattle Harvested by jugular puncture at 9, 10, 11, 12 and 14 days and additional time points 60 days after the last injection. Plasma is collected using an automated plasmapheresis system (Baxter Healthcare, Autopheresis C Model 200). Plasma is then checked for antigen-specific antibodies. A SARS-CoV-2 virus neutralization assay is performed to determine the neutralizing ability of antibodies in plasma as described in Example 11.

Example 19 Administration of RNA Encoding the SARS-CoV-2 Antigen to Artificially Chromosome-Transferred (Tc) Cattle With Adjuvant Administration In this example, circular RNA or mRNA encoding the SARS-CoV-2 antigen was , designed, produced and purified by the methods described herein.

Circular RNA and mRNA are formulated with or without adjuvants as follows:
A. RNA (eg, circular RNA or mRNA) and adjuvant are administered independently. RNA is formulated as described in Example 7 (e.g., formulated with a lipid carrier (e.g., TransIT), with or without a cationic polymer (e.g., protamine), circular RNA formulations or A linear RNA preparation is obtained. Final RNA concentration is 25 pmol in 100 uL. A total volume of 8 mL is generated corresponding to 2 nmoles of circular RNA or mRNA. Circular RNA or mRNA is formulated immediately prior to injection into the animal. For a total of 8 injections, a total of 64 mL of circular RNA or mRNA is formulated. In this example, Tc cows are immunized with circular RNA formulations, linear RNA formulations or vehicle-only controls (ie, no RNA controls) by intramuscular or intradermal injection.

(i) Intramuscular injection: A total of 4 injections are administered at each time point at the following sites: 1 injection of 2 mL (each) behind each ear; 1 injection.

(ii) Intradermal Injection: A total of 4 injections are administered at each time point at the following sites: 4 injections of 2 mL to each site at the neck-shoulder junction.

A total of 8 time points are used: 0, 3, 6, 9, 12, 15, 18 and 21 weeks. Addavax™ adjuvant (Invivogen), MF59® adjuvant, complete Freund's adjuvant, AS03 or SAB's proprietary adjuvant formulation (SAB-adj-1) was administered to each vaccination site for the first three time points. (2 mL total) are administered adjacent (1-2 cm).

B. RNA (eg, circular RNA or mRNA) and adjuvant are administered. RNA is formulated as described in Example 7 (eg, formulated with a lipid carrier (eg, TransIT) and formulated with a cationic polymer (eg, protamine) or not). Addavax™ adjuvant (Invivogen), MF59® adjuvant, complete Freund's adjuvant, AS03 or SAB's proprietary adjuvant formulation (SAB-adj-1) was then administered as described by Beigel JH et al. (Lancet Infect. Dis., 18:410-418 (2018)), formulated with RNA-carrier formulated, RNA-polymer formulated or unformulated RNA to a final concentration of 25 picomoles of RNA in 100 uL. to obtain a circular or linear RNA preparation having A total volume of 8 mL is generated corresponding to 2 nmoles of RNA. Circular RNA and mRNA are formulated immediately prior to injection into animals. For a total of 8 injections, a total of 64 mL of circular RNA and a total of 64 mL of mRNA are formulated.

In this example, Tc cows were injected intramuscularly or intradermally. Circular RNA formulations, linear RNA formulations or vehicle only controls (ie, no RNA controls) are immunized.

A. Intramuscular injection. A total of four injections are administered at each time point at the following sites: one injection of 2 mL (each) behind each ear; and one injection of 2 mL (each) in each hind leg.

B. Intradermal injection. A total of 4 injections are administered at each time point at the following sites: 4 injections of 2 mL to each site at the neck-shoulder junction.

Example 20 Production of Neutralizing Polyclonal Antibodies Specific for SARS-CoV-2 from Circular RNA in Tc Goats Designed, produced and purified by the methods described.

Circular RNA and mRNA are formulated (e.g., with a lipid carrier (e.g., TransIT), with or without a cationic polymer (e.g., protamine)) as described in Example 7, and circularized. An RNA preparation or linear RNA preparation is obtained. Final RNA concentration is 25 pmol in 100 uL. A total volume of 1 mL is produced corresponding to 0.25 nmoles of circular RNA or 0.25 nmoles of mRNA. Circular RNA and mRNA are formulated to obtain circular and linear RNA preparations just prior to injection into animals. For a total of 4 injections, a total of 4 mL of circular RNA and a total of 4 mL of linear RNA are formulated.

In this example, artificially transchromosomal goats (Tc goats) were used in which a human artificial chromosome (HAC) containing the entire human immunoglobulin (Ig) gene repertoire in germline configuration was introduced into the genetic makeup of domestic goats (Tc goats). be. Tc goats produce human polyclonal antibodies in the serum (Wu H et al. (Sci Rep, 9(1):366, doi:doi.org/10.1038/s41598-018-36961-5 (2019) (see ).

In this example, Tc goats are immunized with circular RNA formulations, linear RNA formulations or vehicle-only controls (ie, no RNA controls) by intramuscular or intradermal injection.

A. Intramuscular injection. A total of two injections are administered at each time point at the following sites: one injection of 0.5 mL (each) on each side of the neck.

B. Intradermal injection. A total of 2 injections are administered at each time point at the following sites: lower neck--one injection of 0.5 mL (each) on a different side of the shoulder.

A total of four time points are used: 0, 3, 6 and 9 weeks.

Addavax™ adjuvant (Invivogen), MF59® adjuvant, complete Freund's adjuvant, AS03 or SAB's proprietary adjuvant formulation (SAB-adj-1) was administered to each injection site ( (0.5 mL total) are administered adjacent (1-2 cm).

Blood samples (40 mL) are taken by jugular puncture at 8 and 14 days after injection at each time point and at additional time points 60 days after the last injection. Plasma is collected using an automated plasmapheresis system (Baxter Healthcare, Autopheresis C Model 200). Plasma is then checked for antigen-specific antibodies.

Example 21 Purification of Polyclonal Antibody Fractions This example describes the purification of human polyclonal antibodies from the plasma of non-human mammals with humanized immune systems.

Protein antigen-inactivation and removal are required for purification of human anti-SARS-CoV-2 polyclonal antibodies from collected plasma and subsequent use in human subjects. In this example, human polyclonal anti-SARS-CoV-2 antibodies were used (Ofosu et al. FA (Thromb. Haemost., 99(5):851-862 (2008)); Buchacher A and Iberer G (Biotechnol. J. Buchacher A and Curling JM (in Biopharm. Process., Chap 42, pp. 857-876, doi: https://doi.org/10.1016/ B978-0-08-100623-8.00043-8 (2018).Fraction (I+)II+III obtained by the Cohn-Oncley method. are collected and human polyclonal anti-SARS-CoV-2 antibodies are purified from this fraction using the method described by Lebing et al. Briefly, fractions II+III are suspended in 12 volumes of water for injection (WFI) at pH 4.2.Sodium caprylate (20 mM) is added and the pH is brought to pH 5.1 with sodium hydroxide. During this process, some of the lipoproteins, albumin and caprylate are precipitated.The precipitate is removed by cloth filtration in the presence of filter aid.After filtration, the caprylate concentration is Readjusted to 20 mM, the solution is incubated at pH 5.1 for 1 hour at 25° C. to inactivate enveloped virus The solution is purified by depth filtration with the aid of a filter. Secondly, the filtrate is passed through two consecutive anion exchange chromatography columns (Q Sepharose FF followed by ANX Sepharose FF) at pH 5.2.The eluate is filtered by ultrafiltration (BioMax 50KDa cassette, Millipore). Concentrated and dialyzed from WFI using the same system Purified IgG solution is adjusted to pH 4.25, 0.2 M glycine and 100 mg/mL protein Bulk IVIG is sterile filtered and , 50, 100, or 200 mL vials.The final product is incubated at 23-27° C. for 21 days for virus inactivation before storage at 2-8° C.

Cellulose acetate electrophoresis is used to confirm the enrichment of IVIG. For clinical use, 95% purity is typical and expected as a result of this purification procedure.

Example 22 Formulation of Fully Human Polyclonal Antibodies for Treatment of Human Subjects In this example, purified antibodies are formulated at neutral pH (pH 7.2) in an ionic solution containing sodium chloride. diluted in United States Pharmacopoeia (USP) grade infusion solution, 0.9% sodium chloride is used. Clinical formulations can be based on several solution compositions including:
1. Trehalose, sodium citrate, citric acid, polysorbate 80.
2. Sodium succinate, sucrose, polysorbate 20.
3. Sodium chloride, tromethamine, polysorbate 80.
4. Sucrose, sodium chloride, sodium phosphate, dextran 40.

Example 23: Treatment of Human Subjects Infected with SARS-CoV-2 This example describes the administration of fully human anti-SARS-CoV-2 polyclonal antibodies to human subjects with SARS-CoV-2.

In this example, adult subjects with COVID-19 are administered a single dose (400 mg/kg) of a formulated polyclonal antibody intravenously by infusion. Infusion is initiated at a rate of 1.0 mg/kg/min and increased to 1.5-2.5 mg/kg/min after 20 minutes. Other suitable rates of injection known in the art may also be used.

Effect of polyclonal antibodies against COVID-19 on viral load, serum antibody titers, changes in body temperature, Sequential Organ Failure Assessment (SOFA) scores (ranging from 0 to 24, with higher scores Markers of COVID-19 such as Pao2/Fio2, routine blood biochemical indices, ARDS, and respiratory and membrane oxygenation (ECMO) support in human subjects before and after infusion, indicating more severe disease). is evaluated by evaluating

Example 24 Passive Immunization of Healthy Human Subjects Against SARS-CoV-2 Infection This example demonstrates fully human polyclonal antibodies against SARS-CoV-2 raised in non-human mammals with humanized immune systems. describes the passive immunization of human subjects from SARS-CoV-2 infection.

In this example, healthy human subjects were administered a single dose (400 mg/kg) of a formulated polyclonal antibody or placebo (saline control) intravenously by infusion. Infusion is initiated at a rate of 1.0 mg/kg/min and increased to 1.5-2.5 mg/kg/min after 20 minutes. Other suitable rates of injection known in the art may be used. After 3 days, the treated subjects are bled and the plasma is tested for neutralizing ability of the antibodies using the plaque reduction neutralization assay as described in Example 11.

In this example, serology is performed in human subjects 14 days after administration of the formulated polyclonal antibody. Serological testing for SARS-CoV-2 is described, for example, by Gonzalez JM et al. medRxiv, (doi: doi.org/10.1101/2020.04.10.20061150 (2020)).

Example 25: Prophylactic treatment of healthy human subjects A prophylactic treatment of a human subject against is described.

In this example, purified human polyclonal antibodies against SARS-CoV-2 are obtained as described in Example 21. Purified polyclonal antibodies are obtained as described in Example 22 and then administered to healthy human subjects as described in Example 24.

After 3 days, blood was drawn from healthy human subjects receiving formulated polyclonal antibodies or placebo (saline control) and plasma was subjected to plaque reduction neutralization assays as described in Example 11. is used to test the neutralizing ability of the antibody.

Example 26: Prophylactic Treatment of Non-Human Primates This example demonstrates SARS-CoV-2 infection by fully human polyclonal antibodies against SARS-CoV-2 raised in non-human mammals with humanized immune systems. A prophylactic treatment of non-human primates against

In this example, purified human polyclonal antibodies to SARS-CoV-2 are obtained as described in Example 21. Purified polyclonal antibodies are formulated as described in Example 22 and then administered to adult rhesus monkeys. Briefly, the polyclonal antibody formulation is administered intravenously to rhesus monkeys at a dose of 10 mg/kg. As a control, polyclonal antibodies from transchromosomal cattle injected with vehicle only (no circular RNA) are used.

Rhesus monkeys were then inoculated intratracheally with 1 x ¹⁰ 50% tissue culture infectious dose (TCID ₅₀ ) of SARS-CoV-2 and sampled body weight, temperature, X-ray, serum, nasal cavity/ Throat swabs and all primary tissues were prepared according to Bao L et al. (bioRxiv, doi: doi.org/10.1101/2020.03.13.990226 (2020)). Sampling takes up to 30 days after inoculation and is assessed for viral load.

Example 27 Administration of RNA Encoding SARS-CoV-2 Antigen to a Human Subject This example describes administration of circular RNA encoding a SARS-CoV-2 antigen to a human subject.

In this example, circular RNA or mRNA encoding the SARS-CoV-2 antigen was designed, produced and purified by the methods described herein.

In this example, in one approach, RNA is formulated as described in Example 7 (e.g., formulated with a lipid carrier (e.g., TransIT), formulated with a cationic polymer (e.g., protamine), Formulated with lipid nanoparticles or not) to obtain a first set of circular RNA formulations or a first set of linear RNA formulations. In a second approach, Addavax™ adjuvant (Invivogen), MF59® adjuvant, or complete Freund's adjuvant was administered as described by Beigel JH et al. (Lancet Infect. Dis., 18:410-418 (2018)), in combination with RNA-lipid carrier mixtures or unformulated RNA formulations (e.g., circular or linear RNA formulations), A second set of circular RNA preparations or a second set of linear RNA preparations is obtained. Circular or linear RNA is formulated to obtain a circular or linear RNA formulation just prior to injection into a human subject.

In this example, a human subject receives a circular RNA formulation (i.e., the first circular RNA formulation or the second circular RNA formulation), a linear RNA formulation (i.e., the first circular RNA formulation) by intramuscular or intradermal injection. or a second circular RNA formulation). A circular or linear RNA formulation is administered to a human subject at least once, at least twice, at least three times, or more to elicit an immunogenic response in the human subject.

Example 28 Expression of Multiple Antigens from Circular RNA in Mammalian Cells This example demonstrates the expression of multiple antigens from circular RNA in mammalian cells. Exemplary schematics of these constructs are shown in FIG.

Experiment 1
A first circular RNA encoding the SARS-CoV-2 RBD antigen (nucleic acid SEQ ID NO:56; amino acid SEQ ID NO:55) was designed, produced and purified by the methods described herein. A second circular RNA encoding the SARS-CoV-2 spike antigen (nucleic acid SEQ ID NO:54; amino acid SEQ ID NO:53) was designed, produced and purified by the methods described herein. The first circular RNA and the second circular RNA were mixed together to obtain a mixture. The mixture (1 pmol each of circular RNA) was transfected into HeLa cells (100,000 cells per well in a 24-well plate) using Lipofectamine MessengerMax (ThermoFisher, LMRNA015). As a control, the first circular RNA and the second circular RNA were also separately transfected into HeLa cells using MessengerMax.

RBD antigen expression was measured at 24 hours using a SARS-CoV-2 RBD antigen-specific ELISA. Spike antigen expression was measured at 24 hours by flow cytometry.

From transfection with the mixture, SARS-Co-V-2 RBD antigen was detected in HeLa cell supernatants and SARS-CoV-2 spike antigen was detected on the cell surface of HeLa cells. SARS-CoV-2 RBD antigen, but not SARS-CoV-2 spike antigen, was detected from transfection with the first circular RNA. SARS-CoV-2 spike antigen, but not SARS-CoV-2 RBD antigen, was detected from transfection with the second circular RNA. This demonstrates that both the SAR-CoV-2 RBD and SARS-CoV-2 spike antigen were expressed in mammalian cells from the combinatorial mixture of circular RNAs.

Experiment 2
A first circular RNA encoding the SARS-CoV-2 RBD antigen (nucleic acid SEQ ID NO:56; amino acid SEQ ID NO:55) was designed, produced and purified by the methods described herein. A second circular RNA was designed with an IRES and an ORF encoding a Gaussia luciferase (GLuc) polypeptide (nucleic acid SEQ ID NO:58; amino acid SEQ ID NO:57) as a model antigen, and Produced and purified as described. The first circular RNA and the second circular RNA were separately complexed with Lipofectamine MessengerMax (ThermoFisher, LMRNA015) and then mixed together to obtain a mixture. The mixture (0.1 pmoles of each circular RNA) was transfected into HeLa cells (20,000 cells per well in a 96-well plate). As a control, the first circular RNA and the second circular RNA were also separately transfected into HeLa cells using MessengerMax.

RBD antigen expression was measured at 24 hours using a SARS-CoV-2 RBD antigen-specific ELISA. GLuc activity was measured at 24 hours using a Gaussia luciferase activity assay (Thermo Scientific Pierce).

From transfection with the mixture, SARS-CoV-2 RBD antigen and GLuc activity were detected in HeLa cell supernatants at 24 hours. SARS-CoV-2 RBD antigen, but no GLuc activity, was detected from transfection with the first circular RNA. GLuc activity, but not SARS-CoV-2 RBD antigen, was detected from transfection with the second circular RNA. This demonstrates that both SAR-CoV-2 RBD and GLuc antigens were expressed in mammalian cells from a combinatorial mixture of circular RNAs.

Experiment 3
A first circular RNA encoding the SARS-CoV-2 RBD antigen (nucleic acid SEQ ID NO:56; amino acid SEQ ID NO:55) was designed, produced and purified by the methods described herein. A second circular RNA was modified to include an IRES followed by an ORF encoding the hemagglutinin (HA) antigen from influenza A H1N1, A/California/07/2009 (nucleic acid SEQ ID NO: 60; amino acid SEQ ID NO: 59). Designed, produced and purified by the methods described herein. The first circular RNA and the second circular RNA were mixed together to obtain a mixture. The mixture (1 pmole of each circular RNA) was transfected into HeLa cells (100,000 cells per well in a 24-well plate) using Lipofectamine MessengerMax (ThermoFisher, LMRNA015). As a control, the first circular RNA and the second circular RNA were also separately transfected into HeLa cells using MessengerMax.

RBD antigen expression was measured at 24 hours using a SARS-CoV-2 RBD antigen-specific ELISA. HA antigen expression was measured at 24 hours using immunoblotting. Briefly, for immunoblotting, 24 hours after transfection, cells were lysed and Western blots were performed using influenza A H1N1 HA (A/California/07/2009) monoclonal antibody (MA5-29920) as primary antibody. (Thermo Fisher)) and goat anti-mouse IgG H&L (HRP) as secondary antibody (Abcam, ab 97023) to detect the HA antigen. For loading controls, alpha tubulin (DM1A) mouse antibody (Cell Signaling Technology, CST #3873) as primary antibody and goat anti-mouse IgG H&L (HRP) (Abcam, ab 97023) as secondary antibody. used with

Both SARS-CoV-2 RBD and influenza HA antigens were detected from transfection with the mixture. SARS-CoV-2 RBD but not influenza HA antigen was detected from transfection with the first circular RNA. Influenza HA antigen, but not SARS-CoV-2 RBD antigen, was detected from transfection with the second circular RNA. This demonstrates that both the SAR-CoV-2 RBD and influenza HA antigens were expressed in mammalian cells from a combinatorial mixture of circular RNAs.

Experiment 4
A first circular RNA encoding the SARS-CoV-2 spike antigen (nucleic acid SEQ ID NO:45; amino acid SEQ ID NO:53) was designed, produced and purified by the methods described herein. A second circular RNA was designed to contain an IRES followed by an ORF encoding HA from Influenza A H1N1, A/California/07/2009 (nucleic acid SEQ ID NO: 60; amino acid SEQ ID NO: 59), It was produced and purified by the method described in . The first circular RNA and the second circular RNA were mixed together to obtain a mixture. The mixture (1 pmole of each circular RNA) was transfected into HeLa cells (100,000 cells per well in a 24-well plate) using Lipofectamine MessengerMax (ThermoFisher, LMRNA015). As a control, the first circular RNA and the second circular RNA were also separately transfected into HeLa cells using MessengerMax.

Spike antigen expression was measured at 24 hours by flow cytometry. HA antigen expression was measured at 24 hours by immunoblotting as described above in Experiment 3.

Both SARS-CoV-2 spike antigen and influenza HA antigen were detected from transfection with the mixture. SARS-CoV-2 spike antigen, but not influenza HA antigen, was detected from transfection with the first circular RNA. Influenza HA antigen, but not SARS-CoV-2 spike antigen, was detected from transfection with the second circular RNA. This demonstrates that both the SAR-CoV-2 spike and influenza HA antigen were expressed in mammalian cells from a combinatorial mixture of circular RNAs.

This example demonstrates that multiple antigens were expressed in mammalian cells from circular RNA preparations containing different combinations of circular RNA.

Example 29: Multiple Antigen Expression from Circular RNA This example demonstrates the expression of multiple antigens from circular RNA in mammalian cells. Exemplary schematics of these constructs are shown in FIGS.

Experiment 1
In this example, a circular RNA was designed to contain an IRES, followed by an ORF encoding the GLuc polypeptide, a stop codon, a spacer, an IRES, an ORF encoding the SARS-CoV-2 RBD antigen, and a stop codon. Circular RNA was produced and purified by the methods described herein. As controls, the following circular RNAs were generated as described above: (i) circular RNAs with ORFs encoding IRES and SARS-CoV-2 RBD antigens; (ii) ORFs encoding IRES and GLuc polypeptides. circular RNA with

Circular RNAs (0.1 pmol) were transfected into HeLa cells (10,000 cells per well in 96-well plates) using Lipofectamine MessengerMax (ThermoFisher, LMRNA015).

RBD antigen expression was measured at 24 hours using a SARS-CoV-2 RBD antigen-specific ELISA. GLuc activity was measured at 24 hours using a Gaussia luciferase activity assay (Thermo Scientific Pierce).

RBD antigen expression was detected from circular RNAs encoding SARS-CoV-2 RBD antigen and GLuc polypeptides (Fig. 13A). GLuc activity was detected from circular RNA encoding the GLuc polypeptide (Fig. 13B). This demonstrates that both SAR-CoV-2 RBD and GLuc antigens were expressed in mammalian cells from circular RNAs encoding both SARS-CoV-2 RBD and GLuc antigens.

Experiment 2
In this example, the circular RNA was composed of an IRES followed by an ORF encoding the SARS-CoV-2 RBD antigen, a stop codon, a spacer, an IRES, an ORF encoding the Middle East Respiratory Syndrome (MERS) RBD antigen, and a stop codon. Designed to contain. Circular RNA is produced and purified by the methods described herein.

Circular RNA is transfected into HeLa cells (10,000 cells per well in a 96-well plate) at various concentrations using Lipofectamine MessengerMax (ThermoFisher, LMRNA015).

SARS-CoV-2 RBD antigen expression is measured at 24 hours using a SARS-CoV-2 RBD antigen-specific ELISA. MERS RBD antigen expression is measured at 24 hours using a detectable MERS RBD antigen-specific antibody.

Example 30: Immunogenicity of Multiple Antigens from Circular RNA in a Mouse Model This example demonstrates the expression of multiple antigens in a subject by administering multiple circular RNA molecules.

Experiment 1
Immunogenicity of circular RNA formulations containing (a) circular RNA encoding SARS-CoV-2 RBD antigen and (b) circular RNA encoding GLuc polypeptide as model antigen, formulated in lipid nanoparticles. , was evaluated in a mouse model. Antibody production and GLuc activity against the SARS-CoV-2 RBD antigen was also evaluated in a mouse model.

A first circular RNA encoding the SARS-CoV-2 RBD antigen (nucleic acid SEQ ID NO:56; amino acid SEQ ID NO:55) was designed, produced and purified by the methods described herein. A second circular RNA was designed with an ORF encoding an IRES and a GLuc polypeptide (nucleic acid SEQ ID NO:58; amino acid SEQ ID NO:57), produced and purified by the methods described herein. The first circular RNA and the second circular RNA were mixed together to obtain a mixture. This mixture was then formulated with lipid nanoparticles as described in Example 7 to yield a first circular RNA formulation. The first circular RNA and the second circular RNA were also separately formulated with lipid nanoparticles as described in Example 7 and then mixed together to obtain a second circular RNA formulation. .

Three mice received a first circular RNA formulation (at a total dose of 10 ug RBD + 10 ug GLuc) on day 0 and a second circular RNA formulation (at a total dose of 10 ug RBD + 10 ug GLuc) on day 12. Inoculated intramuscularly. Additional mice (3 or 4 per group) also received (i) a dose of 10 ug of the first circular RNA formulated with lipid nanoparticles on days 0 and 12; (ii) formulated with lipid nanoparticles; or (iii) PBS was inoculated intramuscularly.

Blood collection from each mouse was performed by submandibular gland extraction. Blood was collected into dry anticoagulant-free tubes at 2 and 17 days after priming with the first circular RNA formulation. Serum was separated from whole blood by centrifugation at 1200g for 30 minutes at 4°C. Individual serum samples were assayed for the presence of RBD-specific IgG by enzyme-linked immunosorbent assay (ELISA). ELISA plates (MaxiSorp 442404 96-well, Nunc) were coated with SARS-CoV-2 RBD (Sino Biological, 40592-V08B; 100 ng) in 100 uL of 1× coating buffer (Biolegend, 421701) overnight at 4°C. bottom. Plates were then blocked with blocking buffer (TBS containing 2% BSA and 0.05% Tween 20) for 1 hour. Serum dilutions (1:500, 1:1500, 1:4500, and 1:13,500) were then added to each well in 100 uL of blocking buffer and incubated for 1 hour at room temperature. After three washes with 1× Tris-buffered saline containing Tween® detergent (TBS-T), plates were incubated with an anti-mouse IgG HRP detection antibody (Abcam, ab97023) for 1 hour. , TBS-T three times, then tetramethylbenzene (Biolegend, 421101) was added. ELISA plates were reacted for 10-20 minutes and then quenched with 0.2N sulfuric acid. Optical density (O.D.) values were determined at 450 nm.

The optical density of each serum sample was divided by background (RBD-coated plate incubated with secondary antibody only). The fold over background for each sample was plotted.

The activity of GLuc was tested using the Gaussia luciferase activity assay (Thermo Scientific Pierce). 50 uL of 1×GLuc substrate was added to 10 uL of serum to perform the GLuc luciferase activity assay. Plates were read immediately after mixing in a luminometer (Promega).

Results showed that anti-RBD antibodies were obtained at 17 days after prime (i.e., 17 days after injection of the first circular RNA formulation) (Fig. 14A) and GLuc activity was obtained at 2 days after prime (i.e., first (Fig. 14B).

These results indicated that a circular RNA preparation containing two circular RNAs encoding different antigens induced antigen-specific responses in mice.

Experiment 2
Circular RNA Formulation Immunogens Comprising (a) Circular RNA Encoding SARS-CoV-2 RBD Antigen and (b) Circular RNA Encoding Influenza Hemagglutinin (HA) Antigen Formulated in Lipid Nanoparticles Sex was evaluated in a mouse model. The production of antibodies against SARS-CoV-2 RBD and influenza HA antigens was also evaluated in mouse models.

A first circular RNA encoding the SARS-CoV-2 RBD antigen (nucleic acid SEQ ID NO:56; amino acid SEQ ID NO:55) was designed, produced and purified by the methods described herein. A second circular RNA was designed to contain an IRES followed by an ORF encoding hemagglutinin (HA) from Influenza A H1N1, A/California/07/2009 (nucleic acid SEQ ID NO: 60; amino acid SEQ ID NO: 59) was produced and purified by the methods described herein. The first circular RNA and the second circular RNA were mixed together to obtain a mixture. This mixture was then formulated with lipid nanoparticles as described in Example 7 to yield a first circular RNA formulation. The first circular RNA and the second circular RNA were also separately formulated with lipid nanoparticles as described in Example 7 and then mixed together to obtain a second circular RNA formulation. .

Three mice received a first circular RNA formulation (at a total dose of 10 ug RBD + 10 ug HA) on day 0 and a second circular RNA formulation (at a total dose of 10 ug RBD + 10 ug HA) on day 12. Inoculated intramuscularly. Additional mice (3 or 4 per group) also received (i) a dose of 10 ug of the first circular RNA formulated with lipid nanoparticles on days 0 and 12; (ii) formulated with lipid nanoparticles; or (iii) PBS was inoculated intramuscularly.

Blood sampling was as described in Experiment 1. The presence of RBD-specific IgG by ELISA was determined as described in Experiment 1.

Individual serum samples were assayed for the presence of HA-specific IgG by ELISA. ELISA plates were coated with HA recombinant protein (Sino Biological, 11085-V08B; 100 ng) overnight at 4° C. and plates were processed as described in Experiment 1. The optical density of each serum sample was divided by the background (HA-coated plate incubated with secondary antibody only) optical density. The fold over background for each sample was plotted.

Results showed that anti-RBD and anti-HA antibodies were obtained 17 days after prime (ie, 17 days after injection with the first circular RNA formulation (Figures 16A and 16B).

The results also showed that a circular RNA preparation containing two circular RNAs encoding different antigens induced an antigen-specific immune response in mice.

Experiment 3
Circular RNA Formulation Immunogens Comprising (a) Circular RNA Encoding SARS-CoV-2 Spike Antigen and (b) Circular RNA Encoding Influenza Hemagglutinin (HA) Antigen Formulated in Lipid Nanoparticles Sex was evaluated in a mouse model. Antibody production against SARS-CoV-2 spike and influenza HA antigens was also evaluated in a mouse model.

A first circular RNA encoding the SARS-CoV-2 spike antigen (nucleic acid SEQ ID NO:54; amino acid SEQ ID NO:53) was designed, produced and purified by the methods described herein. A second circular RNA was designed to contain an IRES followed by an ORF encoding hemagglutinin (HA) from Influenza A H1N1, A/California/07/2009 (nucleic acid SEQ ID NO: 60; amino acid SEQ ID NO: 59) was produced and purified by the methods described herein. The first circular RNA and the second circular RNA were mixed together to obtain a mixture. This mixture was then formulated with lipid nanoparticles as described in Example 7 to yield a first circular RNA formulation. The first circular RNA and the second circular RNA were also separately formulated with lipid nanoparticles as described in Example 7 and then mixed together to obtain a second circular RNA formulation. .

Three mice received the first circular RNA formulation on day 0 (with a total dose of 10 ug spike + 10 ug HA) and the second circular RNA formulation on day 12 (with a total dose of 10 ug spike + 10 ug HA). ) was inoculated intramuscularly. Additional mice (3 or 4 per group) also received (i) a dose of 10 ug of the first circular RNA formulated with lipid nanoparticles on days 0 and 12; (ii) formulated with lipid nanoparticles; or (iii) PBS was inoculated intramuscularly.

Blood sampling was as described in Experiment 1. Serum was separated from whole blood by centrifugation at 1200 g for 30 min at 40C. Individual serum samples were assayed for the presence of RBD (ie, spike RBD)-specific IgG by ELISA as described in Experiment 1.

Individual serum samples were assayed for the presence of HA-specific IgG by ELISA. ELISA plates were coated with HA recombinant protein (Sino Biological, 11085-V08B; 100 ng) overnight at 4° C. and plates were processed as described in Experiment 1. The optical density of each serum sample was divided by the background (HA-coated plate incubated with secondary antibody only) optical density. The fold over background for each sample was plotted.

Results showed that anti-RBD and anti-HA antibodies were obtained 17 days after prime (ie, 17 days after injection of the first circular RNA formulation (Figures 15A and 15B).

The results also showed that a circular RNA preparation containing two circular RNAs encoding different antigens induced an antigen-specific immune response in mice.

Example 31 Immunogenicity of Circular RNA Containing Multiple Antigens in a Mouse Model This example describes the immunogenicity of circular RNA containing multiple antigens. This example also describes the production of antibodies in a mouse model against multiple antigens encoded by a single circular RNA.

Experiment 1
In this example, the circular RNA contains an IRES followed by an ORF encoding the GLuc polypeptide (as a model antigen), a stop codon, a spacer, an IRES, an ORF encoding the SARS-CoV-2 RBD antigen, and a stop codon. was designed and produced and purified as described in Example 29. As controls, the following circular RNAs were generated as described above: (i) circular RNAs with ORFs encoding IRES and SARS-CoV-2 RBD antigens; (ii) ORFs encoding IRES and GLuc polypeptides. circular RNA with

Circular RNA is formulated with lipid nanoparticles as described in Example 7 to obtain circular RNA formulations.

Three mice per group are inoculated intramuscularly on days 0 and 12 with a total dose of 10 ug or 20 ug circular RNA formulation.

Blood sampling is as described in Example 30. The presence of RBD-specific IgG by ELISA is determined as described in Example 30. GLuc activity is measured as described in Example 30.

Experiment 2
Designed to contain an IRES followed by an ORF encoding the SARS-CoV-2 RBD antigen, a stop codon, a spacer, an IRES, an ORF encoding the MERS RBD antigen, and a stop codon, formulated in lipid nanoparticles. The immunogenicity of circular RNA formulations containing circular RNA is evaluated in a mouse model. Production of antibodies against SARS-CoV-2 RBD and MERS RBD antigens is also evaluated in mouse models.

This circular RNA is then formulated with lipid nanoparticles as described in Example 7 to obtain a circular RNA formulation.

Mice are inoculated intramuscularly or intradermally on day 0 and again at least 1 day after the first dose with a circular RNA formulation in an amount of 5 μg, 10 μg, 20 μg, or 50 μg.

Blood sampling is as described in Experiment 1. The presence of SARS-CoV-2 RBD-specific IgG by ELISA is determined as described in Experiment 1. The presence of MERS RBD-specific IgG is also determined by ELISA.

Individual serum samples were tested for anti-SARS-CoV-2 RBD binding antibody, anti-MERS RBD binding antibody, neutralizing antibody against SARS-CoV-2 RBD antigen, neutralizing antibody against MERS RBD antigen, cells against SARS-CoV-2 antigen response, and the presence of a cellular response to the MERS RBD antigen.

Example 32: Evaluation of T Cell Responses ELISpot assays are used to detect the presence of SARS-CoV-2 spike or RBD-specific T cells or influenza HA-specific T cells. This assay is performed on the following groups of mice from Example 30:
1. RBD
2. GLuc
3. HA
4. Spike 5 . RBD + HA
6. Spike + HA
7. PBS

Mouse spleens are harvested 30 days after boost (ie, 30 days after injection with the first circular RNA formulation) and processed in single cell suspensions. Splenocytes are plated at 0.5 M cells per well in IFN-g or IL-4 ELISpot plates (ImmunoSpot). Splenocytes are left unstimulated or stimulated with SARS CoV-2 and HA peptide pools (JPT, PM-WCPV-SRB and PM-IFNA_HACal). ELISPOT plates are processed according to the manufacturer's protocol.

Example 33 Evaluation of Antibody Responses in Mice Administered Circular RNA Encoding Multiple Antigens This example demonstrates antibody responses resulting from administration of circular RNA encoding expression of multiple antigens.

A hemagglutination inhibition assay (HAI) was used to measure anti-influenza HA antibodies that prevent hemagglutination in sera from mice. Mice were administered formulations of circular RNA, each of which was designed and produced by the methods described herein, SARS-CoV-2 RBD antigen, SARS-CoV-2 spike antigen, influenza HA antigen, It encodes expression of SARS-CoV-2 RBD antigen and influenza HA antigen, SARS-CoV-2 RBD antigen and GLuc polypeptide, or SARS-CoV-2 RBD antigen and SARS-CoV-2 spike antigen. Blood sampling was performed as described in Example 30, Experiment 1, 2 days and 17 days after injection.

Two-fold serial dilutions of samples taken from mice on days 2 and 17 were prepared. A constant amount of influenza virus with a known hemagglutinin (HA) titer, equivalent to 4 hemagglutinin units, was added to all wells of a 96-well plate, except for serum control wells where no virus was added. added to concentration. Plates were allowed to sit at room temperature for 60 minutes before red blood cell samples were added and allowed to incubate at 4° C. for 30 minutes. The highest serum dilution that prevented hemagglutination was determined to be the serum HAI titer. Samples taken on day 17 were dosed with circular RNA formulations encoding influenza HA antigens when administered alone or in combination with SARS-CoV-2 antigens such as RBD or spikes. HAI titers in the treated samples were shown (Fig. 17). No HAI titers were seen at day 17 from samples not dosed with HA antigen, such as SARS-CoV-2 RBD antigen alone or SARS-CoV-2 spike antigen alone.

While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are shown by way of example only. Many changes, modifications and substitutions will occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be used in practicing the invention. It is intended that methods and structures within the scope of the following claims defining the scope of the invention and within the scope of these claims and their equivalents be covered thereby.

Claims (37)

An immunogenic composition comprising a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen. An immunogenic composition comprising a circular polyribonucleotide comprising a sequence encoding a coronavirus antigen, wherein said coronavirus antigen is SEQ ID NOs: 1-10, 13, 15, 17, 19, 21, 23, 25- at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a coronavirus antigen selected from any one of 30, 48, and 49 at least about 80%, 85% for cyclic polyribonucleotides comprising a sequence having a polarizing property, or wherein said cyclic polyribonucleotides are selected from SEQ ID NOS: 12, 14, 16, 18, 20, 22, and 24 , 90%, 95%, 97%, 98%, 99%, or 100% sequence identity. 3. The immunogenic composition of claim 1 or 2, further comprising said coronavirus antigen. The immunogenic composition of any one of claims 1-3, wherein said coronavirus antigen is derived from a betacoronavirus or fragment thereof or a sarvecovirus or fragment thereof. said coronavirus antigen is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or fragments thereof, severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1) or fragments thereof, or Middle East respiratory syndrome coronavirus An immunogenic composition according to any one of claims 1 to 4, derived from a virus (MERS-CoV) or fragments thereof. the coronavirus antigen is a membrane protein or variant or fragment thereof, a viral envelope protein or variant or fragment thereof, a viral spike protein or a variant or fragment thereof, a viral nucleocapsid protein or a variant or fragment thereof, a viral An immunogenic composition according to any one of claims 1 to 5, which is an accessory protein or variant or fragment thereof. The immunogenic composition of any one of claims 1-6, wherein said coronavirus antigen is the receptor binding domain of the spike protein or a variant or fragment thereof. 8. The immunogenic composition of claim 7, wherein said spike protein lacks a cleavage site. 9. The immunogenic composition of any one of claims 1-8, wherein the coronavirus accessory protein is selected from the group consisting of ORF3a, ORF7a, ORF7b, ORF8, ORF10, or any variant or fragment thereof. thing. The immunogenic composition of any one of claims 1-9, wherein the cyclic polyribonucleotide comprises a plurality of sequences each encoding an antigen, at least one sequence encoding a coronavirus antigen. The immunogenic composition of any one of claims 1-10, wherein said cyclic polyribonucleotide comprises two or more ORFs. The immunogenic composition of any one of claims 1-11, wherein said circular polyribonucleotide comprises sequences encoding antigens from at least two different microorganisms, at least one of which is a coronavirus. thing. The immunogenic composition of any one of claims 1-12, wherein said coronavirus antigen comprises an epitope. 14. The immunogenic composition of any one of claims 1-13, wherein the coronavirus antigen comprises an epitope recognized by B cells. 15. The immunogenic composition of any one of claims 1-14, further comprising a second circular polyribonucleotide comprising a sequence encoding a second antigen. 16. The immunogenic composition of any one of claims 1-15, further comprising a second circular polyribonucleotide comprising a second ORF. 17. The immunogen of any one of claims 1-16, further comprising a third, fourth or fifth cyclic polyribonucleotide comprising a sequence encoding a third, fourth or fifth antigen. sex composition. Immunogenic composition according to any one of claims 1 to 17, wherein said first antigen, second antigen, third antigen, fourth antigen and fifth antigen are different antigens. thing. The immunogenic composition of any one of claims 1-18, wherein said immunogenic composition further comprises a pharmaceutically acceptable carrier or excipient. The immunogenic composition of any one of claims 1-19, wherein said immunogenic composition further comprises a pharmaceutically acceptable excipient and does not comprise any carrier. An immunogenic composition comprising a linear polyribonucleotide comprising a sequence selected from any one of SEQ ID NOS: 13, 15 and 12. 22. The immunogenic composition of claim 21, wherein said linear polyribonucleotide comprises sequences encoding two or more antigens, at least one antigen being a coronavirus antigen. wherein said linear polyribonucleotide comprises sequences encoding at least 2, 3, 4, or 5 antigens, wherein at least one antigen is a coronavirus antigen encoded by the sequences of SEQ ID NOS: 13, 15, and 12; 23. The immunogenic composition of claim 21 or claim 22, wherein the immunogenic composition is a 24. A method of delivering an immunogenic composition to a human subject, comprising: a) administering an immunogenic composition according to any one of claims 1-23 to said human subject. A method of inducing an immune response against coronavirus antigens in a non-human animal or human subject, comprising: a) administering an immunogenic composition according to any one of claims 1 to 23 to said non-human animal or human subject; A method comprising administering to 24. A method of delivering an immunogenic composition to a human subject, comprising: a) administering to said human subject an immunogenic composition according to any one of claims 1-23; and b) said non- A method comprising obtaining antibodies against coronavirus antigens from a human animal or human subject. A method of inducing an immune response against coronavirus antigens in a non-human animal or human subject, comprising: a) administering an immunogenic composition according to any one of claims 1 to 23 to said non-human animal or human subject; and b) collecting antibodies against coronavirus antigens from said non-human animal or human subject. 28. The method of any one of claims 24-27, further comprising administering an adjuvant to said non-human animal or human subject. 29. The method of claim 28, wherein said adjuvant is co-formulated and co-administered with said immunogenic composition, or formulated and administered separately from said immunogenic composition. 30. The method of any one of claims 24-29, further comprising formulating the immunogenic composition with a carrier. Claims 24-30, further comprising administering said cyclic polyribonucleotide to said non-human animal or human subject or immunizing said non-human animal or human subject with said cyclic polyribonucleotide at least twice. The method according to any one of . 32. The method of any one of claims 24-31, further comprising administering a vaccine to said non-human animal or human subject or immunizing said non-human animal or human subject with a vaccine. 33. The method of claim 32, wherein said vaccine is a pneumococcal polysaccharide vaccine. 33. The method of claim 32, wherein said vaccine is for bacterial infection. 35. The method of any one of claims 24-34, wherein said non-human animal or human subject is immunized with said cyclic polyribonucleotide by injection. 36. The method of any one of claims 24-35, wherein the antibody of said polyclonal antibody specifically binds to said coronavirus antigen. The method of any one of claims 24-36, wherein said polyclonal antibody is a humanized antibody or a fully human antibody.

Images