CN117700495A

CN117700495A - Novel coronavirus vaccine, preparation method and application thereof

Info

Publication number: CN117700495A
Application number: CN202211111449.6A
Authority: CN
Inventors: 彭育才; 刘隽; 刘琪; 雷奕欣; 李爽; 罗丽平; 金京
Original assignee: Zhuhai Lifanda Biotechnology Co ltd
Current assignee: Zhuhai Lifanda Biotechnology Co ltd
Priority date: 2022-09-13
Filing date: 2022-09-13
Publication date: 2024-03-15

Abstract

The invention provides a novel coronavirus vaccine, a preparation method and application thereof, and relates to the technical field of vaccines. The novel coronavirus vaccine comprises nucleic acid molecules for encoding novel coronavirus Delta variant S protein and encoding novel coronavirus Omikou variant S protein, is a multivalent vaccine, and relieves the technical problem that the novel coronavirus vaccine in the prior art has poor protection effect on variant.

Description

Novel coronavirus vaccine, preparation method and application thereof

Technical Field

The invention relates to the technical field of vaccines, in particular to a novel coronavirus vaccine, a preparation method and application thereof.

Background

The epidemic situation of the new coronavirus causes great social and economic loss worldwide, the new coronavirus is extremely easy to mutate, and the strains such as the original strain of the new coronavirus, the Alpha strain of the new coronavirus, the Beta strain of the new coronavirus, the Gamma mutant strain of the new coronavirus, the Kappa strain of the new coronavirus, the Delta strain of the new coronavirus, the Omicron strain of the new coronavirus and the like appear successively from the discovery to date.

The current market and most of the new coronavirus vaccines in clinical trial stage are designed against the antigen of the original strain of the new coronavirus. The omickon (omacron) variant is at least 60 more mutations compared to the original new coronavirus original strain sequence, with more than 35 mutations in the spike protein (S protein) and 15 mutations in the most critical receptor binding domain within the spike protein (S protein), as opposed to only 2 mutations in this region. The omnikom variant can be divided into at least 5 sub variants, ba.1, ba.2.12.1, ba.2, ba.4, ba.5, etc., according to the difference in mutation sites, wherein the first three are major epidemic strains.

The research shows that the protection effect of the existing vaccine on variant strains is reduced to different degrees, especially against the novel coronavirus Omikovia strain. Therefore, new crown vaccines with better protection effect against variant strains are urgently needed to be developed.

In view of this, the present invention has been made.

Disclosure of Invention

The first object of the present invention is to provide a novel coronavirus vaccine, which alleviates the technical problem that the novel coronavirus vaccine in the prior art has poor protection effect on variant strains.

In order to solve the technical problems, the invention adopts the following technical scheme:

according to one aspect of the present invention there is provided a novel coronavirus vaccine comprising a nucleic acid molecule comprising a first reading frame and a second reading frame;

the first open reading frame encodes a novel coronavirus Delta variant S protein;

the second open reading frame encodes a novel coronavirus omnikom variant S protein.

Preferably, the novel coronavirus vaccine comprises: a nucleic acid molecule comprising a first open reading frame; and, a nucleic acid molecule comprising a second open reading frame;

alternatively, the novel coronavirus vaccine comprises: a fusion nucleic acid molecule comprising both a first open reading frame and a second open reading frame.

Preferably, the amino acid sequence of the novel coronavirus Delta variant S protein is as shown in seq_8;

preferably, the novel coronavirus omnikom variant is a ba.2 subvariant or a ba.1 subvariant; more preferably a ba.2 child variant;

preferably, the amino acid sequence of the ba.1 seed variant S protein is as set forth in seq_16;

preferably, the amino acid sequence of the ba.2 variant S protein is as set forth in seq_14 or seq_26.

Preferably, the nucleic acid molecule is RNA;

preferably, the total GC% content of part of the open reading frame in the RNA is 30-70%, and the GC% content in any fragment with the length of 60bp in the fragments of the open reading frame is not less than 40%;

preferably, the total gc% content of the portion of the open reading frame in the RNA is 50% to 60%, more preferably 54% to 60%;

preferably, the RNA further comprises one or more of a 5' cap, a 5' utr, a 3' utr, a polyA tail, a initiation region, a termination region, a signal sequence region, and a linker sequence;

preferably, the nucleotide sequence of the first open reading frame is as shown in seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53 or seq_54;

preferably, the second open reading frame encodes a novel coronavirus omnikov variant as a ba.1 subvariant; the nucleotide sequence of the second open reading frame is shown as seq_17;

Preferably, the second open reading frame encodes a novel coronavirus omnikov variant as a ba.2 subvariant; the nucleotide sequence of the second open reading frame is shown as seq_15, seq_27, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60 or seq_46;

preferably, the nucleotide sequence of the first open reading frame is selected from one of the sequences shown as seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53 or seq_54 expressing the Delta variant S protein; and, the nucleotide sequence of the second open reading frame is selected from the group consisting of the sequence shown in seq_17 expressing the omnikov ba.1 subvariant S protein;

preferably, the nucleotide sequence of the first open reading frame is selected from one of the group consisting of seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53, and seq_54 expressing Delta variant S protein; and, the nucleotide sequence of the second open reading frame is selected from one of the group consisting of seq_15, seq_27, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60, and seq_46 expressing the omnirange ba.2 variant S protein;

preferably, the combination of the first open reading frame and the second reading frame is selected from: seq_9 and seq_17, seq_9 and seq_27; seq_47 and seq_32; seq_48 and seq_55; seq_49 and seq_56; seq_50 and seq_57; seq_51 and seq_58; seq_52 and seq_59; seq_53 and seq_60; seq_54 and seq_46; seq_54 and seq_60; seq_53 and seq_55; seq_52 and seq_56; seq_51 and seq_57; seq_50 and seq_32; seq_49 and seq_59; seq_48 and seq_60; or, seq_47 and seq_58.

Preferably, the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is (1:9) - (9:1), preferably (1:1) - (9:1), more preferably 3:1;

preferably, the nucleic acid molecule is a fusion nucleic acid molecule, and the number of repetitions of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) - (9:1); preferably (1:1) to (9:1), and more preferably 3:1.

Preferably, the vaccine further comprises a delivery formulation;

preferably, the novel coronavirus vaccine contains nucleic acid lipid nanoparticles consisting of the nucleic acid molecules and lipid components;

preferably, the novel coronavirus vaccine is selected from (a), (b) or (c):

(a) The novel coronavirus vaccine comprises nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a first open reading frame, and nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a second open reading frame;

(b) The novel coronavirus vaccine comprises nucleic acid lipid nanoparticles encapsulated with a nucleic acid molecule comprising a first open reading frame and a nucleic acid molecule comprising a second open reading frame;

(c) The novel coronavirus vaccine comprises: nucleic acid lipid nanoparticles encapsulated with a fused nucleic acid molecule comprising both a first open reading frame and a second open reading frame.

According to another aspect of the present invention, there is also provided a method for preparing the novel coronavirus vaccine described above, comprising mixing the nucleic acid molecule with optional adjuvants to obtain the novel coronavirus vaccine.

Preferably, the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, the preparation method comprising:

separately preparing nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a first open reading frame and nucleic acid lipid nanoparticles coated with a nucleic acid molecule comprising a second open reading frame; then mixing the two nucleic acid lipid nanoparticles according to the formula amount;

or, firstly mixing the nucleic acid molecules containing the first open reading frame and the nucleic acid molecules containing the second open reading frame according to the formula amount, and then preparing the nucleic acid lipid nanoparticle coated with the nucleic acid molecules containing the two nucleic acid molecules;

alternatively, nucleic acid lipid nanoparticles are prepared that encapsulate nucleic acid molecules that contain both a first open reading frame and a second open reading frame.

According to another aspect of the present invention, there is also provided the use of the novel coronavirus vaccine described above, or of the preparation method described above, for the preparation of a product for the prophylaxis or treatment of a disease caused by a novel coronavirus.

According to another aspect of the present invention there is also provided a product for the prophylaxis or treatment of a novel coronavirus-induced disease, said product comprising a novel coronavirus vaccine as described above.

Compared with the prior art, the invention has the following beneficial effects:

the novel coronavirus vaccine provided by the invention takes nucleic acid as main immunogenic matters of the vaccine, and comprises nucleic acid molecules containing a first reading frame and a second reading frame, wherein the first reading frame codes for novel coronavirus Delta variant S protein, and the second reading frame codes for novel coronavirus Omicron variant S protein. After the novel coronavirus vaccine is immunized on a body, S proteins of novel coronavirus Delta variant strains and Omikovia variant strains can be expressed in the body, and the activity of antibodies generated by each variant strain of the novel coronavirus is reduced less, so that the novel coronavirus vaccine is a multivalent vaccine.

After animals are immunized by the nucleic acid molecules containing the protein of the novel coronavirus Delta variant S, antibodies generated in animal serum have strong neutralizing activity on 6 strains of pseudoviruses, namely an original strain, an Alpha variant, a Beta variant, a Gamma variant, a Delta variant and an Omicron variant of the novel coronavirus; after animals are immunized by the nucleic acid molecules containing the S protein of the novel coronavirus omnikom variant, antibodies generated in animal serum have stronger neutralization activity on Omicron variant; the novel coronavirus vaccine can be combined with the world epidemic strain distribution of the novel coronavirus, so that the immunogen of the novel coronavirus vaccine can encode the Delta variant S protein and the Omikou variant S protein, and can have the prevention effect on each epidemic strain of the novel coronavirus.

Experiments show that after animals are immunized by S protein containing encoding novel coronavirus Delta variant and Omicron variant, the generated antibodies have better neutralization activity on epidemic novel coronavirus Delta variant, novel coronavirus Omicron BA.1 variant and novel coronavirus Omicron BA.2 variant, and the effect of preventing the increase of the variety of the novel coronavirus variant is realized.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1-1 shows the results of a test for pseudovirus neutralization activity of serum produced after immunization of cynomolgus monkeys with each of the vaccine formulations of example 2 on a novel coronavirus;

FIGS. 1-2 are results of tests for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of cynomolgus monkeys with the vaccine formulation of example 2;

FIG. 2 is a graph showing the results of test of pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each vaccine formulation of example 3;

FIG. 3 is a GC% content of RNA with the reading frame sequence shown as seq_27;

FIG. 4 is a GC% content of RNA with the reading frame sequence shown as seq_32;

FIG. 5 is the GC% content of RNA with the reading frame sequence shown as seq_33;

FIG. 6 is the GC% content of RNA with the reading frame sequence shown as seq_34;

FIG. 7 is a GC% content of RNA with the reading frame sequence shown as seq_35;

FIG. 8 is a graph showing the results of test of pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with each of the vaccine formulations of example 6;

FIG. 9 is a graph showing the results of the test for pseudovirus neutralization activity of the novel coronavirus by serum produced after immunization of C57 mice with samples 1 to 11 in example 7;

FIG. 10 is a graph showing the results of the test for pseudovirus neutralization activity of the novel coronavirus by serum produced after immunization of C57 mice with samples 11 to 12 of example 7;

FIG. 11 shows the cross-comparison of samples 6-9 and samples 17-20 of example 7;

FIG. 12 is a graph showing the results of the pseudo-virus neutralization activity test of the novel coronavirus by the serum produced after immunization of C57 mice with samples 2-1 to 2-11 in example 8;

FIG. 13 is a graph showing the results of the pseudo-virus neutralization activity test of the novel coronavirus by the serum produced after immunization of C57 mice with samples 2-12 to 2-22 in example 9;

FIG. 14 is a graph showing the results of a test for pseudovirus neutralization activity of novel coronaviruses by serum generated after immunization of C57 mice with the sample of example 10;

FIG. 15 is a graph showing the results of a test for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with the sample of example 11;

FIG. 16 is a graph showing the results of a test for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with the sample of example 12;

FIG. 17 is a graph showing the results of a test for pseudovirus neutralization activity of novel coronaviruses by serum produced after immunization of C57 mice with the sample of example 13.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in connection with the embodiments, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

It should be noted that: in the present invention, all embodiments and preferred methods of implementation mentioned herein may be combined with each other to form new technical solutions, if not specifically stated; all technical features and preferred features mentioned herein may be combined with each other to form new solutions; the components involved or their preferred components can be combined with one another to form new technical solutions.

The "range" disclosed herein may take the form of a lower limit and an upper limit, respectively, of one or more lower limits and one or more upper limits; unless otherwise indicated, the steps may or may not be performed in sequential order.

Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any method or material similar or equivalent to those described may be used in the present invention.

According to one aspect of the present invention there is provided a novel coronavirus vaccine comprising a nucleic acid molecule as an immunogenic agent comprising a nucleic acid molecule comprising a first open reading frame encoding a novel coronavirus Delta variant S protein and a second open reading frame encoding a novel coronavirus ommicon variant S protein. After the novel coronavirus vaccine is immunized on a body, the novel coronavirus Delta variant and S protein of the Omikovia variant can be expressed in the body, and the novel coronavirus vaccine is a multivalent vaccine.

As used herein, a "nucleic acid molecule" refers to a polymeric form of nucleotides of any length, including ribonucleotides and/or deoxyribonucleotides. Examples of nucleic acids include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA; integrating vector DNA from an exogenous gene, such as an expression cassette or plasmid; DNA-RNA hybrids or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases.

In the nucleic acid molecule comprising the first reading frame and the second reading frame, the first reading frame and the second reading frame may be present in the same nucleic acid molecule or may be present in different nucleic acid molecules. Thus, as long as the novel coronavirus vaccine comprises a nucleic acid molecule comprising a first reading frame and a second reading frame, the novel coronavirus Delta variant and the Omikovia variant S protein can be generated in the body after the novel coronavirus vaccine is applied to the body, namely the novel coronavirus vaccine provided by the invention.

In some alternative embodiments, the novel coronavirus vaccine comprises: a nucleic acid molecule comprising a first open reading frame; and, a nucleic acid molecule comprising a second open reading frame;

Experiments show that after animals are immunized by nucleic acid molecules containing S protein of a novel coronavirus Delta variant, antibodies generated in animal serum have strong neutralization activity on pseudoviruses of 6 strains of an original strain, an Alpha variant, a Beta variant, a Gamma variant, a Delta variant and an Omicron variant of the novel coronavirus; after animals are immunized by the nucleic acid molecules containing the S protein of the novel coronavirus omnikom variant, antibodies generated in animal serum have stronger neutralization activity on Omicron variant; the novel coronavirus vaccine contains nucleic acid molecules capable of encoding Delta variant S protein and Omikovia variant S protein, and has the effect of preventing various epidemic strains of the novel coronavirus.

In the novel coronavirus vaccine provided by the invention, the S protein of the novel coronavirus coded by the open reading frame is optionally the S protein obtained by mutating a Delta variant strain and/or an Omikovia variant strain under natural conditions; alternatively, the mutant and modified S protein can be an amino acid sequence of the S protein which is obtained by wild type mutation and modification and accords with a Delta variant strain or an Omikou variant strain; alternatively, the amino acid sequence of the S protein may be obtained by further mutating and modifying the amino acid sequences of the S proteins of the Delta variant strain and the Omikovia variant strain.

The amino acid sequence of the S protein of the novel coronavirus encoded by the open reading frame is preferably as follows:

the amino acid sequence of the novel coronavirus Delta variant S protein is preferably as shown in seq_8.

The amino acid sequence of the S protein of the novel coronavirus omucon variant is optionally derived from the S protein of the BA.1 variant, the BA.2 variant or the BA.3 variant;

or, the amino acid sequence of the S protein of the omnikom variant is optionally derived from the amino acid sequence obtained by mutating a wild-type S protein. Wherein the mutation comprises the step of obtaining at least one mutation site in an Omikovia strain BA.1 mutant strain, a BA.2 mutant strain and a BA.3 mutant strain after the wild S protein is mutated; for example, but not limited to, obtaining three mutation sites common to the omucon strain ba.1, ba.2 and ba.3, or one or more of all mutation sites of the three sub variants, after mutation of the wild-type S protein; or, obtaining a mutation site shared by the BA.1 mutant strain and the BA.2 mutant strain, or one or more mutation sites of all the two mutant strains; or, obtaining a mutation site shared by the BA.1 mutant strain and the BA.3 mutant strain, or one or more mutation sites of all the two mutant strains; alternatively, a mutation site common to the ba.1 and ba.3 mutant strains, or one or more of all mutation sites of both mutant strains, is obtained.

In some preferred embodiments, the novel coronavirus omnikov variant is a ba.2 subvariant or a ba.1 subvariant; more preferably, the strain is a strain of the BA.2 child variant.

The amino acid sequence of the novel coronavirus omucon variant BA.1 subunit variant S protein is preferably as shown in seq_16.

The amino acid sequence of the S protein of the novel coronavirus Ompick variant BA.2 subvariant strain is preferably shown as seq_14 or seq_26, and the sequence seq_26 is obtained by mutating the SN of the S protein of the Omacron BA.2 strain (two proline residues are substituted at positions 983 and 984 of the amino acid sequence seq_14 of the full-length S protein), and has higher expression level.

The novel coronavirus vaccine provided by the invention takes nucleic acid molecules as main effective components, and the novel coronavirus vaccine expresses and generates S protein of novel coronavirus Delta variant strain and virus Omikovia strain in vivo after being applied to an organism. In order to further improve the immune effect of the vaccine, the invention also optimizes the nucleic acid molecules, the proportion of two nucleic acids encoding S protein and the vaccine preparation.

Optimization of nucleic acid molecules:

the nucleic acid molecules contained in the novel coronavirus vaccine are preferably RNA, and the novel coronavirus vaccine is preferably an RNA vaccine.

In some preferred embodiments, the total gc% content of the open reading frame portions in the RNA is 30-70%, such as, but not limited to, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70%, or a range between any two points thereof, preferably 50% -60%, more preferably 54% -60%. Meanwhile, the GC percent content in any fragment with the length of 60bp in the open reading frame part is not less than 40 percent, and the invention discovers that the expression quantity of the novel coronavirus S protein of the RNA meeting the above conditions is higher through experiments.

In some preferred embodiments, the RNA further comprises one or more of a 5' cap, a 5' utr, a 3' utr, a polyA tail, a start region, a termination region, a signal sequence region, and a linker sequence; the structure of the RNA in the novel coronavirus vaccine is preferably as follows:

alternatively, the RNA comprises, in order from the 5 'end to the 3' end: 5 'cap-5' utr-first open reading frame and/or second open reading frame-3 'utr-3' polya tail; sequentially includes fragments comprising RNA from the 5 'end to the 3' end, and may or may not comprise at least one ribonucleotide or functional nucleic acid fragment.

Alternatively, the RNA contains both a first open reading frame and a second open reading frame, and is a fusion RNA, the structure of which is preferably as follows:

an alternative example structure is as follows: 5 'cap-5' utr-initiation region-first open reading frame-linker sequence-second open reading frame-3 'utr-termination region-3' polya tail;

or, a 5 'hat-5' UTR-first open reading frame-linker sequence-second open reading frame-3 'UTR-3' polyA tail;

an alternative example structure is as follows: 5 'hat-5' UTR-initiation region- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3 'UTR-termination region-3' polyA tail;

or, a 5 'hat-5' UTR- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3'UTR-3' polyA tail;

wherein n is: repeat number of the fragment "first coding region-linker sequence"; m is: repeat number of the fragment "linker sequence-second coding region"; n and m are each independently a positive integer.

In the above example, the content of the open reading frame encoding the novel coronavirus Delta variant S protein and the open reading frame encoding the novel coronavirus omucon variant S protein can be adjusted by adjusting the repetition number of the fragments of the first coding region-linker sequence and the fragment of the second coding region, namely the values of n and m, or adjusting the ratio of n and m, so that after RNA immunization of a human body in the novel coronavirus, delta variant S proteins and omucon variant S proteins with different content and proportion can be produced.

Other functional fragments in RNA are preferably as follows:

the 5 'cap structure is used to increase mRNA stability and prevent mRNA from being degraded by exonuclease, and the 5' cap structure is preferably m7G (5 ') (2' -OMeA) pG.

The 5'UTR and the 3' UTR are used for regulating the translation of mRNA,

the 5' UTR sequence is preferably: GGGAGAAAGCUUACC (shown as seq_1).

The 3' UTR sequence is preferably:

GGACUAGUUAUAAGACUGACUAGCCCGAUGGGCCUCCCAACGGGCCCUCCUCCCCUCCUUGCACCGAGAUUAAU (shown as seq_2).

The 3' polyA tail is used to avoid degradation of mRNA by exonucleases while terminating transcription, the polyA preferably being 100bp in length and having the sequence shown in seq_3.

In some alternative embodiments, the Linker sequence contains at least one portion encoding a protein cleavage signal, which may be, for example, but not limited to, a cleavage signal with a cleavage functional substance as follows: protein precursor convertases, hormone precursor convertases, thrombin and factor Xa proteins. The protein cleavage signal preferably comprises a Furin cleavage site (Furin cleavage site, FCS, reference US7374930B 2). Furin cleavage sites are widely distributed in most cell types, and the fusion RNA can effectively express active polypeptide in almost any type of cells in vivo, so that the active polypeptide expressed in vivo by the fusion RNA can be effectively cleaved by using the Furin cleavage sites, and the first open reading frame and the second open reading frame fused on the same RNA respectively express Delta variant S protein and Omikou variant S protein.

The DNA sequence of the Furin cleavage site is preferably CGTCAACGTCGT (seq_6); the RNA sequence is preferably CGUCAACGUCGU (seq_7).

In some alternative embodiments, the Linker is a cleavable Linker or a protease sensitive Linker. The cleavable linker is preferably a 2A peptide, and the 2A peptide (2A self-cleaving peptides) is a peptide fragment 18-22 amino acid residues in length, which can induce self-cleavage of a recombinant protein containing the 2A peptide in a cell. Several viruses use 2A peptides to produce two proteins from one transcript by ribosome skipping, such that normal peptide bonds are weakened at the 2A peptide sequence, resulting in two discrete proteins produced by one translational event.

Examples of 2A peptides may be, for example, but are not limited to:

F2A linker (foot-and-mouth disease virus (FMDV) 2A peptide):

the amino acid sequence is: (GSG) VKQTLNFDLLKLAGDVESNPGP (shown as seq_36 or seq_37);

P2A linker (porcine teschovirus-1 2A peptide):

the amino acid sequence is: (GSG) ATNFSLLKQAGDVEENPGP (shown as seq_38 or seq_39);

E2A linker (equine rhinitis a virus 2A peptide):

the amino acid sequence is: (GSG) QCTNYALLKLAGDVESNPGP (shown as seq_40 or seq_41);

T2A linker (the flat vein echinococcosis virus 2A peptide):

the amino acid sequence is: (GSG) EGRGSLLTCGDVEENPGP (shown as seq_42 or seq_43).

The N-terminal of the 2A peptide sequence is added with a GSG (Gly-Ser-Gly, glycine, serine and glycine) sequence, so that the efficiency of 2A peptide induced shearing can be improved.

The nucleotide sequence encoding the 2A peptide includes, but is not limited to, or is based on, the following sequences, the polynucleotide sequence of the 2A peptide being modified or codon optimized by methods described hereinabove and/or known in the art:

GGAAGCGGAGCUACUAACUUCAGCCUGCUGAAGCAGGCUGGAGACGUGGAGGAGAACCCUGGACCU (shown as seq_44); or alternatively, the first and second heat exchangers may be,

UCCGGACUCAGAUCCGGGGAUCUCAAAAUUGUCGCUCCUGUCAAACAAACUCUUAACUUUGAUUUACUCAAACUGGCTGGGGAUGUAGAAAGCAAUCCAGGTCCACUC (shown as seq_45).

The linker sequence in the fragment "first coding region-linker sequence" and the linker sequence in the fragment "linker sequence-second coding region" may be identical or different.

The sequence and combination of specific open reading frames is preferably as follows:

in some alternative embodiments, the nucleotide sequence encoding the first open reading frame of the novel coronavirus Delta variant S protein is as set forth in seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53, or seq_54.

In some alternative embodiments, the second open reading frame encodes a novel coronavirus omucotton variant ba.1 subvariant, the nucleotide sequence of which is shown in seq_17.

In some alternative embodiments, the second open reading frame encodes a novel coronavirus omucotton variant ba.2 subvariant, the nucleotide sequence of which is shown as seq_15, seq_27, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60, or seq_46.

The first open reading frame and the second open reading frame are optionally combined as follows:

in some alternative embodiments, the nucleotide sequence of the first open reading frame is selected from one of the sequences set forth in seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53, or seq_54 expressing Delta variant S protein; and, the nucleotide sequence of the second open reading frame is selected from the group consisting of the sequence shown in seq_17 expressing the amikappaphrons ba.1 subvariant S protein.

Or, the nucleotide sequence of the first open reading frame is selected from one of the group consisting of seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53, and seq_54 expressing Delta variant S protein; and, the nucleotide sequence of the second open reading frame is selected from one of the group consisting of seq_15, seq_27, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60, and seq_46 expressing the omnirange ba.2 variant S protein.

The specific combination of the first open reading frame and the second reading frame may be, for example, but is not limited to: seq_9 and seq_17, seq_9 and seq_27; seq_47 and seq_32; seq_48 and seq_55; seq_49 and seq_56; seq_50 and seq_57; seq_51 and seq_58; seq_52 and seq_59; seq_53 and seq_60; seq_54 and seq_46; seq_54 and seq_60; seq_53 and seq_55; seq_52 and seq_56; seq_51 and seq_57; seq_50 and seq_32; seq_49 and seq_59; seq_48 and seq_60; or, seq_47 and seq_58.

Nucleic acid ratio encoding S protein:

in some alternative embodiments, the ratio of two S proteins produced in the body after immunization of the body with the vaccine is adjusted by adjusting the amount of nucleic acid encoding the Delta variant S protein and the amount of the Omikovia variant S protein in the novel coronavirus vaccine.

In some alternative embodiments, the first open reading frame and the second open reading frame are located in different nucleic acid molecules, the mass ratio of the nucleic acid molecule encoding the first open reading frame to the nucleic acid molecule encoding the second open reading frame is (1:9) - (9:1); for example, but not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1, preferably (1:1) - (9:1), more preferably 3:1. In this embodiment, the nucleic acid molecule is preferably an RNA molecule and has a sequence as from 5 'to 3' end comprising: structure of 5 'hat-5' UTR-first open reading frame and/or second open reading frame-3 'UTR-3' polyA tail.

In some alternative embodiments, the nucleic acid molecule is a fusion nucleic acid molecule, i.e., the same nucleic acid molecule contains both a first open reading frame and a second open reading frame, the number of repeats of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule being (1:9) - (9:1); for example, but not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1, preferably (1:1) - (9:1), more preferably 3:1.

Vaccine formulation optimization:

it will be appreciated that the novel coronavirus vaccines provided herein may also contain other adjuvants or functional ingredients acceptable in the art for use in preparing vaccines, including, but not limited to, at least one or more of vaccine adjuvants, delivery formulations, solvents, preservatives, stabilizers, pH adjusters, buffer substances, and lyoprotectants.

In some preferred embodiments, the vaccine further comprises a delivery formulation, preferably a lipid component, preferably constituting nucleic acid Lipid Nanoparticles (LNP) with the nucleic acid molecules of the novel coronavirus vaccine, the LNP being nanoparticles formed by encapsulating the nucleic acid with the lipid component, the LNP enabling more efficient delivery of the nucleic acid encapsulated therein into the cell.

The vaccine preferably further comprises a delivery formulation, preferably a lipid component, preferably constituting nucleic acid Lipid Nanoparticles (LNP) with the nucleic acid molecules of the novel coronavirus vaccine, the LNP being nanoparticles formed by encapsulating the nucleic acid with the lipid component, the LNP enabling more efficient delivery of the nucleic acid encapsulated therein into cells.

The novel coronavirus vaccine contains LNP as follows (a), (b) or (c):

(a) The first reading frame and the second reading frame are respectively provided with different nucleic acid molecules, the nucleic acid molecule containing the first reading frame and the nucleic acid molecule containing the second reading frame are respectively wrapped in different LNPs, namely the novel coronavirus vaccine comprises the LNPs wrapped with the nucleic acid molecule containing the first open reading frame and the LNPs wrapped with the nucleic acid molecule containing the second open reading frame.

(b) The first reading frame and the second reading frame are respectively provided with different nucleic acid molecules, the nucleic acid molecules containing the first reading frame and the nucleic acid molecules containing the second reading frame are mixed and then are wrapped in the same LNP, namely the novel coronavirus vaccine comprises the LNP wrapped with the nucleic acid molecules containing the first open reading frame and the nucleic acid molecules containing the second open reading frame.

(c) The first reading frame and the second reading frame are present in the same nucleic acid molecule which is enclosed in the LNP, i.e. the novel coronavirus vaccine comprises: LNP coated with a nucleic acid molecule comprising both a first open reading frame and a second open reading frame.

The lipid components used to construct the LNP are preferably as follows: the lipid component forming the LNP comprises 20 to 50% protonatable cationic lipid in mole percent, such as, but not limited to, 20%, 25%, 30%, 35%, 40%, 45% or 50%; 20-50% structural lipids, such as, but not limited to, 20%, 25%, 30%, 35%, 40%, 45% or 50%; 5-20% helper lipid, for example, but not limited to, 5%, 10%, 15% or 20%; and 1-5% surfactant, which may be, for example, but not limited to, 1%, 2%, 3%, 4% or 5%. Wherein the molar content of protonatable cationic lipids, structural lipids, helper lipids and surfactant add up to 100%.

The protonatable cationic lipid preferably comprises at least one of DlinMC3-DMA, DODMA, C12-200 and DlinDMA.

The helper lipid preferably comprises at least one of DSPC, DOPE, DOPC, DOPG and DOPS.

The structural lipids preferably comprise cholesterol and/or cholesterol derivatives.

The surfactant preferably comprises at least one of PEG-DMG, PEG-DSPE and TPGS.

In some preferred embodiments, the lipid component comprises Dlin-MC3-DMA 50%, DOPG10%, cholesterol 38.5% and PEG-DMG 1.5% in mole percent.

In some preferred embodiments, the lipid component comprises Dlin-MC3-DMA 50%, DOPG20%, cholesterol 29% and PEG-DMG 1% in mole percent.

In some alternative embodiments, the LNP in the vaccine is prepared as follows: the nucleic acid lipid nanoparticle is obtained by uniformly mixing an aqueous phase containing a nucleic acid molecule and an organic phase containing the lipid component to obtain a mixed solution, removing the organic phase and making the concentration of the nucleic acid molecule in the system to be 1 to 100. Mu.g/ml, which may be, for example, but not limited to, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100. Mu.g/ml, preferably 55. Mu.g/ml.

The mixing of the aqueous and organic phases is preferably performed using a microfluidic device, the flow rate being controlled to >3ml/min.

The organic phase is removed by preferably diluting the mixture 50 to 100 times, such as, but not limited to, 50, 60, 70, 80, 90 or 100 times, with a buffer, and removing the organic phase from the solution using Tangential Flow Filtration (TFF), followed by concentration to bring the nucleic acid molecules in the system to the target concentration.

The aqueous phase is an aqueous buffer containing 0.08-1.2 mg/L of the nucleic acid molecule, and the concentration of the nucleic acid molecule in the aqueous phase can be, for example, but not limited to, 0.08, 0.1, 0.2, 0.5, 0.8, 1.0, 1.1 or 1.2mg/L; the aqueous phase buffer solution is citrate buffer solution or sodium acetate buffer solution.

The organic phase is anhydrous C1-C4 lower alcohol containing 5-7 mg/L of the lipid component, and the concentration of the lipid component can be, for example, but not limited to, 5, 5.5, 6, 6.5 or 7mg/ml; the anhydrous C1-C4 lower alcohol is preferably ethanol.

The volume ratio of the aqueous phase to the organic phase is 1:2-4, and may be, for example, but not limited to, 1:2, 1:3, or 1:4.

It should be noted that all the technical features and preferred features mentioned above in the optimization of nucleic acid molecules, optimization of the proportion of nucleic acids encoding the S protein and optimization of vaccine formulations can be combined with each other to form new technical solutions. For example, in an optimized protocol for the proportion of nucleic acid encoding the S protein, LNP is optionally prepared in either (a), (b) or (c), with or without other delivery means; in the vaccine preparation optimization scheme, a plurality of LNPs coated with different nucleic acids are prepared by adopting different combinations of a first open reading frame and a second open reading frame; when the nucleic acid molecule adopts other types of molecules, such as an expression cassette or a vector integrated with DNA, LNP coated with DNA can also be prepared by adopting the mode of (a), (b) or (c) to serve as a main efficacy component of the vaccine. Specific examples may be, for example, but are not limited to:

In some alternative embodiments, the novel coronavirus vaccine comprises two RNA molecules, each comprising a first reading frame having a nucleotide sequence shown as seq_9 and a second reading frame having a nucleotide sequence shown as seq_27. The two RNA molecule sequence features also include a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2) and the 3' tails of 100 polyAs (as shown in seq_3). The mass ratio (1:9) to (9:1) of the RNA molecule containing the first reading frame to the RNA molecule containing the second reading frame; for example, but not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1. The two RNA molecules are respectively prepared into LNP, and then mixed according to the mass of RNA and the formula amount to obtain the effective components in the novel coronavirus vaccine.

In this embodiment, the nucleotide sequence of the first reading frame may also be selected from any of seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53 or seq_54; the nucleotide sequence of the second reading frame may also be selected from any of seq_17, seq_15, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60 or seq_46.

In the above embodiment, the specific combination manner of the first open reading frame and the second reading frame may be, for example, but not limited to: seq_9 and seq_17, seq_9 and seq_27; seq_47 and seq_32; seq_48 and seq_55; seq_49 and seq_56; seq_50 and seq_57; seq_51 and seq_58; seq_52 and seq_59; seq_53 and seq_60; seq_54 and seq_46; seq_54 and seq_60; seq_53 and seq_55; seq_52 and seq_56; seq_51 and seq_57; seq_50 and seq_32; seq_49 and seq_59; seq_48 and seq_60; or, seq_47 and seq_58.

In other alternative embodiments, the novel coronavirus vaccine comprises two RNA molecules, each comprising a first reading frame having a nucleotide sequence shown as seq_9 and a second reading frame having a nucleotide sequence shown as seq_27. The two RNA molecule sequence features also include a 5 'cap (m 7G (5') (2 '-OMeA) pG), a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2) and the 3' tails of 100 polyAs (as shown in seq_3). The mass ratio (1:9) to (9:1) of the RNA molecule containing the first reading frame to the RNA molecule containing the second reading frame; for example, but not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1. Mixing the two RNA molecules according to the formula, and then preparing LNP coated with the two RNA molecules to obtain the effective components in the novel coronavirus vaccine.

In the above embodiment, the nucleotide sequence of the first reading frame may also be selected from any one of seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53 or seq_54; the nucleotide sequence of the second reading frame may also be selected from any of seq_17, seq_15, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60 or seq_46.

In other alternative embodiments, the novel coronavirus vaccine comprises a fusion RNA molecule comprising two coding regions comprising at least a first open reading frame selected from the nucleotide sequences set forth in seq_9 and a second open reading frame selected from the nucleotide sequences set forth in seq_27.

The fusion RNA molecule has the structure of 5 'cap-5' UTR- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3'UTR-3' polyA tail, and n and m are respectively independent positive integers. Wherein the 5' cap is m7G (5 ') (2 ' -OMeA) pG, the 5' UTR is shown as seq_1, the 3' UTR is shown as seq_2 and the polyA is shown as seq_3, and the Linker sequence is shown as seq_45. The ratio of n to m is (1:9) - (9:1); for example, but not limited to, 1:9, 1:4, 1:3, 1:1, 3:1, 4:1, or 9:1. LNP is prepared from the fusion RNA molecule and is used as an effective component in novel coronavirus vaccine.

In the above embodiment, the nucleotide sequence of the first open reading frame may also be selected from any one of seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53 or seq_54; the nucleotide sequence of the second open reading frame may also be selected from any of seq_17, seq_15, seq_32, seq_55, seq_56, seq_57, seq_58, seq_59, seq_60 or seq_46.

According to another aspect of the present invention, there is also provided a method of preparing the novel coronavirus vaccine described above, comprising mixing the nucleic acid molecule with optional adjuvants to obtain the novel coronavirus vaccine.

In some alternative embodiments, the novel coronavirus vaccine comprises nucleic acid lipid nanoparticles, the method of making comprising:

preparing nucleic acid lipid nanoparticles coated with nucleic acid molecules containing a first open reading frame and nucleic acid lipid nanoparticles coated with nucleic acid molecules containing a second open reading frame respectively, obtaining nucleic acid lipid nanoparticles coated with different open reading frames respectively, and mixing the two nucleic acid lipid nanoparticles according to the formula amount.

Alternatively, the nucleic acid molecule containing the first open reading frame and the nucleic acid molecule containing the second open reading frame are mixed according to the formula amount, and then the nucleic acid lipid nanoparticle coated with the nucleic acid molecules containing the two nucleic acid molecules is prepared.

The preparation method of the nucleic acid lipid nanoparticle is preferably performed according to the method of Lipid Nanoparticle (LNP) described in the section of the novel coronavirus vaccine technical scheme, and will not be described in detail here.

According to another aspect of the present invention, there is also provided the use of the novel coronavirus vaccine described above, or a method of preparing the novel coronavirus vaccine described above, in the manufacture of a product for the prevention or treatment of a disease caused by a novel coronavirus.

According to another aspect of the present invention there is also provided a product for the prophylaxis or treatment of a novel coronavirus-induced disease comprising the novel coronavirus vaccine described above.

The above-mentioned products for preventing or treating diseases caused by the novel coronaviruses may be, for example, but not limited to, kits further comprising means for vaccinating the novel coronaviruses; kits containing other prophylactically or therapeutically active ingredients; or, a kit for evaluating the effectiveness of the novel coronavirus vaccine.

The technical solution and advantageous effects of the present invention are further described below in connection with preferred embodiments.

Example 1

The present example provides a method for preparing lipid nanoparticles comprising RNA, wherein the lipid nanoparticles comprise in mole percent: dlin-MC3-DMA 50%, DOPG 20%, cholesterol 29% and PEG-DMG 1%, and the preparation method is as follows:

(a) RNA was dissolved in citrate buffer at pH4 to adjust the concentration to 0.1mg/ml, to give an aqueous phase.

(b) Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG were dissolved in absolute ethanol in the amounts of the formulation, and the concentration of the lipid component in the organic phase was adjusted to 6mg/mL to give an organic phase.

(c) Mixing the aqueous phase of step (a) and the organic phase of step (b) at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12mL/min, immediately diluting the mixture 100-fold with PBS solution at pH7.4, removing ethanol component from the solution using Tangential Flow Filtration (TFF), and concentrating to a mRNA concentration of 55 μg/mL in the system to obtain lipid nanoparticles comprising RNA encoding SARS-CoV-2 virus antigen.

Example 2

This example designed a series of mRNA sequences in which the sequence of the reading frames is shown in Table 1; in addition to the reading frame sequence, the series of mRNA sequence features also include a 5 'cap, a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2), and the 3' tail of 100 polyAs (as shown in seq_3).

TABLE 1 mRNA sequence design scheme

Each of the above mrnas was prepared as lipid nanoparticles according to the preparation method provided in example 1.

Experiment a: and selecting normal cynomolgus monkeys about 5-8 years old, and evaluating the immunogenicity of the vaccine. Animals were randomly divided into 5 groups, namely, original strain group (seq_13) (50. Mu.g/only), delta group (seq_9) (50. Mu.g/only), beta group (seq_5) (50. Mu.g/only), omicron group (seq_11) (50. Mu.g/only) and negative control group, 12 each, hermaphroditic.

The mRNA LNP formulation prepared in example 2 was used in a cynomolgus monkey immunization experiment, each cynomolgus monkey was intramuscularly injected with 50 micrograms (in terms of mRNA) through the hind limb thigh, and the corresponding test vaccine and control vaccine were respectively injected with D0 (D0) and D21 through the hind limb thigh on the day of administration, wherein the negative control group was injected with 0.5mL of PBS. The cynomolgus monkey serum was withdrawn 28 days after the first immunization and sent to a third party laboratory for the neutralization activity test of SARS-CoV-2 pseudovirus. Diluting cynomolgus monkey serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast at the same time, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. The serum corresponds to the group number and the results are shown in fig. 1-1.

As can be seen from fig. 1-1:

(1) The vaccine preparation prepared from the 4 antigens can stimulate the cynomolgus monkey to generate antibodies with neutralizing capacity to pseudoviruses of target strains.

(2) mRNA (seq_9) vaccine preparation for encoding novel coronavirus Delta variant S protein stimulates that antibodies produced by cynomolgus monkey have strong neutralizing activity on pseudoviruses of 6 strains of original strain, alpha variant, beta variant, gamma variant, delta variant and Omicron variant of the novel coronavirus;

the mRNA (seq_13) vaccine preparation for encoding the S protein of the original strain of the novel coronavirus stimulates that antibodies produced by the cynomolgus monkey have stronger neutralizing activity on pseudoviruses of the original strain, alpha variant strain, beta variant strain, gamma variant strain and Delta variant strain 5 strains of the novel coronavirus, and weaker neutralizing activity on the Omicron variant strain;

the mRNA (seq_5) vaccine preparation encoding the S protein of the novel coronavirus Beta variant stimulates the cynomolgus monkey to produce antibodies which have stronger neutralizing activity against 3 strains of pseudoviruses of the novel coronavirus Beta variant, gamma variant and Delta variant, and weaker neutralizing activity against the original strain, alpha variant and Omicron variant.

The antibodies produced by the mRNA vaccine formulations encoding the novel coronavirus Delta variant and the novel coronavirus original strain S protein possess broader neutralizing activity from the point of view of stimulating the neutralizing activity of the antibodies produced by cynomolgus monkeys against pseudoviruses of each novel coronavirus strain and variant.

Experiment B: and selecting normal cynomolgus monkeys about 5-8 years old, and evaluating the immunogenicity of the vaccine. Animals were randomly divided into 3 groups, namely, the original strain group (seq_13) (50. Mu.g/only), the Delta group (seq_9) (50. Mu.g/only), and the negative control group, 36 animals per group, in hermaphroditic halves. The neutralization activity test of SARS-CoV-2 pseudovirus was performed as described in experiment A. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. The serum corresponds to the group number and results are shown in figures 1-2. The mRNA vaccine preparation sample encoding the S protein of the novel coronavirus Delta variant is designated as sample 1-1, and the mRNA vaccine preparation sample encoding the S protein of the novel coronavirus original is designated as sample 1-2.

mRNA vaccine formulations encoding the S protein of the novel coronavirus Delta variant have better neutralizing activity against epidemic strains such as Beta variants and Omicron variants.

Example 3

Screening of Omicron subtype strain S protein:

this example designed a series of mRNA sequence information in which the sequence of the reading frames is shown in table 2; in addition to the reading frame sequence, the series of mRNA sequence features also include a 5 'cap, a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2), and the 3' tail of 100 polyAs (as shown in seq_3).

TABLE 2 mRNA sequence design scheme

The 3 child variant strains of the Omicron strain in table 2 are the Omicron ba.1 strain, the Omicron ba.2 strain and the Omicron ba.3 strain.

The six different antigens of samples 1-6 are respectively prepared into vaccines according to the method of the embodiment 1, the mixture of mRNA of different groups is respectively prepared into LNP preparations, the detection encapsulation rate of the LNP preparations is more than 90%, and the particle size is about 70 nm.

The prepared mRNA LNP formulation was used in C57 mice immunization experiments, each mouse being injected 5 micrograms (in mRNA) via hind limb lateral thigh muscle, and two immunizations were performed after 7 days apart, 3 mice per group. Mice were serum withdrawn 14 days after the first immunization and sent to third party laboratories for the neutralization activity test of SARS-CoV-2 pseudovirus. Diluting mouse serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. EC50 values for pseudovirus strains of different antigens prepared from samples 1-6 are shown in figure 2.

As can be seen from the results of fig. 2:

(1) Since the S proteins of both BA.1 and BA.2 variants of the novel coronavirus Omikovia variant are mutated more at sites than the S proteins of the novel coronavirus Delta strain, the vaccine preparation prepared by the amino acid sequences of the S proteins encoded by the mRNA vaccine reading frames as shown in seq_14, seq_16, seq_18, seq_20, seq_22 and seq_24 has lower antibody activity for stimulating the neutralizing capacity of mice when neutralizing pseudoviruses of the novel coronavirus Delta strain.

(2) The vaccine preparation prepared when the amino acid sequences of S proteins coded by the mRNA vaccine reading frames are shown as seq_14, seq_16, seq_18, seq_20, seq_22 and seq_24 can stimulate mice to generate neutralizing antibodies to pseudoviruses of two novel coronavirus Omicron variant strains of BA.1 and BA.2.

(3) In vaccine formulations prepared with mRNA vaccine reading frames encoding different S proteins (amino acid sequences shown as seq_14, seq_16, seq_18, seq_20, seq_22 and seq_24), mRNA vaccines encoding the S protein of amino acid sequences such as seq_14 (encoding the S protein of the novel coronavirus Omicron BA.2 strain) were able to stimulate the production of neutralizing antibodies to both BA.1 and BA.2 novel coronavirus Omicron variant pseudoviruses in mice.

Example 4

This example designed a series of mRNA sequences based on the unique mutant sequences of the S protein reading frame of the novel coronavirus Omicron strain and the mutations SN and SM that promote precursor stability mentioned in other patents and literature, wherein the reading frame information is shown in Table 3 below.

In addition to the reading frames of Table 3, the series of mRNA sequence features also include a 5 'cap, a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2), and the 3' tail of 100 polyAs (as shown in seq_3).

TABLE 3 mRNA sequence design and relative expression level

In table 3:

SN is mutated to have two proline residue substitutions at positions 983 and 984 of the amino acid sequence seq_14 of the full-length S protein;

SM mutations are full-length SARS-CoV-2 proteins with substitution of proline residues at positions 813, 889, 886, 939, 983 and 984 of the amino acid sequence seq_14 of the full-length S protein;

SL mutations in the amino acid sequence of the full-length S protein in SEQ_14 at positions 682, 683, 684, 685 RRAR mutations to GSGG full-length SARS-CoV-2 protein.

The mRNA shown in Table 3 was transfected into cells, and the expression of the S full-length protein in the cells was examined, and the results are shown in Table 3. The detailed method is as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed, and the target protein was specifically detected by SDS-PAGE immunoblotting at a loading of 10. Mu.g of total protein, and in this example, incubation was performed using an anti-SARS-S1 protein antibody as primary antibody and a goat anti-mouse-HRP antibody as secondary antibody, respectively, followed by color development. When the protein expression amount detection result is analyzed, the internal reference beta-actin is used for standardization and quantification, meanwhile, cells which are not transfected with mRNA are set as negative controls, and the difference of the expressed protein amount of transfected cells of different mRNA is compared. The detection results show that the expression of the whole S protein and the S1 subunit can be detected. The expression levels of the respective sequences were measured in terms of relative OD values as shown in Table 3; the method for calculating the relative OD value comprises the following steps: (sample OD value-negative control mean)/(OD value of sample 1-negative control mean).

From the above table it can be seen that:

(1) S protein in transfected cells of mRNA designed by 4 different sequences is expressed.

(2) After cells were transfected with sample 3 having SM mutation and sample 4 having SL mutation, the S protein content was lower in the same case than in the other mRNA transfected samples, indicating that SM mutation and SL mutation would result in a decrease in S protein expression.

(3) After the cell is transfected by the sample 2 with the SN mutation, the S protein content under the same condition is higher than that of the sample 1 without the SN mutation, which indicates that the SN mutation brings about remarkable improvement of the S protein expression in the experiment of the transfected cell. Thus the corresponding amino acid sequence seq_26, corresponding mRNA sequence seq_27 of SN mutated sample 2 is more suitable as potential vaccine selection than other samples.

The inventors also combine other published reports to mutate other sites of the seq_5, such as G614S, and design corresponding mRNA sequences based on the sequence of the seq_15, detect protein expression immunoblotting results after mRNA transfection cells, and find that the mutations and optimization of the corresponding mRNA sequences can lead to reduction of expression compared with the sequence of the seq_27mRNA and the sequence of the seq_15 mRNA.

With reference to the optimization of the full-length S protein mRNA of SARS-COV-2 and the Seq_17mRNA and the Seq_19mRNA disclosed in WOUS21032609, GB2002166, WOUS21016979, etc., the results of immunoblotting of protein expression after mRNA transfection cells are examined, and it is found that these mutations and optimization of the corresponding mRNA sequences result in a decrease in the expression level compared to the Seq_15mRNA sequences and the Seq_17mRNA sequences.

Example 5

Optimization of mRNA sequence encoding ba.2 child variant strain S protein:

in this example, a series of mRNA sequences were designed based on the novel coronavirus Omacron strain S protein (amino acid sequence shown as seq_26) and mRNA sequence optimization principle, wherein the reading frame information is shown in the following Table 4, the GC content is shown in FIG. 3 to FIG. 7, and the abscissa of FIG. 3 to FIG. 7 is the local GC% content.

In addition to the reading frames of Table 4, the series of mRNA sequence features also include a 5 'cap, a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2), and the 3' tail of 100 polyAs (as shown in seq_3).

TABLE 4 mRNA sequence design and relative expression levels

"local GC% content" in Table 4: GC% content in the partial sequence was 60bp as window size from the 3 'end to the 5' end of the ORF.

The mRNA shown in Table 4 was transfected into cells, and the expression of the S full-length protein in the cells was examined, and the results are shown in Table 4. The detailed method is as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed, and the target protein was specifically detected by SDS-PAGE immunoblotting at a loading of 10. Mu.g of total protein, and in this example, incubation was performed using an anti-SARS-S1 protein antibody as primary antibody and a goat anti-mouse-HRP antibody as secondary antibody, respectively, followed by color development. When the protein expression amount detection result is analyzed, the internal reference beta-actin is used for standardization and quantification, meanwhile, cells which are not transfected with mRNA are set as negative controls, and the difference of the expressed protein amount of transfected cells of different mRNA is compared. The detection results show that the expression of the whole S protein and the S1 subunit can be detected. The expression levels of the respective sequences were measured in terms of relative OD values as shown in Table 4; the method for calculating the relative OD value comprises the following steps: sample OD/OD of sample 1.

As can be seen from table 4:

(1) S protein expression in transfected cells of mRNA designed by 4 different sequences is expressed.

(2) When the GC% content of the whole mRNA reading frame sequence is 54-60%, the relative expression amount of S protein is higher when the local GC% content is not less than 40% (see seq_27 and 32);

when the GC% content of the whole mRNA reading frame is less than 54%, the GC% content of the sequence part is not less than 40%, the relative expression amount of S protein is lower (see seq_33);

when the GC% content of the whole mRNA reading frame is higher than 60%, the GC% content of the sequence part is not lower than 40%, the relative expression amount of S protein is lower (see seq_34);

when the GC% content of the whole mRNA reading frame is 54-60%, the relative expression amount of S protein is lower when the GC% content of the sequence part is lower than 40% (see seq_35).

(3) When the GC% content of the whole mRNA reading frame sequence is 54-60%, the local GC% content is not less than 40%, and the S protein expression amount of the mRNA reading frame sequence is higher than that of the mRNA reading frame sequence seq_32, which is seq_27.

Example 6

Two different antigens of samples 1 and 2 in example 5 are respectively prepared into vaccines according to the method in example 1, different mRNA mixtures are respectively prepared into LNP preparations, the LNP preparations have encapsulation rates of more than 90% after detection, and the particle size is about 70nm. The two groups of vaccine formulations obtained were used in C57 mice immunization experiments, each mouse being injected 5 micrograms (in mRNA) via hind limb lateral thigh muscle, and two immunizations were performed after 7 days apart, each group of 3 mice. Mice were drawn 14 days after the first immunization and sent to third party laboratories for SARS-CoV-2 pseudovirus neutralization activity testing. Diluting mouse serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. The serum-corresponding group numbers and results are shown in fig. 8.

As can be seen from fig. 8: the nucleotide sequences of the mRNA vaccine reading frames are shown as seq_27 and seq_32, and the vaccine preparation prepared by the method can stimulate mice to generate antibodies with neutralizing capacity to pseudoviruses of five seed variants of new coronavirus Omikon variant, namely BA.1, BA.2, BA.2.12.1, BA.4 and BA.5 (remarked that the mutations of the seed variants of BA.4 and BA.5 of the new coronavirus Omikon variant on the S protein are the same as the mutations of the original strain).

When the GC% content of the total mRNA reading frame sequence is 54-60%, and the local GC% content is not lower than 40%, the mRNA vaccine preparation can stimulate mice to generate antibodies with neutralization capability on pseudoviruses of two Omicron variant strains of new coronaviruses BA.1 and BA.2, and the neutralization capability of the antibodies is slightly lower than that of the vaccine preparation prepared by the methods shown in Seq ID No.27 and Seq ID No. 32; however, since the expression level of mRNA sequence Seq ID No.27 is high, the neutralizing ability of the antibody produced by the mRNA vaccine preparation prepared from mRNA sequence Seq ID No.27 is optimal.

Example 7

The present example provides a series of novel coronavirus bivalent vaccines, prepared as follows:

the novel coronavirus bivalent vaccine provided in this example comprises lipid nanoparticles encoding RNA of antigen 1 and antigen 2, wherein the lipid nanoparticles comprise 50% of Dlin-MC3-DMA, 10% of DOPG, 38.5% of cholesterol and 1.5% of PEG-DMG in mole percent.

The preparation method comprises the following steps:

(a) Dissolving RNA encoding different antigens in citrate buffer solution with pH of 4, and adjusting the concentration to 0.1mg/ml to obtain water phase; the sequences and mixing ratios of RNAs encoding different antigens are shown in Table 5;

(c) Mixing the aqueous phase of step (a) and the organic phase of step (b) at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12mL/min, immediately diluting the mixture 100-fold with a PBS solution at ph7.4, removing the ethanol component from the solution using Tangential Flow Filtration (TFF), and concentrating to a mRNA concentration of 0.55mg/mL in the system to obtain lipid nanoparticles comprising RNAs encoding antigen 1 and antigen 2.

The mRNA sequence encoding antigen 1 and the mRNA sequence encoding antigen 2 were mixed according to Table 5, wherein the reading frame information is shown in Table 5, and the series of mRNA sequence features include, in addition to the reading frames in the tables, a 5 'cap, a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2), and the 3' tails of 100 polyAs (as shown in seq_3). M1 and M2 are the mRNA quality encoding antigen 1 and the mRNA quality encoding antigen 2, respectively, including the 5 'cap, 5' UTR, reading frame, 3'UTR and 3' tail.

TABLE 5

The 22 samples prepared above were used in C57 mouse immunization experiments, each mouse being injected 5 micrograms (in mRNA) via hind limb lateral thigh muscle, and two immunizations were performed after 7 days apart, with 3 mice per group. Mice were drawn 14 days after the first immunization and sent to third party laboratories for SARS-CoV-2 pseudovirus neutralization activity testing. Diluting mouse serum according to different proportions (initial dilution multiple is 30) in a 96-well plate, adding SARS-CoV-2 pseudovirus which can be infected, setting cell contrast and virus contrast, incubating for 1 hour, adding cells prepared in advance, culturing for 20-28 hours in a cell incubator, absorbing a part of supernatant, adding a luciferase detection reagent, repeatedly blowing and sucking cells in the well after light-shielding reaction at room temperature, and placing the cells in a chemiluminescent detector for reading a luminous value after the cells are fully lysed. And on the premise of ensuring that the virus control and the cell control are established, calculating an EC50 value by adopting a Reed-Muench method. The serum-corresponding group numbers and results are shown in fig. 9 and 10.

Samples 1-11 are S protein mRNA lipid nanoparticle vaccines encoding the novel coronavirus Omicron BA.2 variant and encoding the novel coronavirus Delta variant, respectively. Samples 1-11 are the bivalent mRNA vaccine of the novel coronavirus respectively.

The neutralizing activity of antibodies produced by the tested vaccines was considered to be better when the EC50 value of the pseudovirus strain was not less than 200. The bar graph in FIG. 9 shows the pseudovirus strain EC50 values for samples 1-11; dashed lines are indicator lines indicating positions where the EC50 value of the pseudovirus strain is 200. As can be seen from fig. 9:

(1) The novel coronavirus bivalent mRNA vaccine prepared by the samples 3-9 stimulates mice to generate better neutralizing activity on antibodies of epidemic novel coronavirus Delta variant, novel coronavirus Omicron BA.1 variant and novel coronavirus Omicron BA.2 variant, and the EC50 value of pseudovirus strain of the three strains is higher than 200.

(2) With the decrease of the S protein mRNA proportion of the encoding new coronavirus Omicron BA.2 variant strain and the increase of the S protein mRNA proportion of the encoding new coronavirus Delta variant strain in the sample, the bivalent mRNA vaccine of the new coronavirus prepared by the samples 1-2 stimulates mice to generate low neutralizing activity (< 200) on the epidemic antibodies of the new coronavirus Omicron BA.1 variant strain and the new coronavirus Omicron BA.2 variant strain and high neutralizing activity on the antibodies of the new coronavirus Delta variant strain;

(3) With the decrease in the proportion of S protein mRNA encoding the novel coronavirus Delta variant and the increase in the proportion of S protein mRNA encoding the novel coronavirus Omicron BA.2 variant in the samples, the novel coronavirus bivalent mRNA vaccines prepared in samples 10-11 stimulate mice to produce antibodies with low neutralizing activity (< 200) against the epidemic novel coronavirus Delta variant and high neutralizing activity against the novel coronavirus Omicron BA.1 variant and the novel coronavirus Omicron BA.2 variant.

In summary, when M1: when M2 is (1:9) - (9:1) (samples 3-9), the neutralizing activity of antibodies raised by the novel coronavirus bivalent mRNA vaccine against the epidemic novel coronavirus Delta variant, novel coronavirus Omicron BA.1 variant and novel coronavirus Omicron BA.2 variant is better. Wherein M1: when M2 is (1:1) to (9:1) (samples 6 to 9), the neutralizing activity of the antibody is more excellent.

And samples 12-22 are S protein mRNA lipid nanoparticle vaccines for encoding a novel coronavirus Omicron BA.1 variant and encoding a novel coronavirus Delta variant, and are novel coronavirus bivalent mRNA vaccines. As can be seen from fig. 10:

(1) The novel coronavirus bivalent mRNA vaccine prepared by the samples 14-20 can stimulate mice to generate antibodies with neutralizing activity on epidemic novel coronavirus Delta variant, novel coronavirus Omicron BA.1 variant and novel coronavirus Omicron BA.2 variant.

(2) With the decrease in the proportion of S protein mRNA encoding the novel coronavirus Omicron BA.1 variant and the increase in the proportion of S protein mRNA encoding the novel coronavirus Delta variant in the samples, the novel coronavirus bivalent mRNA vaccines prepared from samples 12-13 stimulate mice to produce antibodies with low neutralizing activity (< 200) against the epidemic novel coronavirus Omicron BA.1 variant and the novel coronavirus Omicron BA.2 variant and high neutralizing activity against the antibodies of the novel coronavirus Delta variant.

(3) With the decrease in the proportion of S protein mRNA encoding the novel coronavirus Delta variant and the increase in the proportion of S protein mRNA encoding the novel coronavirus Omicron BA.1 variant in the samples, the novel coronavirus bivalent mRNA vaccines prepared from samples 21-22 stimulate mice to generate antibodies with low neutralizing activity (< 200) against the epidemic novel coronavirus Omicron BA.1 variant and the novel coronavirus Delta variant and high neutralizing activity against the antibodies of the novel coronavirus Omicron BA.2 variant.

In summary, when M1: when M2 is (1:9) - (9:1) (samples 14-20), the neutralizing activity of antibodies produced by the novel coronavirus bivalent mRNA vaccine-stimulated mice on epidemic novel coronavirus Delta variants, novel coronavirus Omicron BA.1 variants and novel coronavirus Omicron BA.2 variants is better; wherein M1: when M2 is (1:1) to (9:1) (samples 17 to 20), the neutralizing activity of the antibody is more excellent.

(III) within each experimental group, samples of a novel coronavirus bivalent mRNA vaccine, including samples 6-9 and samples 17-20, with better neutralizing activity against the epidemic novel coronavirus Delta variant, novel coronavirus Omicron BA.1 variant and novel coronavirus Omicron BA.2 variant, were selected, and the results of the cross-comparison experiments are shown in FIG. 11.

Sample 7 (m1:m2=3:1) and sample 18 (m1:m2=3:1) stimulated mice to produce antibodies with better neutralizing activity against the circulating novel coronavirus Delta variant, novel coronavirus Omicron ba.1 variant and novel coronavirus Omicron ba.2 variant; whereas sample 7 produced antibodies with respect to each mutant with a neutralizing activity superior to that of sample 18, mRNA encoding the S protein of the novel coronavirus Omicron BA.2 variant was more advantageous in preparing a novel coronavirus bivalent mRNA vaccine than mRNA encoding the S protein of the novel coronavirus Omicron BA.1 variant.

Example 8

(a) mRNA (seq_27) lipid nanoparticle sample 2.1 encoding the S protein of the novel coronavirus Omicron BA.2 variant was prepared as in example 1.

(b) mRNA (seq_9) lipid nanoparticle sample 2.2 encoding the novel coronavirus Delta variant S protein was prepared as in example 1;

(c) Samples 2.1 and 2.2 were mixed in 11 ratios in total according to the settings (1:15) - (15:1) of example 7 to prepare new coronavirus bivalent mRNA vaccine samples 2-1 to 2-11.

The mRNA sequence features described above also include a 5 'cap, a 5' UTR (as shown in seq_1), a 3'UTR (as shown in seq_2), and the 3' tail of 100 polyAs (as shown in seq_3).

The EC50 values of the pseudovirus strains of the novel coronavirus bivalent mRNA vaccine samples 2-1 to 2-11 prepared in this example were tested according to the method of example 7, and the experimental results are shown in fig. 12.

Example 9

(a) An mRNA (seq_17) lipid nanoparticle sample 3.1 encoding the novel coronavirus omacron ba.1 variant S protein was prepared as in example 1.

(b) mRNA (seq_9) lipid nanoparticle sample 3.2 encoding the novel coronavirus Delta variant S protein was prepared as in example 1;

(c) Samples 3.1 and 3.2 were mixed in 11 ratios in total according to the settings (1:15) - (15:1) of example 7 to prepare new coronavirus bivalent mRNA vaccine samples 2-12-2-22.

The EC50 values of the pseudovirus strains of the novel coronavirus bivalent mRNA vaccine samples 2-12 to 2-22 prepared in this example were tested according to the method of example 7, and the experimental results are shown in fig. 13.

Example 10

M1 was prepared as described in example 7: 2 parts of novel coronavirus vaccine lipid nanoparticle with an M2 ratio of 3:1, the 2 parts of novel coronavirus vaccine lipid nanoparticle respectively comprising 1) mRNA encoding the novel coronavirus Delta variant S protein (seq_9) and mRNA encoding the novel coronavirus Omicron BA.2 variant S protein (seq_27), designated as sample a; 2) mRNA encoding the S protein of the novel coronavirus Delta variant (seq_9) and mRNA encoding the S protein of the novel coronavirus Omicron BA.1 variant (seq_17) were recorded as sample b.

M1 was prepared as described in example 8: novel coronavirus vaccine lipid nanoparticle with M2 ratio of 3:1 was designated sample c.

M1 was prepared as described in example 9: novel coronavirus vaccine lipid nanoparticle with M2 ratio of 1:1 was designated as sample d.

The EC50 values of the pseudovirus strains of the novel coronavirus bivalent mRNA vaccine samples a, b, c and d prepared in this example were tested according to the method of example 7, and the experimental results are shown in fig. 14.

Example 11

The RNA molecules in the novel coronavirus vaccine provided in this embodiment are of a fusion RNA structure, and the specific structure is as follows:

5 'hat-5' UTR- (first coding region-linker sequence) n- (linker sequence-second coding region) m-3 'UTR-3' polyA tail; n=3, m=1;

wherein the nucleotide sequence of the first coding region is shown as seq_9; the nucleotide sequence of the second coding region is shown as seq_27;

the 5' cap is m7G (5 ') (2 ' -OMeA) pG; the 5' UTR is shown as seq_1; 3' UTR is shown as seq_2; the 3' tail of 100 polyas is shown as seq_3;

linker sequences are shown as seq_45.

LNP was prepared by the preparation method provided in example 1, and the test results of the EC50 values of pseudovirus strains of 2.3-1 to 2.3-11 of the novel coronavirus bivalent mRNA vaccine samples prepared in this example were tested by the method of example 7, and are shown in FIG. 15.

Example 12

This example provides a series of novel coronavirus bivalent vaccines prepared as described in example 8, wherein the mRNA reading frame sequence encoding the novel coronavirus omacron ba.2 variant S protein and the mRNA reading frame sequence encoding the novel coronavirus Delta variant S protein, and M1: the M2 values are shown in the following table:

TABLE 6

The EC50 values of the pseudovirus strains of the novel coronavirus bivalent mRNA vaccine samples 2-1 to 2-11 prepared in this example were tested according to the method of example 7, and the experimental results are shown in fig. 16.

Example 13

TABLE 7

The EC50 values of the pseudovirus strains of the novel coronavirus bivalent mRNA vaccine samples 2-1 to 2-11 prepared in this example were tested according to the method of example 7, and the experimental results are shown in fig. 17.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

Claims

1. A novel coronavirus vaccine, characterized in that the novel coronavirus vaccine comprises a nucleic acid molecule comprising a first reading frame and comprising a second reading frame;

2. The novel coronavirus vaccine of claim 1, wherein the novel coronavirus vaccine comprises: a nucleic acid molecule comprising a first open reading frame; and, a nucleic acid molecule comprising a second open reading frame;

3. The novel coronavirus vaccine of claim 1, wherein the novel coronavirus Delta variant S protein has an amino acid sequence as shown in seq_8;

4. The novel coronavirus vaccine of claim 1, wherein the nucleic acid molecule is RNA;

preferably, the RNA comprises, in order from the 5 'end to the 3' end: 5 'cap-5' utr-first open reading frame and/or second open reading frame-3 'utr-3' polya tail;

Preferably, the RNA contains a first open reading frame and a second open reading frame;

preferably, the RNA comprises, in order from the 5 'end to the 3' end: 5 'cap-5' utr-initiation region-first open reading frame-linker sequence-second open reading frame-3 'utr-termination region-3' polya tail;

preferably, the RNA comprises, in order from the 5 'end to the 3' end: 5 'hat-5' UTR- (first open reading frame-linker sequence) n- (linker sequence-second open reading frame) m-3'UTR-3' polyA tail;

n is the repetition number of the first coding region-linker sequence of the fragment; m is the repetition number of the segment linker sequence-second coding region; n and m are each independently a positive integer;

preferably, the 5' cap is: m7G (5 ') (2' -OMeA) pG;

preferably, the sequence of the 5' UTR is as shown in seq_1;

preferably, the sequence of the 3' UTR is as shown in seq_2;

preferably, the sequence of the 3' polyA tail is as shown in seq_3;

preferably, the linker sequence contains a protein cleavage signal;

preferably, the protein cleavage signal comprises a cleavage signal of at least one of a protein precursor converting enzyme, a hormone precursor converting enzyme, thrombin, a factor Xa protease;

preferably, the protein cleavage signal is a Furin cleavage site;

Preferably, the RNA nucleotide sequence of the Furin cleavage site is as shown in seq_7;

preferably, the linker sequence is a cleavable linker or a protease sensitive linker;

preferably, the cleavable linker comprises an F2A linker, a P2A linker, a T2A cleavage linker or an E2A cleavage linker.

5. The novel coronavirus vaccine of claim 4, wherein the nucleotide sequence of the first open reading frame is represented by seq_9, seq_47, seq_48, seq_49, seq_50, seq_51, seq_52, seq_53, or seq_54;

6. The novel coronavirus vaccine of any one of claims 1-5, wherein the mass ratio of nucleic acid molecules encoding the first open reading frame to nucleic acid molecules encoding the second open reading frame is (1:9) - (9:1), preferably (1:1) - (9:1), more preferably 3:1;

7. The novel coronavirus vaccine of any one of claims 1-5, further comprising a delivery formulation;

preferably, the novel coronavirus vaccine is selected from (a), (b) or (c):

(c) The novel coronavirus vaccine comprises: nucleic acid lipid nanoparticles encapsulated with a fused nucleic acid molecule comprising both a first open reading frame and a second open reading frame;

preferably, the nucleic acid molecule is a fusion nucleic acid molecule, and the number of repetitions of the first open reading frame and the second open reading frame in the fusion nucleic acid molecule is (1:9) - (9:1); preferably (1:1) to (9:1), more preferably 3:1;

preferably, the lipid component comprises 20 to 50% of a protonatable cationic lipid, 20 to 50% of a structural lipid, 5 to 20% of a helper lipid, and 1 to 5% of a surfactant, in mole percent, wherein the molar content of the protonatable cationic lipid, the structural lipid, the helper lipid, and the surfactant add up to 100%;

preferably, the protonatable cationic lipid comprises at least one of dlimc 3-DMA, DODMA, C-200 and DlinDMA;

preferably, the helper lipid comprises at least one of DSPC, DOPE, DOPC, DOPG and DOPS;

preferably, the structural lipid comprises cholesterol and/or cholesterol derivatives;

preferably, the surfactant comprises at least one of PEG-DMG, PEG-DSPE and TPGS;

Preferably, the lipid component comprises Dlin-MC3-DMA 50%, DOPG 10%, cholesterol 38.5% and PEG-DMG 1.5% in mole percent;

preferably, the lipid component comprises Dlin-MC3-DMA 50%, DOPG 20%, cholesterol 29% and PEG-DMG 1% in mole percent;

preferably, the nucleic acid lipid nanoparticle is prepared according to the following method:

uniformly mixing an aqueous phase containing nucleic acid molecules and an organic phase containing the lipid component to obtain a mixed solution, and removing the organic phase to ensure that the concentration of the nucleic acid molecules in the system is 1-100 mug/ml to obtain the nucleic acid lipid nanoparticle;

the aqueous phase is an aqueous phase buffer solution containing 0.08-1.2 mg/L nucleic acid molecules, and the aqueous phase buffer solution is a citrate buffer solution or a sodium acetate buffer solution;

the organic phase is anhydrous C1-C4 low-carbon alcohol containing 5-7 mg/L of the lipid component;

the volume ratio of the aqueous phase to the organic phase is 1:2-4.

8. A method of preparing a novel coronavirus vaccine according to any one of claims 1 to 7, comprising mixing said nucleic acid molecule with optionally an adjuvant to obtain said novel coronavirus vaccine;

or, preparing nucleic acid lipid nanoparticles coated with nucleic acid molecules containing both the first open reading frame and the second open reading frame;

uniformly mixing an aqueous phase containing nucleic acid molecules and an organic phase containing lipid components to obtain a mixed solution, and removing the organic phase to ensure that the concentration of RNA in a system is 1-100 mug/ml to obtain the nucleic acid lipid nanoparticle;

The volume ratio of the aqueous phase to the organic phase is 1:2-4.

9. Use of a novel coronavirus vaccine according to any one of claims 1 to 7, or a method of preparation according to claim 8, for the preparation of a product for the prevention or treatment of a disease caused by a novel coronavirus.

10. A product for the prevention or treatment of a novel coronavirus-induced disease comprising a novel coronavirus vaccine according to any one of claims 1-7.