CN116616171A - Method for screening two-line hybrid wheat seed production parents with stable flowering period - Google Patents
Method for screening two-line hybrid wheat seed production parents with stable flowering period Download PDFInfo
- Publication number
- CN116616171A CN116616171A CN202211740695.8A CN202211740695A CN116616171A CN 116616171 A CN116616171 A CN 116616171A CN 202211740695 A CN202211740695 A CN 202211740695A CN 116616171 A CN116616171 A CN 116616171A
- Authority
- CN
- China
- Prior art keywords
- flowering
- primer
- wheat
- line
- stable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 title claims abstract description 174
- 241000209140 Triticum Species 0.000 title claims abstract description 97
- 235000021307 Triticum Nutrition 0.000 title claims abstract description 97
- 238000004519 manufacturing process Methods 0.000 title claims abstract description 45
- 238000000034 method Methods 0.000 title claims abstract description 30
- 238000012216 screening Methods 0.000 title claims abstract description 17
- 239000000463 material Substances 0.000 claims description 61
- 238000009331 sowing Methods 0.000 claims description 40
- 108090000623 proteins and genes Proteins 0.000 claims description 17
- 238000007619 statistical method Methods 0.000 claims description 5
- 238000004364 calculation method Methods 0.000 claims description 4
- 239000003550 marker Substances 0.000 claims 1
- 238000012360 testing method Methods 0.000 description 17
- 238000009395 breeding Methods 0.000 description 11
- 230000001488 breeding effect Effects 0.000 description 11
- 238000001514 detection method Methods 0.000 description 10
- 239000003147 molecular marker Substances 0.000 description 8
- 108020004414 DNA Proteins 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 6
- 108700028369 Alleles Proteins 0.000 description 5
- 241000196324 Embryophyta Species 0.000 description 4
- 238000012408 PCR amplification Methods 0.000 description 4
- 238000010835 comparative analysis Methods 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 238000003205 genotyping method Methods 0.000 description 3
- 230000006641 stabilisation Effects 0.000 description 3
- 238000011105 stabilization Methods 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 244000208060 Lawsonia inermis Species 0.000 description 2
- 235000013339 cereals Nutrition 0.000 description 2
- 238000005520 cutting process Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000009826 distribution Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 230000035558 fertility Effects 0.000 description 2
- 208000019849 gnathodiaphyseal dysplasia Diseases 0.000 description 2
- 230000036512 infertility Effects 0.000 description 2
- 238000011835 investigation Methods 0.000 description 2
- 239000010977 jade Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 208000035240 Disease Resistance Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000009825 accumulation Methods 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 230000004075 alteration Effects 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000002860 competitive effect Effects 0.000 description 1
- 230000001186 cumulative effect Effects 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 238000009401 outcrossing Methods 0.000 description 1
- 230000006798 recombination Effects 0.000 description 1
- 238000005215 recombination Methods 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000000087 stabilizing effect Effects 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application belongs to the field of molecular biology, and in particular relates to a method for screening two-line hybrid wheat seed production parents with stable flowering phase. The method can select seed production combinations meeting in the flowering phase, takes the genotypes of the seed production combinations as markers, and can be used for improving the stable wheat in the flowering phase. And selecting a combination of a sterile line and a restorer line, which are sown between two years until flowering and growth days are stable, wherein the growth days reach a significant level, and taking the combination of the genotypes as a seed production combination parent with stable flowering. The method can be used for efficiently identifying and screening the wheat with stable flowering phase.
Description
Technical Field
The application belongs to the field of molecular biology, and in particular relates to a method for screening two-line hybrid wheat seed production parents with stable flowering phase.
Background
Hybrid wheat has the potential to greatly increase wheat yield. The two-line hybrid wheat is bred by a 'two-line method' breeding system of photo-thermo-sensitive sterile line and restoring line, and the two-line hybrid wheat variety is created to be superior to parent or control variety hybrid wheat variety in terms of yield, stress resistance and other characters. However, hybrid wheat tends to suffer from low seed production yield and instability. The development process of the two-line hybrid wheat parent is inconsistent, the inter-year seed production combination flowering period is not met, the two-line hybrid wheat parent is one of main factors which lead to low seed production yield and instability, and the two-line hybrid wheat parent brings great risk to the production of hybrid wheat seeds, so that the problem to be overcome is urgent in the development of the hybrid wheat industry. The stable wheat in the flowering period is identified and screened for seed production, which is one of the most economical and effective measures for solving the problem of the combination flowering period of seed production, stabilizing and improving the seed production yield of the two-line hybrid wheat and ensuring the environment safety. In addition, this also helps to reduce the risk of hybrid wheat seed production. A large number of researches show that photoperiod genes and vernalization genes are key genes for determining the flowering period of wheat, but the flowering periods of wheat with different genotypes are different due to the effect of external light and temperature conditions.
The calendar day from sowing to flowering is a conventional metering index of the flowering period of wheat. The time-space difference can cause the difference of temperature and light time in the development process of the wheat, and the flowering period of the wheat identified by the index is large in variation amplitude and unstable due to the time-space difference, and is often in a combined flowering period of seed production in the two-line hybrid wheat parent.
In recent years, molecular markers based on DNA sequence polymorphism are highly valued by breeders at home and abroad. The KASP technique (i.e., competitive allele-specific PCR) is one of the currently internationally mainstream genotyping methods, and makes accurate bi-allele determination of SNP and InDel at a specific site based on specific matching of primer terminal bases.
The molecular marker assisted selection breeding strategy, namely the technique of breeding varieties assisted by functional markers of target characters, is well established. Wherein KASP markers based on wheat disease resistance, quality and other genes have been applied to molecular marker assisted variety breeding. The KASP molecular markers of the flowering phase related vernalization gene and the photoperiod gene have been developed in 2016, and the conventional identification technology of the phenotype of wheat in the flowering phase is also mature, but the combined technical scheme of the two is not capable of screening wheat with stable flowering phase, so that no application report of meeting the wheat with stable flowering phase in the hybrid wheat seed production flowering phase exists so far.
Disclosure of Invention
The application aims to provide a method for screening two-line hybrid wheat seed production parents with stable flowering phase, which utilizes the growth degree day of the wheat flowering phase as a new identification index and combines with a molecular marking technology related to the flowering phase so as to solve the problem of seed production risk of the hybrid wheat parents caused by flowering phase incompatibility.
The method for screening the two-line hybrid wheat seed production parents with stable flowering phase comprises the following steps:
(1) For the sterile line and restorer line materials to be tested, grouping the sterile line materials with the same genotype into the same group according to the genotypes of the wheat vernalization gene Vrn-1 and the photoperiod gene Ppd-1, and grouping the restorer line materials with the same genotype into the same group;
(2) Determining the growth degree daily value of each sterile line material and restorer line material with the same genotype, wherein the growth degree daily value is the temperature of the sowing to flowering, and the calculation formula is as follows:
wherein TD, H, S and T i Respectively represent the time from sowing to flowering, the date of flowering, the sowing date and the average temperature of the day, wherein the average temperature of the day T i ＝(T max +T min ) 2, when T i ＜T b At the time T i =0, where T max 、T min And T b Respectively representing the basal temperature from day maximum temperature to day minimum temperature to sowing to flowering of wheat;
(3) Combining sterile line and restorer line materials according to genotypes;
(4) Calculating the average value of the growth degree days of all sterile line materials and the average value of the growth degree days of all restorer line materials in each genotype combination, carrying out statistical analysis by combining the growth degree days of each sterile line material and restorer line material, and selecting genotype combinations with obvious differences;
(5) And (3) further selecting genotype combinations with stable growth degrees of sterile lines and restorer lines among different years for the genotype combinations selected in the step (4), and selecting sterile line materials and restorer line materials with the combined genotypes as two-line hybrid wheat seed production parents with stable flowering phase.
The method for screening two-line hybrid wheat seed parents with stable flowering phase according to the application, wherein the sequence of the KASP-labeled primer of the wheat vernalization gene Vrn-1 is as follows:
FAM primer: 5 'AGAGTTTTCCAAAAAGATCATAATGATGTAAAT 3',
HEX primer: 5 'GAGTTTTCCAAAAGATAGATAGATAATGTAAAC3',
universal primer: 5 'GTTAGTGAGTGATTGGTCCAATAATGGCCAAA 3';
the sequence of the KASP-labeled primer of the photoperiod gene Ppd-1 is shown below:
FAM primer: 5 'CAACTCCTTGAGATATAGAATTAGATTCAAG3',
HEX primer: 5 'GCAACTCTTGAGATTCAAAGATTCAAATTAAA3',
universal primer: 5 'CATCCTGGCATCTGGCATCTC 3';
FAM primer: 5'GTTTTGGCCTGGCCATCCTCC3',
HEX primer: 5'GTTTTGGCCTGGCCATCCTCA3',
universal primer: 5 'TATCAGGGTGGTTGGGTGAGGACGT3';
FAM primer: 5'GAGTTTGATCTTGCTGCGCCG3',
HEX primer: 5'CTGAGTTTGATCTTGCTGCGCCA3',
universal primer: 5 'CTTCCCACGCTCGGGGAGAAA3';
FAM primer: 5'CCGTTTTCGCGGCCTT3',
HEX primer: 5'GACGTTATGAACGCTTGGCA3',
universal primer: 5'GGGTTCGTCGGGAGCTGT3'.
The beneficial technical effects of the application are as follows:
1. for hybrid wheat breeding and industrial application fields, although flowering phase meeting has important significance in reducing seed production risk and improving seed production yield in large-area seed production, more people focus on outcrossing fruiting characteristics such as: anther size, exposed stigma, glume opening angle, etc. In addition, the inventors found that with conventional calendar days as an index for identifying the flowering phase of wheat, the flowering phases of different annual and regional seed production combinations are greatly different and unstable due to the influence of space and time. Therefore, even in combination with a breeding strategy of molecular marker-assisted selection, wheat with stable flowering phase cannot be selected, and thus there has been no report on a technical scheme of combining conventional breeding with a breeding system of molecular marker-assisted selection to select wheat with stable flowering phase.
2. According to the method, the growth day from wheat sowing to flowering is used as an index of the wheat flowering period, and the conventional index of the wheat flowering period, namely the calendar day from wheat sowing to flowering, is replaced. The index identifies the wheat with more stable and accurate flowering phase, and can better screen the wheat with stable flowering phase. According to the technical scheme, a metering formula of the flowering growth day of wheat sowing is optimized, and the growth day is taken as a flowering phase phenotype. On the basis, the method combines with the genotypes related to the existing flowering period of wheat, utilizes molecular markers to assist in screening out wheat with stable flowering period, carries out the comparative analysis on the meeting time of wheat parent combination in the flowering period, screens out the wheat with stable meeting time in the flowering period as a seed production parent combination, and takes the genotypes of the combination as the selection markers of the seed production combination with stable meeting time in the flowering period. The technical scheme of using molecular markers and the identification index to perform systematic optimization and recombination is not seen yet, and the related complete set of technical method for solving the scientific problem of meeting the two-line hybrid wheat in the flowering phase so as to reduce the large-area seed production risk of the hybrid wheat is not seen yet.
3. According to the method, the photoperiod and vernalization genotype of the wheat are identified through modern molecular biology means, the growth degree day from wheat sowing to flowering is combined as an identification index of the phenotype of the wheat flowering, and the molecular marker is used for assisting in screening the wheat with stable flowering for seed production, so that the selection efficiency is improved. On the basis, the flowering phase meeting is regulated through the sowing period, so that technical support is provided for enlarging the production area of the hybrid wheat and reducing the risk of hybrid wheat seed production.
Drawings
FIG. 1 shows a graph of the results of detecting the genotyping of Ppd-B1, wherein the red dots are HEX alleles; blue dots are FAM genotypes; black dots are blank.
Detailed Description
The following examples are illustrative of the application and are not intended to limit the scope of the application. Modifications and substitutions to methods, procedures, or conditions of the present application without departing from the spirit and nature of the application are intended to be within the scope of the present application. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.
The term "growth-days" (GDDs) refers to the cumulative effective heat accumulation experienced by a plant in its actual environmental conditions to complete a certain stage of fertility, an index based on temperature, representing the heat accumulated in the plant's growing period, and the GDDs are directly related to the growth rate and the stage of fertility.
The "flowering phase encounter time" is the flowering phase encounter, i.e., the difference in time between the material with the earlier final flowering phase and the material with the later initial flowering phase. In the prior art, the index of the flowering period identification is the calendar day from sowing to flowering, and the technical scheme of the application uses the growth day from sowing to flowering as the index of the flowering period identification. It is well known that the flowering period of wheat identified by calendar day as an index is affected by weather temperature, sowing time or climate change, and the annual flowering period of wheat may change. However, in the application, the wheat identified by taking the growth day as an index has more stable flowering phase, is less influenced by temperature, has less sowing time or climate change, and has more stable growth day and smaller change amplitude.
In the present application, the flowering phase stabilization takes into account the influence of temperature and sowing time, for example: in the examples, the variation of the combined flowering phase of the same genotype under the treatment conditions of different sowing phases in 2018-2019 and 2019-2020 are studied.
In Table 4, "flowering phase encounter time" (i.e., "flowering phase difference") is in units of "delta calendar day, delta growth day".
Flowering phase stability: in the embodiment of the application, in order to screen the wheat with stable flowering period, the variation sizes of two identification indexes of the wheat flowering period, namely 'calendar day' and 'growth day', are compared between different years.
The difference of growth degree days of the sterile line and the restorer line under different sowing period treatment conditions is studied, and if the variation amplitude is smaller and the statistical analysis shows that the difference is obvious, the flowering period of the material with the gene identified by taking the growth degree days as an index is stable. Further, a combination having a small difference in growth day between years was selected from among combinations having good stability.
The term "flowering period" refers to "calendar day of sowing to flowering": when the inner and outer glumes of the upper florets in each row of inner half-snapping seeds are opened and anther is scattered, the flowering period is entered, and the days from sowing to flowering are taken as the flowering period.
In the following examples, the technical scheme is implemented:
the KASP labeled primers of the wheat vernalization gene Vrn-1 and the photoperiod gene Ppd-1 are designed, and the 5' ends of the FAM primer and the HEX primer respectively contain specific linkers, GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT, and can be combined with fluorescent labels for fluorescent detection. After the test material and the detection mark are amplified by PCR, the detection data are read by using SNP viewer 2.0 software developed by LGC company, and the fluorescence color corresponds to the genotype of the detection site. According to the genotypes of the materials to be tested, the sterile lines and the restorer lines of the materials to be tested are divided into different groups, and in order to avoid the interference of the genotype difference on the selection of the flowering period identification indexes, the sterile lines and the restorer lines with the same genotypes are selected as materials for the flowering period stability analysis.
Metering the flowering identification index of wheat sowing: the method for calculating the calendar day and the growth degree day of wheat sowing to flowering respectively takes the calendar day and the growth degree day of wheat sowing to flowering as indexes to measure the flowering period of the wheat, wherein the method for calculating the calendar day and the growth degree day of wheat sowing to flowering comprises the following steps:
calendar day calculation formula for sowing to flowering: hd=h-S, where HD, H, and S are respectively a calendar day of sowing to flowering, a flowering date, a sowing date, and a flowering date difference calculation formula: Δhd=hd S -HD R Wherein HD is an S And HD (HD) R Flowering dates of the sterile line and the restorer line respectively;
growth days from sowing to flowering:wherein TD, H, S and T i Respectively represent the time from sowing to flowering, the date of sowing and the average temperature of the day, wherein T i ＝(T max +T min ) 2, when T i ＜T b At the time T i =0, where T i 、T max 、T min And T b Respectively represents the basal temperature from the average temperature of the day, the highest temperature of the day, the lowest temperature of the day and the temperature of wheat sowing to flowering.
Screening parent combinations of flowering phase stability two-line hybrid wheat seed production: the sterile line and the restorer line with the same genotype are used as materials for flowering period stability analysis, the stability of the tested materials in different years from day to day of flowering calendar and day of growth is analyzed through saliency comparison, the time between two years is selected to be sowed to day of flowering growth to be stable, the sterile line and the restorer line are combined into materials on the basis, and the flowering period meeting time saliency comparison analysis and the stability comparison analysis are carried out on the sterile line and the restorer line meeting time (respectively taking day to day and day of growth as indexes).
Example 1
Test parent source: the tested sterile line adopts BS366 as a parent to select an excellent sterile line, and the proper-period sowing realizes more than 95% of sterility. Test restorer source: and a high-generation restorer line bred by taking white jade 149 as a male parent.
The sequences of 5 sets of primers, which are the most effective primers in the test materials, were designed as Vrn-A1_9K0001, vrn1_new, vrn-A1b-Marq, exon 7_C/T_VrnA1, taPpdBJ001, and 5 sets of primers are shown in Table 1 below. According to the primer design requirements of the KASP technology, the 5' ends of the FAM primer and the HEX primer respectively contain specific linkers, GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT, and can be combined with fluorescent labels for fluorescent detection.
Cutting leaves of experimental materials, extracting genomic DNA of wheat materials by using a plant genomic DNA extraction kit, wherein the genomic DNA to be tested is 10-30 ng/mu L. Ultraviolet spectrophotometer Nanodrop2000 detects that A260/A280 ratio is about 1.8, and A260/A230 ratio is greater than 1.8.
And taking genomic DNA of the wheat material to be tested as a template, and respectively adopting 5 groups of primers to carry out PCR amplification to obtain PCR amplification products. When the temperature of the PCR amplified product is reduced to below 40 ℃, the fluorescence value is read through scanning by using FAM and HEX light beams of an enzyme-labeled instrument, and the detection data is read by using SNP viewer 2.0 software developed by LGC company. The composition and distribution of the Vrn-A1 and Ppd-B1 alleles and genotypes in the sterile line and restorer line in the wheat materials used in the example were counted.
TABLE 1 detection of test materials KASP-labeled 5-group primers
In 2018 and 2019, 39 and 55 sterile lines were sown on days 10, 13 and 19, respectively, and 154 and 205 restorer lines were sown on days 10, 19 and 27, respectively. Each material was planted in 2 rows of 30 grains each, 1.5m rows long, and row spacing 25cm. The field test site was conducted at the industrial experimental base (32.68°n,112.08 °e) of hybrid wheat in henna, the academy of agriculture and forestry, beijing. The flowering period of the test materials was investigated and measured separately. And (5) sorting the investigation data. The experimental results of the detection are shown in FIG. 1, and the genotyping results are shown in Table 2.
TABLE 2 statistics of genotypes of test materials based on typing results
Note that: a: HEX allele, b: FAM allele type, -: heterozygous or null genotypes.
Under the two years of selection 2018-2019 and 2019-2020, the amplification results of the Vrn-A1 and Ppd-B1 molecular markers are counted as 8 genotypes numbered I, III, IV, V, VI, VII, VIII and XI respectively, and then the sterile line and the restorer line are respectively grouped according to genotypes. The stability of the test materials from sowing to flowering calendar day and growth day at flowering time between different years is analyzed by statistical significance comparison.
Table 3 shows the calendar day differences and the growth day differences of restorer and sterile line materials having the same genotype, for example, restorer and sterile line materials having the "I" group genotype, and statistical analysis was performed.
TABLE 3 comparative analysis of significance and stability of annual sowing to flowering of test materials
Table 4 shows the calendar day differences and the growth day differences of the restorer material and the sterile material for each genotype combination, and was statistically analyzed.
TABLE 4 comparative analysis of the significance and stability of the flowering phase encounter between seed production combination genotypes
TABLE 4 comparative analysis of the significance and stability of flowering phase encounters between seed production combination genotypes (Table II)
In tables 3 and 4, "×" indicates that the difference is significant, the probability P is less than 0.05, and "×" indicates that the difference is very significant, the probability P is less than 0.01, and "×" indicates that the significant probability P is less than 0.001.
As shown in table 3, the stability of the growth days from annual sowing to flowering and the calendar days from sowing to flowering were compared. Taking genotypes I, III and VI as examples, taking the growth degree days as indexes, wherein the delta growth degree days corresponding to the genotypes I, III and IV in 2018-2019 and 2019-2020 are 75.6 and 80.8 respectively; 35.4 and 29.5;56.2 and 41.5, only delta growth days of genotype I were marked with significant differences in flowering period over two years, while genotypes III and VI were not. Taking calendar days as indexes, and respectively setting delta calendar days corresponding to I, III and IV as 5.4 and 5.4 in 2018-2019 and 2019-2020; 2.8 and 1.9;4.1 and 3.0 days, wherein, in two years, only delta calendar day of genotype I is used as index, the flowering period difference is obvious, while in two years, the flowering period difference of genotype III is obvious in 2018-2019 delta calendar day, and in two years, the flowering period difference of genotype III and VI is not obvious in 2019-2020 delta calendar day. The difference between the growth day and the calendar day is represented by genotype III, and the flowering period with calendar day as the index is 2018-2019The difference between the tested materials is obvious and is 2.76 * But the difference between the test materials was not significant in 2019-2020, 1.88. The flowering period with calendar day as an indicator cannot determine whether the material is stable. However, for genotype III, the flowering period with growth day as an index was 35.4 and 29.5 for the two years of delta growth days, respectively, and the differences were not significant, so that it was possible to determine that the flowering period of the material of the genotype was unstable. The blooming period taking the growth day as an index can be obtained through judging and comparing the significance and the stability of the two indexes of the genotypes I, III and IV, and the significance of the genotype and the blooming period difference can be judged more than the blooming period taking the calendar day as an index, so that the stability of the blooming period can be judged.
Screening of combinations with flowering phase stabilization: based on the method, the sterile line and the restorer line to be tested are combined to be materials, and the flowering phase meeting time (respectively taking calendar day and growth day as indexes) of the sterile line and the restorer line are subjected to flowering phase meeting time saliency comparison analysis and stability comparison analysis. On the one hand, statistical significance comparison is carried out on the flowering time of the sterile line and the flowering time of the restorer line, in the embodiment, the flowering time difference between the sterile line and the restorer line is significant, namely, the flowering time of the sterile line and the flowering time of the restorer line are different, and the reliability of the flowering time is more than 95% in statistics, which is expressed by the sign, and indicates that the flowering time of the sterile line and the flowering time of the restorer line are significantly different in statistics. And secondly, judging stability, and selecting and comparing differences of the flowering time meeting time among the combinations between two years.
As shown in Table 4, for the seed production parent combinations III×I, VIII×I:
genotype aspect: the parental combinations III×I and VIII×I differ in genotype, and from Table 2 it is known that the III genotype is aa-aa, the I genotype is aaaaaa and the VIII genotype is baaaa.
Growth degree day index: the two combinations are stable on two annual growth days 2018-2019 and 2019-2020, the delta growth days of the sterile line and the restorer line are 52.27 ℃ d and 54.02 ℃ d and 2019-2020 respectively, the delta growth days of the sterile line and the restorer line are 74.44 ℃ d and 75.46 ℃ d, and the combinations are stable on two annual flowering phases with calendar days or growth days as indexes.
Flowering phase difference: the flowering phase difference of the two combinations reaches an extremely significant level, which shows that the flowering phase difference of the combination of the sterile line and the restorer line is stable in expression, and the time of the phase difference of the sterile line and the restorer line is credible, and the difference significant standard is that P is less than 0.05 and is significant, and P is less than 0.01 and is extremely significant.
The purpose of the significant statistical difference of the flowering phases in the selection is to select a stable combination of the flowering phases, and only the sterile line and the restorer line have significant flowering phase differences, which indicates that the flowering phases are credible from the statistical analysis. On the basis, the combination with smaller variation between two years is selected as the combination with stable flowering period by comparing the variation of the combined flowering period difference value between the two years.
The following two examples are combinations of flowering phase encounter time instability:
seed production combination I X IV combination:
genotype: as can be seen from Table 2, the genotype of parent I is aaaaa, the genotype of parent IV- - - -aa;
growth degree day: the method is characterized in that the growth degree day is taken as an index of the flowering phase meeting time, and the flowering phase meeting time of two years of 2018-2019 and 2019-2020 is described, wherein the growth degree days of two-year parent combination I multiplied by IV are 82.52 ℃ d and 49.83 ℃ d respectively;
flowering phase meeting time: the parent combination IxIV has extremely significant flowering phase meeting time (P < 0.01), but the parent combination IxIV has unstable flowering phase meeting time in two years, and the difference of the meeting time is 32.69 ℃.
Seed production combination IV multiplied by IV combination:
genotype: as can be seen from Table 2, the genotype of parent IV- -aa.
Growth degree day: the method is characterized in that the growth degree day is taken as an index of the flowering phase meeting time of two years 2018-2019 and 2019-2020, the two annual parent combinations IV multiplied by IV are respectively 50.38 ℃ d and 25.86 ℃ d, the difference of the flowering phase meeting time of the parent combinations IV multiplied by IV is not obvious (P is more than 0.05), meanwhile, the meeting time of the two annual flowering phases is unstable, and the difference of the meeting time of the two annual parent combinations IV multiplied by IV is 24.52 ℃. This indicates that the parent of the combination is unstable in flowering phase and the parent has a large variation in the time of meeting.
The conventional molecular marker assisted selection breeding strategy is combined with the calendar day index of the conventional wheat flowering period, and the wheat with stable flowering period cannot be screened, so that no technical scheme for screening the wheat with stable flowering period by combining conventional breeding with a molecular marker assisted selection breeding system has been reported. Wheat with stable flowering phase can be screened based on the wheat flowering phase with the growth degree day as an index by combining with the existing molecular marker.
The method can select seed production combinations meeting in the flowering phase, takes the genotypes of the seed production combinations as markers, and can be used for improving the stable wheat in the flowering phase. And selecting a combination of a sterile line and a restorer line, which are sown between two years until flowering and growth days are stable, wherein the growth days reach a significant level, and taking the genotype of the combination as a seed production combination parent with stable flowering. The method can be used for efficiently identifying and screening the wheat with stable flowering phase.
Example 2
Test parent source: the tested sterile line adopts BS366 as a parent to select an excellent sterile line, and the proper-period sowing realizes more than 95% of sterility. Test restorer source: and a high-generation restorer line bred by taking white jade 149 as a male parent.
The above 5 sets of primers were used, namely Vrn-A1_9K0001, vrn1_new, vrn-A1b-Marq, exon 7_C/T_VrnA1, taPpdBJ001, as shown in Table 1. According to the primer design requirements of the KASP technology, the 5' ends of the FAM primer and the HEX primer respectively contain specific linkers, GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT, and can be combined with fluorescent labels for fluorescent detection.
Cutting leaves of experimental materials, extracting genomic DNA of wheat materials by using a plant genomic DNA extraction kit, wherein the genomic DNA to be tested is 10-30 ng/mu L. Ultraviolet spectrophotometer Nanodrop2000 detects that A260/A280 ratio is about 1.8, and A260/A230 ratio is greater than 1.8.
And taking genomic DNA of the wheat material to be tested as a template, and respectively adopting 5 groups of primers to carry out PCR amplification to obtain PCR amplification products. When the temperature of the PCR amplified product is reduced to below 40 ℃, the fluorescence value is read through scanning by using FAM and HEX light beams of an enzyme-labeled instrument, and the detection data is read by using SNP viewer 2.0 software developed by LGC company. The composition and distribution of the Vrn-A1 and Ppd-B1 alleles and genotypes in the sterile line and restorer line in the wheat materials used in the example were counted.
In 2020, 4 sterile lines and 4 restorer lines were sown on 30 days of 10 months, respectively. Each material was planted in 2 rows of 30 grains each, 1.5m rows long, and row spacing 25cm. The field test site was conducted at the industrial experimental base (32.68°n,112.08 °e) of hybrid wheat in henna, the academy of agriculture and forestry, beijing. The flowering period of the test materials was investigated and measured separately. And (5) sorting the investigation data. The genotypes detected and the flowering phase growth days are shown in Table 5.
TABLE 5 genotype of test materials and meeting growth days of test combination flowering phase
Flowering phase instability combination: as shown in table 5, for the seed production parent combination 2"V x VIII",
the genotypes were different from each other in the V.times.VIII genotypes, and from Table 2, the V genotype was-aaaa, and the VIII genotype was baaaa.
The growth degree day index is that the delta growth degree days of the parental combination V multiplied by VIII in two years from 2018 to 2019 and 2019 to 2020 are respectively-27.08 ℃ d and 27.33, the delta growth degree days of the sterile line and the restorer in the years from 2020 to 2021 are 58 ℃, the meeting time of the combination is unstable compared with the last two years, and the combination genotype can be used as the selection basis of the combination with unstable flowering phase. This is consistent with the identification results in example 1.
Flowering phase stabilization combination: as shown in Table 5, for the seed production parent combination 3 "III X III",
genotype aspect: from Table 2, the III genotype was aa-aa.
Growth degree day index: the combination III x III is stable in two years of growth days from 2018 to 2019 and 2019 to 2020, and the delta growth days of the sterile line and the restorer line are 35.36 ℃ d and 29.50 ℃ d respectively from 2018 to 2019 and 2019 to 2020, and the delta growth days of the sterile line and the restorer line are 31.5 ℃ d from 2020 to 2021 respectively. The combination genotype was stable in flowering time compared to the last two years and could be used as a selection basis for the combination of flowering stability, consistent with the identification in 1.
Although embodiments of the present application have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made therein without departing from the principles and spirit of the application, the scope of which is defined in the appended claims and their equivalents.
Claims (2)
1. A method for screening a parent of a two-line hybrid wheat seed production with stable flowering phase, the method comprising the steps of:
(1) For the sterile line and restorer line materials to be tested, grouping the sterile line materials with the same genotype into the same group according to the genotypes of the wheat vernalization gene Vrn-1 and the photoperiod gene Ppd-1, and grouping the restorer line materials with the same genotype into the same group;
(2) Determining the growth degree daily value of each sterile line material and restorer line material with the same genotype, wherein the growth degree daily value is the temperature of the sowing to flowering, and the calculation formula is as follows:
wherein TD, H, S and T i Respectively represent the time from sowing to flowering, the date of flowering, the sowing date and the average temperature of the day, wherein the average temperature of the day T i ＝(T max +T min ) 2, when T i ＜T b At the time T i =0, where T max 、T min And T b Respectively representing the basal temperature from day maximum temperature to day minimum temperature to sowing to flowering of wheat;
(3) Combining sterile line and restorer line materials according to genotypes;
(4) Calculating the average value of the growth degree days of all sterile line materials and the average value of the growth degree days of all restorer line materials in each genotype combination, carrying out statistical analysis by combining the growth degree days of each sterile line material and restorer line material, and selecting genotype combinations with obvious statistical differences;
(5) And (3) further selecting genotype combinations with stable growth degrees of sterile lines and restorer lines among different years for the genotype combinations selected in the step (4), and selecting sterile line materials and restorer line materials with the combined genotypes as two-line hybrid wheat seed production parents with stable flowering phase.
2. The method for screening a flowering phase stable two-line hybrid wheat seed production parent according to claim 1, wherein the sequence of the KASP marker primer of the wheat vernalization gene Vrn-1 is as follows:
FAM primer: 5 'AGAGTTTTCCAAAAAGATCATAATGATGTAAAT 3',
HEX primer: 5 'GAGTTTTCCAAAAGATAGATAGATAATGTAAAC3',
universal primer: 5 'GTTAGTGAGTGATTGGTCCAATAATGGCCAAA 3';
the sequence of the KASP-labeled primer of the photoperiod gene Ppd-1 is shown below:
FAM primer: 5 'CAACTCCTTGAGATATAGAATTAGATTCAAG3',
HEX primer: 5 'GCAACTCTTGAGATTCAAAGATTCAAATTAAA3',
universal primer: 5 'CATCCTGGCATCTGGCATCTC 3';
FAM primer: 5'GTTTTGGCCTGGCCATCCTCC3',
HEX primer: 5'GTTTTGGCCTGGCCATCCTCA3',
universal primer: 5 'TATCAGGGTGGTTGGGTGAGGACGT3';
FAM primer: 5'GAGTTTGATCTTGCTGCGCCG3',
HEX primer: 5'CTGAGTTTGATCTTGCTGCGCCA3',
universal primer: 5 'CTTCCCACGCTCGGGGAGAAA3';
FAM primer: 5'CCGTTTTCGCGGCCTT3',
HEX primer: 5'GACGTTATGAACGCTTGGCA3', universal primer: 5'GGGTTCGTCGGGAGCTGT3'.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210835324 | 2022-07-15 | ||
| CN2022108353241 | 2022-07-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116616171A true CN116616171A (en) | 2023-08-22 |
Family
ID=87640517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211740695.8A Pending CN116616171A (en) | 2022-07-15 | 2022-12-30 | Method for screening two-line hybrid wheat seed production parents with stable flowering period |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116616171A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1353924A (en) * | 2001-12-25 | 2002-06-19 | 西北农林科技大学 | Production method for hybrid wheat seed |
| CN107980614A (en) * | 2017-12-08 | 2018-05-04 | 云南省农业科学院粮食作物研究所 | A kind of hybrid wheat flowering regulation producing method for seed |
| CN114496075A (en) * | 2022-02-21 | 2022-05-13 | 中国农业科学院农业环境与可持续发展研究所 | Construction method of winter wheat flowering phase simulation model based on multi-site genes |
-
2022
- 2022-12-30 CN CN202211740695.8A patent/CN116616171A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1353924A (en) * | 2001-12-25 | 2002-06-19 | 西北农林科技大学 | Production method for hybrid wheat seed |
| CN107980614A (en) * | 2017-12-08 | 2018-05-04 | 云南省农业科学院粮食作物研究所 | A kind of hybrid wheat flowering regulation producing method for seed |
| CN114496075A (en) * | 2022-02-21 | 2022-05-13 | 中国农业科学院农业环境与可持续发展研究所 | Construction method of winter wheat flowering phase simulation model based on multi-site genes |
Non-Patent Citations (3)
| Title |
|---|
| 徐博;王英哲;徐安凯;孙启忠;: "基于生长度日的紫花苜蓿生育期预测模型", 草业科学, no. 01, 15 January 2016 (2016-01-15) * |
| 施泽平, 郭世荣, 康云艳, 尹汉文, 高洁静, 徐刚, 张昌伟: "基于生长度日的温室甜瓜发育模拟模型的研究", 南京农业大学学报, no. 02, 30 April 2005 (2005-04-30) * |
| 陈现朝;张立平;秦志列;廖祥政;孙辉;张风廷;赵昌平;: "二系杂交小麦亲本光周期、春化和矮秆等位基因的组成和分布", 河北农业大学学报, no. 05, 15 September 2020 (2020-09-15) * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tian et al. | Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties | |
| Malysheva-Otto et al. | Analysis of molecular diversity, population structure and linkage disequilibrium in a worldwide survey of cultivated barley germplasm (Hordeum vulgare L.) | |
| Baltazar et al. | QTL mapping for tolerance to anaerobic germination in rice from IR64 and the aus landrace Kharsu 80A | |
| CN109735652B (en) | Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application | |
| Tumino et al. | Genome-wide association analysis for lodging tolerance and plant height in a diverse European hexaploid oat collection | |
| CN110295251B (en) | SNP molecular marker linked with wheat effective tillering number QTL and application thereof | |
| CN112080582B (en) | KASP molecular marker closely linked with major QTL locus of wheat spike length and application thereof | |
| CN114134247B (en) | Molecular marker closely linked with millet plant height character, primer sequence and application thereof | |
| CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
| Zhang et al. | Assessment of the individual and combined effects of Rht8 and Ppd-D1a on plant height, time to heading and yield traits in common wheat | |
| Cook et al. | Genetic analysis of stay‐green, yield, and agronomic traits in spring wheat | |
| Wang et al. | Assessment of wheat variety stability using SSR markers | |
| CN113005213A (en) | SNP molecular marker related to wheat stem basal rot resistance and application thereof | |
| CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
| CN114107550A (en) | QTL (quantitative trait locus), molecular marker, amplification primer and application related to soybean hundred-grain weight | |
| CN110628935B (en) | Molecular marking method and application of salt-tolerant gene LOC _ Os02g49700 of rice in adult stage | |
| CN109439788B (en) | KASP molecular marker closely linked with major gene locus of wheat plant height and application thereof | |
| CN109022432B (en) | Method for identifying wheat tillering angle character and special primer group thereof | |
| CN115948603A (en) | Method for screening wheat with different plant heights, tillering and yields | |
| CN111996280B (en) | SNP marker co-separated from brassica napus dwarf compact trait and application thereof | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN116616171A (en) | Method for screening two-line hybrid wheat seed production parents with stable flowering period | |
| EP4111855A1 (en) | Snp based panel for mediterranean wheat plant selection and breeding | |
| US10028459B2 (en) | Tomato plants with improved disease resistance | |
| US10954555B2 (en) | Anthranilate synthase allele fragments for increasing rice yield and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |