CN115948603A - Method for screening wheat with different plant heights, tillering and yields - Google Patents
Method for screening wheat with different plant heights, tillering and yields Download PDFInfo
- Publication number
- CN115948603A CN115948603A CN202310095578.9A CN202310095578A CN115948603A CN 115948603 A CN115948603 A CN 115948603A CN 202310095578 A CN202310095578 A CN 202310095578A CN 115948603 A CN115948603 A CN 115948603A
- Authority
- CN
- China
- Prior art keywords
- wheat
- primer
- seq
- haplotype
- hap
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for screening wheat with different plant heights, tillering and yields, which comprises the following steps: detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2, wherein the plant height, tillering and/or yield of the wheat of the haplotype Hap-5B-1 are larger than those of the wheat of the haplotype Hap-5B-2; the haplotype Hap-5B-1 wheat is the wheat with GG homozygous genotype based on G206TSNP locus, GG homozygous genotype based on A295GSNP locus, deletion based on InDel241-285 genotype and/or deletion based on InDel296-402 genotype. By detecting the haplotypes of the wheat to be detected based on the TaSAG39-5B gene, the plant height, tillering and yield traits of the wheat can be screened. The invention has important application value.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for screening wheat with different plant heights, tillering and yields.
Background
Wheat (Triticum aestivum l.) is one of the most important food crops in our country. Increasing wheat yield is an important way to meet the increasing demand of grains and also a strategic target of guaranteeing grain safety. Currently, researchers have located a number of QTLs that regulate wheat yield. However, QTLs are difficult to apply for genetic improvement in wheat yield because of the small phenotypic contribution rate of most QTLs and poor reproducibility between different years and environments.
Molecular markers are genetic markers based on nucleotide sequence variations in the genetic material between individuals, and are a reflection of polymorphisms at the nucleotide sequence level. DNA molecular markers are mainly classified into 4 types: type 1 is a molecular marker based on molecular hybridization techniques, mainly including Restriction Fragment Length Polymorphism (RFLP) and variable number of tandem repeat polymorphisms (VNTR); the category 2 is molecular markers based on the PCR technology, and mainly includes Random Amplified Polymorphic DNA (RAPD), simple Sequence Repeat (SSR), sequence Tagged Sites (STS), and other molecular markers; class 3 is based on a technique combining restriction enzyme digestion and PCR techniques, and includes Amplified Fragment Length Polymorphism (AFLP) and digested amplified polymorphism sequences (CAPS); class 4 is a new generation of molecular marker technology based on the whole genome sequence, mainly including Single Nucleotide Polymorphism (SNP) and insertion-deletion polymorphism (InDel).
SNP refers to nucleotide sequence polymorphism caused by changes at the single nucleotide base level, and comprises substitution, transversion, insertion, deletion and the like. SNPs can be present at any position of a gene and can be classified into coding region SNPs and non-coding region SNPs according to their positions, wherein the coding region SNPs can be further classified into synonymous mutations and non-synonymous mutations, wherein the change of a base in the synonymous mutation does not cause the change of an amino acid of a protein translated by the synonymous mutation, and the change of a base sequence in the non-synonymous mutation causes the change of a protein translated by the synonymous mutation to affect the function of the protein. SNP is the most abundant variation type in plant genome, and the detection method is simple, and the method is widely applied to genetic research of crops, including association analysis of whole genome or candidate genes, construction of high-density linkage maps, fine positioning of characters, genetic diversity analysis and the like.
InDel refers to the insertion or deletion of the genomic base sequence at the same site between different individuals of the same species, and generally refers to the insertion or deletion of small fragments, which are between 1-50bp in length. In organisms, large segments with lengths of more than 50bp are inserted or deleted InDel which is a very important genomic structural variation, and many researches show that the deletion or insertion of the large segments plays an important role in explaining phenotypic differences affecting a series of important agronomic and quality characteristics of crops. InDel in the genome is widely distributed, has large density and more number, and the distribution density is second to SNP. Compared with SNP markers, the InDel marker is a PCR primer for amplifying insertion/deletion sites according to the insertion/deletion sites in a genome, and is simple and convenient to perform typing by agarose gel electrophoresis. The InDel marker has wide application in the aspects of genetic diversity analysis, gene positioning, variety resource identification and the like of crops.
The correlation analysis is a new method for identifying the relationship between phenotypic characters in a natural population and genetic markers or candidate genes on the basis of linkage disequilibrium experiments, and further excavating and controlling target character functional sites. Association analysis can be classified into genome-wide association assays (GWAS) and candidate gene-based association assays (CGAS) according to the scan range of molecular markers. Among them, GWAS mainly utilizes SNP markers on the whole genome level to screen for variation sites that can cause differences in specific target traits, and then explores candidate genes that are highly correlated with the target traits to reveal relationships between genotypes and phenotypic traits. CGAS mainly carries out sequencing analysis on candidate genes, and excavates allelic variation with positive regulation and control effects on target traits by carrying out correlation analysis on variation sites screened by a candidate gene reference sequence and phenotypic traits of natural populations. Both of them have the advantages of less time consumption, large variation range, high positioning precision and the like, and are widely applied to crop research; there are, however, operational differences, where the molecular markers used by GWAS in the analysis of LD, genetic relationship, population structure, genotype and phenotypic trait associations are the same; the molecular markers used in the analysis process of CGAS are molecular functional markers developed based on the polymorphism of candidate gene reference sequences.
Disclosure of Invention
The invention aims to screen or assist in screening wheat with different plant heights, effective tillering and/or yield.
The invention firstly protects and screens or assists in screening wheat with different plant heights, tillering and/or yields.
The method for screening or assisting in screening wheat with different plant heights, tillering and/or yields, which is protected by the invention, can be specifically a method I, and can comprise the following steps: detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2; the plant height, tillering and/or yield of the haploidy Hap-5B-1 wheat is greater than that of the haploidy Hap-5B-2 wheat;
the haplotype Hap-5B-1 wheat is the wheat which is homozygous for GG based on a G206TSNP locus, homozygous for GG based on an A295GSNP locus, deleted based on an InDel241-285 genotype and/or deleted based on an InDel296-402 genotype;
the haplotype Hap-5B-2 wheat is wheat which is TT homozygous based on the genotype of the G206TSNP locus, AA homozygous based on the genotype of the A295GSNP locus, inserted based on the genotype of the InDel241-285 and/or inserted based on the genotype of the InDel 296-402;
the G206TSNP is nucleotide at position 206 from 5' end of SEQ ID NO 1 in wheat genome;
the A295GSNP is nucleotide at 295 th position from 5' end of SEQ ID NO 1 in wheat genome;
InDel241-285 is nucleotide 241-285 of SEQ ID NO 1 from 5' end in wheat genome;
InDel296-402 is the No. 296-402 nucleotides from 5' end of SEQ ID NO. 1 in wheat genome.
The method for screening or assisting in screening wheat with different plant heights, tillering and/or yields, which is protected by the invention, can be specifically a method II, and sequentially comprises the following steps:
(A1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification on a first by adopting a primer consisting of a primer F1 and a primer R1 to obtain a PCR amplification product P1;
the primer F1 is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the primer R1 is a single-stranded DNA molecule shown in SEQ ID NO. 5;
(A2) Taking the PCR amplification product P1 as a template, and carrying out PCR amplification on the B by adopting a primer consisting of a primer F2 and a primer R2 to obtain a PCR amplification product P2;
the primer F2 is a single-stranded DNA molecule shown in SEQ ID NO. 6;
the primer R2 is a single-stranded DNA molecule shown in SEQ ID NO. 7;
(A3) The PCR amplification product P2 was evaluated as follows: if the PCR amplification product P2 only has a DNA fragment of 222bp, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the PCR amplification product P2 only has a 374bp DNA fragment, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-2;
the plant height, tillering and/or yield of the haploidy Hap-5B-1 wheat is greater than that of the haploidy Hap-5B-2 wheat.
The method for screening or assisting in screening wheat with different plant heights, tillering and/or yields, which is protected by the invention, can be specifically the third method, and sequentially comprises the following steps of:
(B1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification on a first by adopting a primer consisting of a primer F1 and a primer R1 to obtain a PCR amplification product P1;
the primer F1 is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the primer R1 is a single-stranded DNA molecule shown in SEQ ID NO. 5;
(B2) Taking the PCR amplification product P1 as a template, and carrying out PCR amplification on the B by adopting a primer consisting of a primer F2 and a primer R2 to obtain a PCR amplification product P2;
the primer F2 is a single-stranded DNA molecule shown in SEQ ID NO. 6;
the primer R2 is a single-stranded DNA molecule shown in SEQ ID NO. 7;
(B3) Sequencing the PCR amplification product P2, and then judging as follows: if the nucleotide sequence of the PCR amplification product P2 is shown as 127 th to 348 th positions from the 5' end of the SEQ ID NO 2, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the nucleotide sequence of the PCR amplification product P2 is shown as 127 th to 500 th sites from the 5' end of SEQ ID NO. 3, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-2;
the plant height, tillering and/or yield of the haploidy Hap-5B-1 wheat is greater than that of the haploidy Hap-5B-2 wheat.
In any of the above methods, the tillering can be efficient.
The invention also protects a kit for identifying or assisting in identifying the plant height, tillering and/or yield of wheat. The kit can comprise a substance for detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2;
the haplotype Hap-5B-1 is GG homozygous genotype based on a G206TSNP locus, GG homozygous genotype based on an A295GSNP locus, deletion genotype based on InDel241-285 and/or deletion genotype based on InDel296-402 TaSAG39-5B gene;
the haplotype Hap-5B-2 is TaSAG39-5B gene which is TT homozygous based on the genotype of the G206TSNP locus, AA homozygous based on the genotype of the A295GSNP locus, inserted based on the genotype of the InDel241-285 and/or inserted based on the genotype of the InDel 296-402;
the G206TSNP is nucleotide at position 206 from 5' end of SEQ ID NO 1 in wheat genome;
the A295GSNP is nucleotide at 295 th position from 5' end of SEQ ID NO 1 in wheat genome;
InDel241-285 is nucleotide 241-285 of SEQ ID NO 1 from 5' end in wheat genome;
InDel296-402 is the No. 296-402 nucleotides from 5' end of SEQ ID NO. 1 in wheat genome.
The kit can specifically comprise substances for detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2.
Any one of the substances for detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2 can comprise a primer pair A consisting of a primer F1 and a primer R1 and/or a primer pair B consisting of a primer F2 and a primer R2;
the primer F1 is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the primer R1 is a single-stranded DNA molecule shown in SEQ ID NO. 5;
the primer F2 is a single-stranded DNA molecule shown in SEQ ID NO. 6;
the primer R2 is a single-stranded DNA molecule shown in SEQ ID NO. 7.
Any one of the haplotypes for detecting the wheat to be detected based on the TaSAG39-5B gene is haplotype happ-5B-1 the substance which is also haplotype Hap-5B-2 may specifically be composed of the primer pair A and the primer pair B.
Any one of the haplotypes for detecting the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap the substance of-5B-1 or haplotype Hap-5B-2 may specifically consist of the primer pair A.
In any of the above kits, the tillers may be effective tillers.
The invention also protects the molecular marker A shown in SEQ ID NO. 2 or the molecular marker B shown in SEQ ID NO. 3.
The invention also protects the application of any one of the kits, which can be at least one of (z 1) to (z 4):
(z 1) screening or auxiliary screening of wheat with different plant heights, tillering and/or yields;
(z 2) identifying or assisting in identifying the plant height, tillering and/or yield of the wheat;
(z 3) identifying or assisting in identifying the haplotype of the wheat TaSAG39-5B gene;
(z 4) wheat breeding.
The invention also protects the application of the molecular marker A or the molecular marker B, which can be at least one of (z 1) - (z 4):
(z 1) screening or auxiliary screening wheat with different plant heights, tillering and/or yields;
(z 2) identifying or assisting in identifying the plant height, tillering and/or yield of the wheat;
(z 3) identifying or assisting in identifying the haplotype of the wheat TaSAG39-5B gene;
(z 4) wheat breeding.
In the above, if the genotype of the wheat to be tested based on the G206TSNP locus is GG homozygous, the genotype based on the A295GSNP locus is GG homozygous, the genotype based on the InDel241-285 is deleted and/or the genotype based on the InDel296-402 is deleted, the wheat with the haplotype haplotypes Hap-5B-1 is determined. And if the genotype of the wheat to be detected based on the G206TSNP locus is TT homozygous, the genotype based on the A295GSNP locus is AA homozygous, the genotype based on the InDel241-285 is insertion and/or the genotype based on the InDel296-402 is insertion, determining the wheat to be the haplotype happ-5B-2. The plant height of the haplotype Hap-5B-1 wheat is the plant height of the haplotype Hap-5B-2 wheat; effective tillering of haplotype Hap-5B-1 wheat (UK) and haplotype Hap-5B-2 wheat (UK); production of "wheat of haplotype Hap-5B-1 >" wheat of haplotype Hap-5B-2 "; the ">" is statistically >.
Experiments prove that the method provided by the invention can be used for detecting the haplotypes of the wheat to be detected based on the TaSAG39-5B gene, and can be used for screening or assisting in screening the plant height, tillering and/or yield traits of the wheat. The invention has important application value in the wheat molecular marker-assisted breeding process.
Drawings
FIG. 1 shows that wheat is divided into two haplotypes according to the difference of the TaSAG39-5B gene of wheat.
FIG. 2 is the result of detecting haplotyping of part of wheat in natural population based on TaSAG39-5B gene.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the examples described below, the natural population consisted of 389 wheat varieties from different regions. Since wheat material is a cultivar, it is usually defaulted to highly homozygous plant material, and haplotypes are homozygous.
Example 1 discovery of 2 SNP sites and 2 InDel sites in wheat TaSAG39-5B gene and establishment of wheat haplotyping method based on TaSAG39-5B gene
1. Discovery of 2 SNP sites and 2 InDel sites in wheat TaSAG39-5B gene
The inventor of the invention discovers 2 SNP sites (sequentially named as G206T SNP and A295G SNP) and 2 InDel sites (sequentially named as InDel241-285 and InDel 296-402) on a wheat TaSAG39-5B gene (the nucleotide sequence is shown as SEQ ID NO: 1) by analyzing the polymorphism of 32 wheat varieties with higher polymorphism. The names of the 32 wheat varieties are shown in table 1.
TABLE 1
| Numbering | Name of wheat variety | Numbering | Name (R) |
| 1 | Jin 2148-7 | 17 | 04-030 |
| 2 | Clinical reactance 5108 | 18 | Beijing No. 14 |
| 3 | Length 6878 | 19 | Beijing No. 10 |
| 4 | Changle No. 5 | 20 | Ann 85 middle 124-1 |
| 5 | Bai Jimai | 21 | Beijing 8686 |
| 6 | Ganwu 131 | 22 | 04-044 |
| 7 | Dali No. 1 | 23 | Spring 229th-25 |
| 8 | Honghe Shang | 24 | Jingpin No. 10 |
| 9 | Overlord whip | 25 | Spring 049th-5-1 |
| 10 | Ji Mai 41 | 26 | Spring 454th-50-1 |
| 11 | Ji wheat No. 6 | 27 | Jing 411 |
| 12 | Cangzhou wheat | 28 | Mono R8093 |
| 13 | Exhibition No. 1 | 29 | Fengcha 13 |
| 14 | Purple stem white mango | 30 | Jing Ke 8922 |
| 15 | Hometown 188 | 31 | Chinese spring |
| 16 | White coarse wheat | 32 | PANDAS |
The G206T SNP is located at the 206 th site from the 5' end of SEQ ID NO. 1, and the genotypes are GG homozygous and TT homozygous. The A295G SNP is located at the 295 th position from the 5' end of SEQ ID NO. 1, and the genotypes are AA homozygous and GG homozygous. InDel241-285 is located at 241-285 th position from 5' end of SEQ ID NO. 1, and the genotype is insertion or deletion. InDel296-402 is located at 296-402 of SEQ ID NO. 1 from the 5' end, and the genotype is insertion or deletion. Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules that are complementary in the reverse direction, a DNA molecule encoding a protein is generally designated as a sense DNA molecule; a DNA molecule complementary to the reverse direction of the sense DNA molecule is designated as an antisense DNA molecule. The genotypes of the G206T SNP, A295G SNP, inDel241-285 and InDel296-402 are all positive-sense DNA genotypes.
Wheat was divided into two haplotypes according to the difference in the wheat TaSAG39-5B gene (see FIG. 1): hap-5B-1 and Hap-5B-2. The nucleotide sequence of TaSAG39-5B gene of haplotype Hap-5B-1 wheat is shown in SEQ ID NO. 2. The nucleotide sequence of the TaSAG39-5B gene of haplotype Hap-5B-2 wheat is shown in SEQ ID NO. 3.
1 is:
ATGTCTCTGCCCACGTTCATCTTCGCACTCCTCGTCGTGAGCTGCGCCGTCGCCGCTCCCCGTGCGCTCGCGGTACGGGAGCTCGCCGGCAACGACGCCATCGCCGTCGAAGCTGCCATGGTGTCGAGGCACGAGAAGTGGATGGCGGAGCACGGGCGCACGTACGCGGACGAGGAGGAGAAGGCGCGGCGGCTGGAGGTATTCCKCGCCAACGCCAAGTTCATCGACTCGTTTAACGCCGCGGAGGAGAGCAGCCACCGGCTGGCCACCAACAGGTTCGCCGACCTCACCGTCRAGGAGTTCCGCGCCGCGAGGACCGGCCTCCAGCGCCCGGCGGCGGCCGTGGCTGGCGCCGGGAGAGGCGCTGGGGGGTTCAGGTACGAGAACTTCAGCCTGGCCGACGCAGCGGGGAGCATGGACTGGAGGGCCATGGGCGCCGTCACCGGCGTCAAGGACCAAGGCTCTTGCGGTACGTACAATCAACACGACAACACTGGCACGCACGCTACTGCAGATGCATACAAATTAAGCTGCAGAACATTGCAAGCACCGGAACATTTACCACCTGGATCAAGCTTTTTTAGACTTCTAAAAATGTTAAAAAAGAACTTGCAAGTGGCAACACGCGCGTAGGAAAAGTAAAAAATTGACGTGAGATTGTACCGGGATGACCAGAGTCTACAAACAAGTCATGCGTGCACTTTTCGGTCAACCCAGACAGCAAGAGGAGTCAGCGTTCACTTTACTTCAATGATTGGAGTATCATTCTTAATTTTCCATTTTGGACATGTCCTAAGCTTAATTGCCTCTGTTTCATCATTTAATCAAATAACTTGGGTGACATGCATATGCAGGCTGCTGCTGGGCGTTCTCGGCGGTGGCGGCGGTGGAAGGGCTGACCAAGATCCGCACGGGGCGGCTTATGTCACTGTCGGAGCAGCAGCTGGTGGACTGCGACGTGAACGGCGACGACGAGGGCTGCGCCGGCGGCCTCATGGACAACGCCTTCGAGTACATGGTCCGCCGCGGCGGCCTCACCACGGAGTCGTCCTACCCGTACCGCGGCACGGACGGGTCGTGCCGCCGCTCGGCCTCGGCCGCGTCCATCCGGGGGTACGAGGACGTGCCGGCCAACAACGAGGCCGCGCTGATGGCGGCCGTGGCGCACCAGCCCGTGTCCGTGGCCATCAACGGCGGCGACAGCGTGTTCCGGTTCTACGACAGCGGCGTGCTGGGCGGGTCCGGCTGCGGCACGGAGCTCAACCACGCCATCACGGCGGTCGGGTACGGCACGGCGGGCGACGGCACCAAGTACTGGATCATGAAGAACTCGTGGGGCGGGTCGTGGGGCGAGGGCGGCTACGTCAGGATCCGCCGCGGCGTGCGCGGCGAGGGCGTCTGCGGCCTCGCCCAGCTCGCGTCCTACCCTGTCTAG
ATGTCTCTGCCCACGTTCATCTTCGCACTCCTCGTCGTGAGCTGCGCCGTCGCCGCTCCCCGTGCGCTCGCGGTACGGGAGCTCGCCGGCAACGACGCCATCGCCGTCGAAGCTGCCATGGTGTCGAGGCACGAGAAGTGGATGGCGGAGCACGGGCGCACGTACGCGGACGAGGAGGAGAAGGCGCGGCGGCTGGAGGTATTCCGCGCCAACGCCAAGTTCATCGACTCGTTTAACGCCCTCACCGTCGGCAGCGGGGAGCATGGACTGGAGGGCCATGGGCGCCGTCACCGGCGTCAAGGACCAAGGCTCTTGCGGTACGTACAATCAACACGACAACACTGGCACGCACGCTACTGCAGATGCATACAAATTAAGCTGCAGAACATTGCAAGCACCGGAACATTTACCACCTGGATCAAGCTTTTTTAGACTTCTAAAAATGTTAAAAAAGAACTTGCAAGTGGCAACACGCGCGTAGGAAAAGTAAAAAATTGACGTGAGATTGTACCGGGATGACCAGAGTCTACAAACAAGTCATGCGTGCACTTTTCGGTCAACCCAGACAGCAAGAGGAGTCAGCGTTCACTTTACTTCAATGATTGGAGTATCATTCTTAATTTTCCATTTTGGACATGTCCTAAGCTTAATTGCCTCTGTTTCATCATTTAATCAAATAACTTGGGTGACATGCATATGCAGGCTGCTGCTGGGCGTTCTCGGCGGTGGCGGCGGTGGAAGGGCTGACCAAGATCCGCACGGGGCGGCTTATGTCACTGTCGGAGCAGCAGCTGGTGGACTGCGACGTGAACGGCGACGACGAGGGCTGCGCCGGCGGCCTCATGGACAACGCCTTCGAGTACATGGTCCGCCGCGGCGGCCTCACCACGGAGTCGTCCTACCCGTACCGCGGCACGGACGGGTCGTGCCGCCGCTCGGCCTCGGCCGCGTCCATCCGGGGGTACGAGGACGTGCCGGCCAACAACGAGGCCGCGCTGATGGCGGCCGTGGCGCACCAGCCCGTGTCCGTGGCCATCAACGGCGGCGACAGCGTGTTCCGGTTCTACGACAGCGGCGTGCTGGGCGGGTCCGGCTGCGGCACGGAGCTCAACCACGCCATCACGGCGGTCGGGTACGGCACGGCGGGCGACGGCACCAAGTACTGGATCATGAAGAACTCGTGGGGCGGGTCGTGGGGCGAGGGCGGCTACGTCAGGATCCGCCGCGGCGTGCGCGGCGAGGGCGTCTGCGGCCTCGCCCAGCTCGCGTCCTACCCTGTCTAG
3 is:
ATGTCTCTGCCCACGTTCATCTTCGCACTCCTCGTCGTGAGCTGCGCCGTCGCCGCTCCCCGTGCGCTCGCGGTACGGGAGCTCGCCGGCAACGACGCCATCGCCGTCGAAGCTGCCATGGTGTCGAGGCACGAGAAGTGGATGGCGGAGCACGGGCGCACGTACGCGGACGAGGAGGAGAAGGCGCGGCGGCTGGAGGTATTCCTCGCCAACGCCAAGTTCATCGACTCGTTTAACGCCGCGGAGGAGAGCAGCCACCGGCTGGCCACCAACAGGTTCGCCGACCTCACCGTCAAGGAGTTCCGCGCCGCGAGGACCGGCCTCCAGCGCCCGGCGGCGGCCGTGGCTGGCGCCGGGAGAGGCGCTGGGGGGTTCAGGTACGAGAACTTCAGCCTGGCCGACGCAGCGGGGAGCATGGACTGGAGGGCCATGGGCGCCGTCACCGGCGTCAAGGACCAAGGCTCTTGCGGTACGTACAATCAACACGACAACACTGGCACGCACGCTACTGCAGATGCATACAAATTAAGCTGCAGAACATTGCAAGCACCGGAACATTTACCACCTGGATCAAGCTTTTTTAGACTTCTAAAAATGTTAAAAAAGAACTTGCAAGTGGCAACACGCGCGTAGGAAAAGTAAAAAATTGACGTGAGATTGTACCGGGATGACCAGAGTCTACAAACAAGTCATGCGTGCACTTTTCGGTCAACCCAGACAGCAAGAGGAGTCAGCGTTCACTTTACTTCAATGATTGGAGTATCATTCTTAATTTTCCATTTTGGACATGTCCTAAGCTTAATTGCCTCTGTTTCATCATTTAATCAAATAACTTGGGTGACATGCATATGCAGGCTGCTGCTGGGCGTTCTCGGCGGTGGCGGCGGTGGAAGGGCTGACCAAGATCCGCACGGGGCGGCTTATGTCACTGTCGGAGCAGCAGCTGGTGGACTGCGACGTGAACGGCGACGACGAGGGCTGCGCCGGCGGCCTCATGGACAACGCCTTCGAGTACATGGTCCGCCGCGGCGGCCTCACCACGGAGTCGTCCTACCCGTACCGCGGCACGGACGGGTCGTGCCGCCGCTCGGCCTCGGCCGCGTCCATCCGGGGGTACGAGGACGTGCCGGCCAACAACGAGGCCGCGCTGATGGCGGCCGTGGCGCACCAGCCCGTGTCCGTGGCCATCAACGGCGGCGACAGCGTGTTCCGGTTCTACGACAGCGGCGTGCTGGGCGGGTCCGGCTGCGGCACGGAGCTCAACCACGCCATCACGGCGGTCGGGTACGGCACGGCGGGCGACGGCACCAAGTACTGGATCATGAAGAACTCGTGGGGCGGGTCGTGGGGCGAGGGCGGCTACGTCAGGATCCGCCGCGGCGTGCGCGGCGAGGGCGTCTGCGGCCTCGCCCAGCTCGCGTCCTACCCTGTCTAG
2. synthesis of primer pair A and primer pair B for amplification of target sequences including G206T SNP, A295G SNP, inDel241-285 and InDel296-402
Primer pair A and primer pair B were designed and synthesized for amplification of target sequences including the G206T SNP, the A295G SNP, inDel241-285, and InDel 296-402. The primer pair A consists of a primer F1 and a primer R1. And the primer pair B consists of a primer F2 and a primer R2.
The nucleotide sequence of each primer is specifically as follows:
primer F1:5'-GCGTGAGAGGACGTGTATGG-3' (SEQ ID NO: 4)
A primer R1:5'-CCATACGGCAAGCTAGCG-3' (SEQ ID NO: 5)
And (3) primer F2:5'-AGGCACGAGAAGTGGATG-3' (SEQ ID NO: 6)
And (3) a primer R2:5'-GTGCCAGTGTTGTCGTGT-3' (SEQ ID NO: 7)
The target sequence amplified by the primer pair B is shown as 127 th to 348 th positions from the 5 'end of SEQ ID NO. 2 or 127 th to 500 th positions from the 5' end of SEQ ID NO. 3.
3. Establishment of haplotyping method of wheat based on TaSAG39-5B gene
1. Extracting the genome DNA of the wheat to be detected.
2. And (2) taking the genome DNA of the wheat to be detected in the step (1) as a template, and carrying out PCR amplification on the A by adopting a primer consisting of the primer F1 and the primer R1 to obtain a PCR amplification product P1.
3. And (3) after the step (2) is finished, carrying out PCR amplification on the B by using the PCR amplification product P1 as a template and adopting a primer consisting of the primer F2 and the primer R2 to obtain a PCR amplification product P2.
4. And (4) carrying out 2% agarose gel electrophoresis detection on the PCR amplification product P2 obtained in the step (3), and judging as follows: if the size of the PCR amplification product P2 is 222bp and/or the nucleotide sequence is shown as 127 th to 348 th sites from the 5' end of SEQ ID NO. 2, the haplotyping of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the size of the PCR amplification product P2 is 374bp and/or the nucleotide sequence is shown as 127 th to 500 th positions from the 5' end of SEQ ID NO. 3, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-2.
Example 2 Association analysis of wheat haplotyping based on the TaSAG39-5B Gene and wheat agronomic traits (such as plant height, effective tillering and yield)
1. Haplotyping of each wheat in natural population based on TaSAG39-5B gene
Haplotyping each wheat variety in the natural population using the method of step three in example 1. The natural population consists of 389 wheat varieties (all hexaploids). The wheat variety names are detailed in table 2.
The partial detection results are shown in FIG. 2 (M is DNA Marker, I is haplotype Hap-5B-2,D is haplotype Hap-5B-1).
389 Haemophilus minor variety haplotyping based on the TaSAG39-5B gene is shown in Table 2: the 251 triticale cultivar is haplotype Hap-5B-1 based on the haplotype of the TaSAG39-5B gene, and the 138 triticale cultivar is haplotype Hap-5B-2 based on the haplotype of the TaSAG39-5B gene.
TABLE 2 haplotypes based on the TaSAG39-5B gene in the Natural population
2. Detection of plant height, effective tillering and yield traits
389 wheat varieties in natural populations are planted in 5 environments including E1-E5. After harvesting, the average plant height, average effective tillering and average yield of the two haplotypes of wheat were respectively counted.
The 5 environments are 2021-SX-DS + LN (E1) and 2020-SX respectivelyWW + LN (E2), 2019-SX-WW + N (E3), 2019-HB-WW + N (E4) and 2018-SX-WW + N (E5), named as year of planting-place of planting-moisture management + nitrogen treatment. Wherein SX is Shanxi agriculture university Shenfeng test field, HB is Hebei Zhao county test field, DS is drought (namely rain culture is carried out during the whole growth and development period of wheat without artificial irrigation), WW is irrigation (namely watering is carried out at 3 periods before overwintering, in the jointing stage and in the heading stage), N is normal nitrogen treatment (namely applying nitrogen, and the nitrogen application amount is 18kg/667m 2 (calculated by pure nitrogen), 30 percent, 40 percent and 30 percent of the total amount of nitrogen fertilizer is applied during irrigation before overwintering, in the jointing stage and in the heading stage respectively, and LN is low-nitrogen treatment (namely nitrogen is not applied in the whole growth process of wheat).
The statistical results are shown in Table 3.
TABLE 3-1
Note: pvalue is the significance level of the association analysis, * represents P<0.05， ** Represents P<0.01， *** Is represented by P<0.001。
TABLE 3-2
Note: pvalue is the significance level of the association analysis, * represents P<0.05， ** Represents P<0.01， *** Represents P<0.001。
Tables 3 to 3
Note: pvalue is the significance level of the association analysis, * represents P<0.05， ** Represents P<0.01， *** Is represented by P<0.001。
3. Association analysis
Using the software tassel5.0
The haplotype of the wheat TaSAG39-5B gene in the natural population is subjected to correlation analysis with plant height, effective tillering and yield, and the result is shown in Table 3.
The result shows that in a natural population composed of 389 wheat varieties, the plant height of the wheat with the haplotype haploidy Hap-5B-1 and the plant height of the wheat with the haplotype Hap-5B-2 are high; effective tillering of the haplotype Hap-5B-1 wheat and the haplotype Hap-5B-2 wheat; production of "wheat of haplotype Hap-5B-1 >" wheat of haplotype Hap-5B-2 "; the ">" is in statistics >. The research on natural population shows that the haplotype Hap-5B-1 is an excellent haplotype for improving the plant height, effective tillering and yield of wheat.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Claims (10)
1. A method for screening or assisting in screening wheat with different plant heights, tillering and/or yields comprises the following steps: detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2;
the plant height, tillering and/or yield of the haploidy Hap-5B-1 wheat is greater than that of the haploidy Hap-5B-2 wheat;
the haplotype Hap-5B-1 wheat is the wheat with the genotype based on the G206T SNP locus being GG homozygous, the genotype based on the A295G SNP locus being GG homozygous, the genotype based on the InDel241-285 being deleted and/or the genotype based on the InDel296-402 being deleted;
the haplotype Hap-5B-2 wheat is wheat which is TT homozygous based on the genotype of the G206T SNP locus, AA homozygous based on the genotype of the A295G SNP locus, inserted based on the genotype of the InDel241-285 and/or inserted based on the genotype of the InDel 296-402;
the G206T SNP is the nucleotide at the 206 th site from the 5' end of SEQ ID NO 1 in the wheat genome;
the A295G SNP is the 295 th nucleotide from the 5' end of SEQ ID NO 1 in the wheat genome;
InDel241-285 is nucleotide 241-285 of SEQ ID NO 1 from 5' end in wheat genome;
InDel296-402 is the No. 296-402 nucleotides from 5' end of SEQ ID NO. 1 in wheat genome.
2. A method for screening or assisting in screening wheat with different plant heights, tillering and/or yields sequentially comprises the following steps:
(A1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification on a primer A by adopting a primer consisting of a primer F1 and a primer R1 to obtain a PCR amplification product P1;
the primer F1 is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the primer R1 is a single-stranded DNA molecule shown in SEQ ID NO. 5;
(A2) Taking the PCR amplification product P1 as a template, and carrying out PCR amplification on the B by adopting a primer consisting of a primer F2 and a primer R2 to obtain a PCR amplification product P2;
the primer F2 is a single-stranded DNA molecule shown in SEQ ID NO. 6;
the primer R2 is a single-stranded DNA molecule shown in SEQ ID NO. 7;
(A3) The PCR amplification product P2 was evaluated as follows: if the PCR amplification product P2 only has a DNA fragment of 222bp, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the PCR amplification product P2 only has a 374bp DNA fragment, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-2;
the plant height, tillering and/or yield of the haploidy Hap-5B-1 wheat is greater than that of the haploidy Hap-5B-2 wheat.
3. A method for screening or assisting in screening wheat with different plant heights, tillering and/or yields sequentially comprises the following steps:
(B1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification on a first by adopting a primer consisting of a primer F1 and a primer R1 to obtain a PCR amplification product P1;
the primer F1 is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the primer R1 is a single-stranded DNA molecule shown in SEQ ID NO. 5;
(B2) Taking the PCR amplification product P1 as a template, and carrying out PCR amplification on the B by adopting a primer consisting of a primer F2 and a primer R2 to obtain a PCR amplification product P2;
the primer F2 is a single-stranded DNA molecule shown in SEQ ID NO. 6;
the primer R2 is a single-stranded DNA molecule shown in SEQ ID NO. 7;
(B3) Sequencing the PCR amplification product P2, and then judging as follows: if the nucleotide sequence of the PCR amplification product P2 is shown as 127 th to 348 th positions from the 5' end of the SEQ ID NO 2, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1; if the nucleotide sequence of the PCR amplification product P2 is shown as 127 th to 500 th from the 5' end of 3, the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-2;
the plant height, tillering and/or yield of the haplotype Hap-5B-1 wheat is greater than that of haplotype Hap-5B-2 wheat.
4. A method according to any one of claims 1 to 3, wherein: the tillering is effective tillering.
5. A kit for identifying or assisting in identifying the plant height, tillering and/or yield of wheat comprises a substance for detecting whether the haplotype of the wheat to be detected based on the TaSAG39-5B gene is haplotype Hap-5B-1 or haplotype Hap-5B-2;
the haplotype Hap-5B-1 is a TaSAG39-5B gene which is GG homozygous based on the G206T SNP locus, GG homozygous based on the A295G SNP locus, deleted based on the InDel241-285 genotype and/or deleted based on the InDel296-402 genotype;
the haplotype Hap-5B-2 is TaSAG39-5B gene which is TT homozygous based on the genotype of the G206T SNP locus, AA homozygous based on the genotype of the A295G SNP locus, inserted based on the genotype of the InDel241-285 and/or inserted based on the genotype of the InDel 296-402;
the G206T SNP is the nucleotide at the 206 th site from the 5' end of SEQ ID NO. 1 in the wheat genome;
the A295G SNP is the 295 th nucleotide from the 5' end of SEQ ID NO 1 in the wheat genome;
InDel241-285 is nucleotide 241-285 of SEQ ID NO 1 from 5' end in wheat genome;
InDel296-402 are nucleotides 296-402 of SEQ ID NO:1 from the 5' end in the wheat genome.
6. The kit of claim 5, wherein: the substance for detecting whether the haplotypes of the wheat to be detected based on the TaSAG39-5B gene are the haplotypes Hap-5B-1 or the haplotypes Hap-5B-2 comprises a primer pair A consisting of a primer F1 and a primer R1 and/or a primer pair B consisting of a primer F2 and a primer R2;
the primer F1 is a single-stranded DNA molecule shown in SEQ ID NO. 4;
the primer R1 is a single-stranded DNA molecule shown in SEQ ID NO. 5;
the primer F2 is a single-stranded DNA molecule shown in SEQ ID NO. 6;
the primer R2 is a single-stranded DNA molecule shown in SEQ ID NO. 7.
7. The kit of claim 6, wherein: the tillering is effective tillering.
And 8, the molecular marker A shown in SEQ ID NO.
9. The use of the kit of any one of claims 5 to 7, which is at least one of (z 1) to (z 4):
(z 1) screening or auxiliary screening wheat with different plant heights, tillering and/or yields;
(z 2) identifying or assisting in identifying the plant height, tillering and/or yield of the wheat;
(z 3) identifying or assisting in identifying the haplotype of the wheat TaSAG39-5B gene;
(z 4) wheat breeding.
10. The use of the molecular marker A or B according to claim 8, wherein the molecular marker is at least one of (z 1) to (z 4):
(z 1) screening or auxiliary screening wheat with different plant heights, tillering and/or yields;
(z 2) identifying or assisting in identifying the plant height, tillering and/or yield of the wheat;
(z 3) identifying or assisting in identifying the haplotype of the wheat TaSAG39-5B gene;
(z 4) wheat breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310095578.9A CN115948603A (en) | 2023-02-10 | 2023-02-10 | Method for screening wheat with different plant heights, tillering and yields |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310095578.9A CN115948603A (en) | 2023-02-10 | 2023-02-10 | Method for screening wheat with different plant heights, tillering and yields |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115948603A true CN115948603A (en) | 2023-04-11 |
Family
ID=87297949
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310095578.9A Pending CN115948603A (en) | 2023-02-10 | 2023-02-10 | Method for screening wheat with different plant heights, tillering and yields |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115948603A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116530244A (en) * | 2023-07-04 | 2023-08-04 | 山西农业大学 | Soil preparation soil moisture conservation device |
-
2023
- 2023-02-10 CN CN202310095578.9A patent/CN115948603A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116530244A (en) * | 2023-07-04 | 2023-08-04 | 山西农业大学 | Soil preparation soil moisture conservation device |
| CN116530244B (en) * | 2023-07-04 | 2023-09-05 | 山西农业大学 | Soil preparation soil moisture conservation device |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109762812B (en) | Wheat growth potential related SNP and application thereof as target point in identification of wheat growth potential traits | |
| CN108048597B (en) | SNP molecular marker related to drought resistance of rice and application thereof | |
| CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
| CN105219858B (en) | Grain Weight in Common Wheat gene TaGS5 3A single nucleotide polymorphisms and its application | |
| CN111321241B (en) | Molecular marker of wheat thousand-grain weight and grain length gene TaGS3-4A and application thereof | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN115948603A (en) | Method for screening wheat with different plant heights, tillering and yields | |
| CN116287379A (en) | Method for screening wheat with different thousand grain weights and ear phenotypes and special kit thereof | |
| CN116479163A (en) | Molecular marker linked with loose cauliflower leaf yellowing gene and application thereof | |
| CN116287387A (en) | SNP locus and KASP molecular marker closely linked with PMMoV resistance gene L3 of capsicum and application | |
| CN112442544A (en) | Method and kit for auxiliary screening of tomato material with high sugar character and application | |
| CN113881799A (en) | Functional molecular marker for screening/detecting main effect resistance locus of tobacco root black rot and application thereof | |
| CN111607659A (en) | SNP molecular marker associated with hemicellulose content of ramie and application thereof | |
| CN115948591B (en) | Identification of corn seedling drought tolerance related monomer ZmC10.HapDR and application thereof | |
| CN110484651B (en) | Molecular marker in wheat yield related gene TaNRT2-6D and application thereof | |
| CN116926230B (en) | Molecular marker related to cotton fiber length and application thereof | |
| CN116606916B (en) | Method for identifying, screening or controlling wheat spike number per spike based on SNP locus | |
| CN116855592B (en) | Method for identifying, screening or controlling thousand seed weight of wheat based on A583G SNP locus | |
| CN113215297B (en) | Molecular marker ID0159 closely linked with major QTL site of sesame oil content and application thereof | |
| CN113817862B (en) | KASP-Flw-sau6198 molecular marker linked with wheat flag leaf width major QTL and application thereof | |
| CN115961065A (en) | Method for identifying small ear number of wheat per ear based on A2173T SNP site in TaHDA9-D gene | |
| CN117126848A (en) | Kit for identifying wheat powdery mildew resistance | |
| CN117050991A (en) | Method for identifying wheat powdery mildew resistance and primer group used by same | |
| CN115992290A (en) | Wheat plant height related SNP locus and application thereof in auxiliary screening of wheat with different plant heights | |
| CN116287417A (en) | SNP (Single nucleotide polymorphism) marker related to drought resistance of sesame and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |