CN116606821A - Plant salt-alkali-resistant protein GsSIE3, and coding gene and application thereof - Google Patents

Abstract

A plant salt-alkali resistant protein GsSIE3, a coding gene and application thereof belong to the technical field of genetic engineering. In order to improve salt and alkalinity resistance of soybean, the invention provides a GsSIE3 protein with an amino acid sequence shown as SEQ ID NO.2 and a nucleotide sequence which codes the protein and is shown as SEQ ID NO.1, experiments prove that the GsSIE3 gene can respond to salt and alkaline stress reaction, and the GsSIE3 and the GsSnRK1 are physically related, and the GsSnRK1 can phosphorylate the GsSIE3 at a T514 site. Co-expression of GsSnRK1 and GsSIE3 in soybean hairy roots shows that the combination of GsSnRK1 (wt) and GsSIE31 (wt) can significantly increase the resistance of soybeans to saline-alkali stress, and reveals the molecular mechanism that GsSnRK1 and GsSIE3 are cooperatively involved in regulating the salt-alkali tolerance of plants.

Description

Plant salt-alkali-resistant protein GsSIE3, and coding gene and application thereof

Technical Field

The invention relates to a plant salt-tolerant protein GsSIE3, and a coding gene and application thereof, and belongs to the technical field of biology.

Background

Salt stress is one of the environmental stress factors affecting crop yield in many parts of the world. Soybean (Glycine max) is taken as an important crop widely planted in China, and in the long-term artificial breeding process, a plurality of salt resistance genes are lost, so that the soybean is sensitive to salt stress in soil, and wild soybean (Glycine soja) is taken as a closely related seed of cultivated soybean, so that the soybean has strong environmental adaptability and is an important germplasm resource.

In recent years, it has become possible to improve the salt tolerance of crops by genetic engineering technology molecular breeding through excavating key regulatory genes of salt tolerance, thereby improving the crop yield. However, an important premise for achieving this is the excavation of critical regulatory genes for salt tolerance.

Disclosure of Invention

The invention provides a plant salt and alkali resistant protein GsSIE3 for solving the problem of improving the salt and alkali resistance of plants, and the amino acid sequence of the plant salt and alkali resistant protein GsSIE3 is shown as SEQ ID NO. 2.

Further defined, the plant salt-tolerant protein GsSIE3 also comprises fusion proteins obtained by connecting tags at the N end and/or the C end of the protein with the amino acid sequence shown as SEQ ID NO. 2.

Further defined, to facilitate purification of the protein having the amino acid sequence shown in SEQ ID NO.2, an HA tag or Myc tag may be attached to the amino-or carboxy-terminus of the protein having the amino acid sequence shown in SEQ ID NO. 2.

The plant salt-tolerant protein GsSIE3 is a protein with the following amino acid residue sequence: the amino acid residues 477 to 522 from the carboxyl terminal of the amino acid residue sequence SEQ ID NO.2 are ubiquitin ligase active region RING-UboxDomains with highly conserved C ₃ HC ₄ RING motif, which belongs to the HC subgroup, belongs to the RING-Ubox E3 ubiquitin ligase.

T514 in the amino acid residue sequence from 477 th to 522 th of the carboxyl end of the amino acid residue sequence SEQ ID NO.2 in the ubiquitin ligase activity structural domain of the plant salt-tolerant protein GsSIE3 is a site of the plant salt-tolerant protein GsSIE3 regulated by phosphorylation.

The invention also provides a coding sequence of the plant salt-tolerant protein GsSIE3, and the coding sequence is shown as SEQ ID NO. 1.

Further defined, the coding sequence further comprises any one of the following:

1) A cDNA molecule or a DNA molecule as shown in SEQ ID NO. 1;

2) A cDNA molecule or a genomic DNA molecule having more than 75% identity with the coding sequence shown as SEQ ID NO.1 and encoding said protein GsSIE 3.

Further defined, the coding sequence further includes a cDNA molecule or a genomic DNA molecule which hybridizes to the coding sequence defined in 1) or 2) above and which encodes the protein GsSIE 3.

Further defined, the coding sequence may be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc.

The nucleotide sequence encoding the GsSIE3 protein of the present invention can be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity to the nucleotide sequence encoding the GsSIE3 protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the GsSIE3 protein and have the same function.

Primer pairs that amplify the full length of the coding sequence encoding the above GsSIE3 protein or fragments thereof are also within the scope of the present invention.

The invention also provides a biological material related to the coding sequence, wherein the biological material is any one of the following materials:

a1 An expression cassette comprising said coding sequence;

a2 A recombinant vector comprising said coding sequence;

a3 A recombinant microorganism comprising said coding sequence.

Further defined, the above biological material may also be any one of the following materials:

a4 A recombinant vector comprising the expression cassette of A1);

a5 A recombinant microorganism comprising the expression cassette of A1);

a6 A) a recombinant microorganism comprising the recombinant vector of A2).

Further defined, the biological material further comprises a recombinant microorganism comprising the recombinant vector of A4).

In the above biological material, the vector may be a plasmid, cosmid, phage or viral vector.

In the above biological material, the microorganism may be yeast, bacteria, algae or fungi, such as agrobacterium.

In the above biological material, the expression cassette (GsSIE 3 gene expression cassette) containing the nucleic acid molecule encoding the GsSIE3 protein described in A1) refers to a DNA capable of expressing the GsSIE3 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the GsSIE3 but also a terminator for terminating transcription of the GsSIE 3. Further, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the constitutive promoter 35S of cauliflower mosaic virus, the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", chao et al (1999) Plant Physiol 120:979-992), the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR 1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiol S-methyl ester), the tomato protease inhibitor II promoter (PIN 2) or LAP promoter (both inducible with methyl jasmonate), the heat shock promoter (U.S. Pat. No. 5187267), the tetracycline inducible promoter (U.S. Pat. No. 5057422), seed-specific promoters (such as the millet seed-specific promoter pF128 (China patent 2007) 10099169.7 A) seed storage protein specific promoter (e.g., the promoters of phaseolin, napin, oleosin, and soybean beta-glucan (Beachy et al (1985) EMBO J. 4:3047-3053)). They may be used alone or in combination with other plant promoters. All references cited herein are incorporated by reference in their entirety. Suitable transcription terminators include, but are not limited to: agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminator (see, e.g., 0dell et al (I) ⁹⁸⁵ ) Nature 313:810; rosenberg et al (1987) Gene,56:125; guerineau et al (1991) mol. Gen. Genet,262:141; proudroot (1991) Cell,64:671; sanfacon et al Genes Dev.,5:141; mogen et al (1990) Plant Cell,2:1261; munroe et al (1990) Gene,91:151; ballad et al (1989) Nucleic Acids Res.l7:7891; joshi et al (1987) Nucleic Acid Res., 15:9627).

Recombinant vectors containing the GsSIE3 gene expression cassette can be constructed using existing expression vectors. The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Co.), etc. The plant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylation to the 3 'end of the mRNA precursor, and can function similarly in non-translated regions transcribed from the 3' end of Agrobacterium tumefaciens crown tumor-inducing (Ti) plasmid genes (e.g., nopaline synthase gene Nos) and plant genes (e.g., soybean storage protein genes). When the gene of the present invention is used to construct a plant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence. The sources of the translational control signals and initiation codons are broad, and can be either natural or synthetic. The translation initiation region may be derived from a transcription initiation region or a structural gene. To facilitate identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptl gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to the herbicide phosphinothricin, hph gene conferring resistance to antibiotic hygromycin, dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate) or chemical reagent marker genes, etc. (such as herbicide resistance genes), mannose-6-phosphate isomerase gene providing mannose metabolization ability. From the safety of transgenic plants, transformed plants can be screened directly in stress without adding any selectable marker gene.

The invention also provides application of the plant salt-tolerant protein GsSIE3, the coding sequence or the biological material in improving the salt tolerance of soybeans.

Further defined, the use is to overexpress the proteins GsSIE3 or co-express the proteins GsSIE3 and GsSnRK1 in plants.

The invention also provides application of the plant salt-tolerant protein GsSIE3, the coding sequence or the biological material in improving the alkali resistance of soybeans.

Further defined, the use is to overexpress the proteins GsSIE3 or co-express the proteins GsSIE3 and GsSnRK1 in plants.

The invention also provides a method for cultivating transgenic soybean hairy roots with salt tolerance, which comprises the steps of introducing a coding gene of a protein GsSIE3 into soybean hairy roots, or introducing a coding gene of the protein GsSIE3 and a coding gene of GsSnRK1 into soybean hairy roots; the nucleotide sequence of the gene encoding the protein GsSIE3 is shown as SEQ ID NO. 1.

Further defined, the soybean hairy root is a soybean hairy root obtained by induction of agrobacterium rhizogenes K599.

The invention also provides a method for cultivating the transgenic soybean hairy root with alkali resistance, which comprises the steps of introducing the encoding gene of the protein GsSIE3 into the soybean hairy root, or introducing the encoding gene of the protein GsSIE3 and the encoding gene of the GsSnRK1 protein into the soybean hairy root; the nucleotide sequence of the gene encoding the protein GsSIE3 is shown as SEQ ID NO. 1.

Further defined, the soybean hairy root is a soybean hairy root obtained by induction of agrobacterium rhizogenes K599.

In one embodiment of the present invention, the coding gene of GsSIE3 protein, i.e., the nucleotide sequence shown in SEQ ID NO.1, is introduced into Agrobacterium rhizogenes K599 by recombinant vectors pPBEL-BiFC-GsSnRK1-GsSIE3 and pPBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 containing the expression cassette of the coding gene of GsSIE3 protein. The recombinant vectors pPBEL-BiFC-GsSnRK1-GsSIE3 and pPBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 are vectors obtained by inserting molecules with nucleotide sequences shown as SEQ ID NO.1 between EcoRI sites of the pPBEL-BiFC vector and keeping other sequences of the pPBEL-BiFC vector unchanged. The recombinant vector pPBEL-BiFC-GsSnRK1-GsSIE3 expresses GsSnRK1 protein and GsSIE3 protein, and PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 expresses GsSnRK1 (K49M) protein and GsSIE3 protein.

In one embodiment of the present invention, the transgenic soybean hairy root is understood to be a transgenic hairy root obtained by transforming the GsSIE3 gene into cotyledons of a plant of interest. Conventional breeding techniques can also be used to transfer the gene into other varieties of the same species, including particularly commercial varieties. The transgenic plants include seeds, calli, whole plants and cells.

The invention has the beneficial effects that:

the invention discovers an E3 ubiquitin ligase GsSIE3 related to plant saline-alkali stress, which is specific to NaCl and NaHCO ₃ Sensitive, and through qRT-PCR and RT-PCR analysis, it is shown that GsSIE3 gene is expressed in wild soybean root, and GsSIE3 is subjected to NaCl and NaHCO ₃ The expression quantity is obviously improved after stress induction, and the salt stress response can be responded. The physical association of GsSIE3 and GsSnRK1 was confirmed by yeast binary hybridization validation, GST-pulldown validation and co-immunoprecipitation assay. In addition, it was determined that GsSnRK1 can phosphorylate GsSIE3 at the T514 site.Ubiquitin ligase activity of GsSIE3 was biochemically detected using transient transformation techniques and HA-Ub antibodies, saline-alkali stress could activate GsSnRK1, and subsequently phosphorylation of GsSnRK1 to GsSIE3 was found to be necessary for its ubiquitin ligase activity. Co-expression of GsSnRK1 and GsSIE3 in soybean hairy roots shows that the combination of GsSnRK1 (wt) and GsSIE3 (wt) can obviously enhance the resistance of soybeans to saline-alkali stress, and reveals the novel function of GsSIE3 and the regulation mechanism of the GsSIE3 to the saline-alkali resistance of plants. Then, the phenotype and physiological indexes of various transgenic soybean plants under the saline-alkali stress are analyzed, and the result shows that under the saline-alkali stress, the transgenic chimeric soybean plants which are used for singly and over-expressing GsSnRK1 and GsSIE3 have good growth states, and the growth states of the transgenic chimeric soybean plants which are used for co-expressing GsSnRK1 (wt) and GsSIE3 (wt) are better than those of the transgenic chimeric soybean plants which are used for singly and over-expressing GsSnRK1 and GsSIE3. This provides new clues for the novel function of GsSIE3 and its regulatory mechanism for the saline-alkali stress tolerance of plants.

Drawings

FIG. 1 is a graph showing the results of analysis of GsSIE3 gene expression in different tissue sites by qRT-PCR and RT-PCR after saline-alkali treatment; wherein A in FIG. 1 is the expression level of GsSIE3 gene at each part of a 3-week-old wild soybean plant, B in FIG. 1 is the expression level of GsSIE3 gene after treatment by different stress solutions, C in FIG. 1 is the expression level of GsSIE3 gene at different tissue parts of a 3-week-old wild soybean plant detected by RT-PCR, and D in FIG. 1 is the expression level of GsSIE3 gene of a 3-week-old wild soybean plant after treatment by different stress solutions detected by RT-PCR;

FIG. 2 is a graph showing the results of multiple alignments of amino acid sequences of proteins of the GsSIE3 family;

FIG. 3 is a diagram of the GsSIE 3E 3 ubiquitin ligase domain and RING domain; wherein A in FIG. 3 is a GsSIE 3E 3 ubiquitin ligase domain diagram, and B in FIG. 2 is a GsSIE 3E 3 ubiquitin ligase RING domain diagram;

FIG. 4 is a graph showing the results of physical association of GsSIE3 and GsSnRK1 by yeast binary hybridization;

FIG. 5 is a GsSIE3 subcellular localization map;

FIG. 6 is a graph of the results of confirming the interaction relationship of GsSIE3 and GsSnRK1 by GST-Pulldown and Co-IP; wherein, A in FIG. 6 is an in vitro protein interaction diagram, and B in FIG. 6 is a graph of the interaction result of Co-IP analysis GsSnRK1 and GsSIE3 in plant cells;

FIG. 7 is a graph showing the results of analysis of ubiquitin ligase activity of GsSIE3 protein; wherein a in fig. 7 is GsSIE3 self-ubiquitination map; b in FIG. 7 is a GsSIE3 self-ubiquitination site map, and C in FIG. 7 is a GsSIE3 polyubiquitination reaction map;

FIG. 8 is a Phos-tag ^TM And Western blot detection of the result graph of GsSnRK1 on GsSIE3, wherein A in FIG. 8 is a result graph of in vitro phosphorylation analysis by using a specific phosphorylation antibody, and B in FIG. 8 is a result graph of in vitro phosphorylation analysis of GsSIE3 by using a Phos-tag technology; c in FIG. 8 is a graph of in vitro phosphorylation site analysis of GsSIE3 by the Phos-tag technology, T514A is GsSIE3 (T514A), K49M is GsSnRK1 (K49M), D in FIG. 8 is a graph of in vitro phosphorylation site analysis of GsSIE3 re-verified by the Phos-tag technology, and E in FIG. 8 is a graph of in vitro phosphorylation site analysis re-performed by specific phosphorylated antibodies;

FIG. 9 is a graph showing the effect of phosphorylation sites on ubiquitin ligase activity; wherein A in FIG. 9 is a graph showing the effect of GsSnRK1 mutation site on ubiquitin ligase activity; b in FIG. 9 is a graph showing the effect of GsSIE3 phosphorylation site mutation on ubiquitin ligase activity;

FIG. 10 is a graph showing the stability results of GsSnRK1 affecting GsSIE 3;

FIG. 11 is a graph of the results of analysis of GsSnRK1 phosphorylated GsSIE3 in soybean hairy roots;

FIG. 12 is 200mM NaCl and 50mM NaHCO ₃ Phenotype map of transgenic chimeric soybean after treatment;

FIG. 13 is 200mM NaCl and 50mM NaHCO ₃ A physiological index analysis result graph of the processed transgenic chimeric soybean; wherein a and B in fig. 13 are biomass analyses, and C and D in fig. 13 are root length analyses;

FIG. 14 is 200mM NaCl and 50mM NaHCO ₃ A physiological index analysis result graph of the processed transgenic chimeric soybean; wherein A and D in FIG. 14 are chlorophyll content analyses, and B and E in FIG. 14 areMalondialdehyde content analysis, C and F in fig. 14 are proline content analysis;

FIG. 15 is a graph showing the results of physiological index analysis of transgenic chimeric soybeans after 200mM NaCl treatment; wherein a in fig. 15 is a trypan blue staining analysis result chart, B in fig. 15 is a DAB staining analysis result chart, and C in fig. 15 is a NBT staining analysis result chart;

FIG. 16 is a 50mM NaHCO ₃ A physiological index analysis result graph of the processed transgenic chimeric soybean; wherein a in fig. 16 is a trypan blue staining analysis result chart, B in fig. 16 is a DAB staining analysis result chart, and C in fig. 16 is a NBT staining analysis result chart.

Detailed Description

The experimental methods used in the following examples are all conventional methods unless otherwise specified; materials, reagents and the like used in the following examples are commercially available unless otherwise specified; the quantitative tests in the following examples were all performed in triplicate, and the results were averaged.

Wild soybean G07256 seeds, agrobacterium rhizogenes K599, saccharomyces cerevisiae (Saccharomyces cerevisiae) AH109, pET-32b, pGADT7 and pGBKT7 vectors, pPBEL-BiFC vectors, fusion protein prokaryotic expression recombinant vectors pGEX-4T-1-GsSnRK1.1, pET32b-Myc-GsSnRK1.1, pET32b-Flag-GsGRIK1 and recombinant proteins are disclosed in the patent application No. CN202210037002.2, and are publicly available from northeast agricultural university.

Coli competent Trans1-T1 Phage Resistant Chemically Competent Cell in the examples below is a product of Whole gold company; saccharomyces cerevisiae competent Y2HGold Chemically Competent Cell in the examples below is a product of Shanghai Biotechnology Inc.

The nucleotide sequences corresponding to the primers referred to in the examples below are shown in Table 1.

Table 1 nucleotide sequences corresponding to the primers referred to in the examples

Example 1: cloning of soybean E3 ubiquitin ligase GsSIE3 gene and expression pattern analysis thereof

1. Treatment of plant material

Selecting plump wild soybean (Glycine soja) G07256 seeds, concentrating with concentrated HgSO ₄ Treating for 10min, washing with sterilized water for 3-4 times, placing on wet filter paper, and treating in darkness at 4deg.C for vernalization for 3d. In a climatic chamber, wild soybean seedlings were cultured with 1/4Hoagland nutrient solution for 3 weeks to obtain seedlings of 3 weeks of age. The growth conditions are as follows: the relative humidity is 60 percent at 24 ℃, the illumination period is 16 hours of illumination and 8 hours of darkness.

2. RNA extraction

Total RNA of wild soybean seedlings was extracted by referring to the plant RNAkit instruction, and the extracted total RNA was immediately reverse transcribed or stored at-80 ℃.

3. cDNA acquisition

And (3) carrying out reverse transcription by using the total RNA obtained in the step (II) as a template and adopting a TransScript One-Step gDNARemoval andcDNASynthesis SuperMix kit to obtain cDNA.

4. PCR amplification

And (3) taking the cDNA obtained in the step (III) as a template, and adopting a GsSIE3-Clone-F (SEQ ID NO. 3) primer, a GsSIE3-Clone-R (SEQ ID NO. 4) primer and a PrimeSTARMax DNAPolymerase kit to carry out PCR amplification to obtain a PCR amplification product.

And (3) detecting the PCR amplified product by 1% agarose gel electrophoresis to obtain a band with the molecular weight slightly larger than 1kb, recovering the PCR amplified product by using an agarose gel recovery kit, connecting the PCR amplified product with a pEASY-Blunt Simple CloningKit carrier (TRANSGEN BIOTECH) to obtain a recombinant plasmid, naming the recombinant plasmid as pEASY-Blunt Simple-GsSIE3, converting the recombinant plasmid into escherichia coli Trans1-T1 competent cells, and delivering the competent cells to sequencing.

Sequencing results showed that: the amplified product with 1569bp is obtained by PCR amplification, the nucleotide sequence is shown as SEQ ID NO.1, the amplified product is named as GsSIE3 gene, the ORF is the 1 st-1569 th position of SEQ ID NO.1, and the amino acid sequence of the protein encoded by the GsSIE3 gene is shown as SEQ ID NO. 2.

SEQ ID NO.1：

ATGCTTGCATATGGGGTACACTTGAACGAGTTGAATCTAAAATGTGTTCTTATGATCATATTGATGATGATATTACCCATCCTAGGGTTGTTTTTCTGGCTAGAGAACAAGTTGTCCCATAATTCCAGTGAGGCCAATCATTACTCCAAATGGAAGGAACATTTGCAGATCAGTGATGAAATAAATACCCTATTTTGTGAACAAGATGAGAACAGTACTAGTGCACACTGTGCTTGCTCCTTCTGTGGAAGATTAAGCAACATAGTCACGAGATGCTCACGCTGCAAAGCTGCTATATATTGCTCGAATGCTTGCCATGTTAAGCATTGGAGGATTTGCCATAAATATGAATGCGTTGAGAAAGAAGGGTCACAAGATCAGCAGGAATCACCGTTTCATGGAACCCATTGCCTTATCATGGAGCCTGAAAATGGTAAGTTCTCATTCAGTGAAGTTATTGAGCAGAGATCATATAAGGGAGATGTTTACTATGTCGAAGGAGGAGAAAACAGTGCTGAGGTCAGTGATGAAACAGCTCTAAAGTGTAACGATGGCTGTGCAGTGTGTGGCAATCCAAGCTCTAAAGTATGCTCAAGGTGCAAAGCCATAAAATATTGCTCACAAACATGCCAACATTTCGATTGGAGATCTGGGCATAAGTTTCAATGTCTTGTTGAGAAGGCAAATACAACTGAAAAAGCAATTGTCAATCAAGGAAGACCTGCAAACGGAAATGTTGTAAATCTCACGAATTCGGATGAGGTAGAAGATAATGCTCATTCATCTAGTCCTCTTCGCTTGGAATTTTACTCAGGAAACACCAGTTCCAAGGCCCTGACTCGAAGTTCTTTGTCTCTGGAAGCAACCAATAATGCTCAGAAGGAGATTCAAGATCAATTGACAAGCCTAGAAGAAGAATTGGCAAAGATAAAAGAGGAGAACATGTCATTACTATCAGAGCGCGACGCATGGGAAGTGCGAGCAAGGAATTCCATAGATAGACTTTATAGCTTCAGGAAAGAAAATGAGCACCAGCTGTTTATTTTGAAGCATGAAAATGAATTGATGTCAAATGCTGAGAAGCAATCACGTCAAATGGTTAATAGTTTATCTCAGAGGCTACACTGCTTGCAGATTGCAGTGGAAAGTGGAGTTGAAGAGAGGAAAAAACAAGAAGAATATATACATATGTTGCAGAATGAATGTGCTAAGGTTAAGATAGAGCTACAAGAACAGAACAAGTGCGTCGAAAGGCTTACAGTAGAGCTGGATAAGAACACTCAATTTCCTAGGAGAATAACTGAAGAAACAGGACAAATATTAGTCAATGCTTTAAGTGAAATTGCAGCTGTTGAATCCAATGCTAACTGTGCTGAGGTGTCCCTGCCAATTAGTTTGAGCAGAAATCCAACCTTTACAACACAGGGTTGTTCAATTTGCCTAGCCAATGAGAAGAACATGGCCTTTGGTTGTGGACACATGACTTGTTTAGAGTGTGGATCAAAAATTCGCAAGTGTCATATATGCCGAAGGAAGATCACCATTCGTATCAGATTGTTTCCTGATTAA

SEQ ID NO.2：

MLAYGVHLNELNLKCVLMIILMMILPILGLFFWLENKLSHNSSEANHYSKWKEHLQISDEINTLFCEQDENSTSAHCACSFCGRLSNIVTRCSRCKAAIYCSNACHVKHWRICHKYECVEKEGSQDQQESPFHGTHCLIMEPENGKFSFSEVIEQRSYKGDVYYVEGGENSAEVSDETALKCNDGCAVCGNPSSKVCSRCKAIKYCSQTCQHFDWRSGHKFQCLVEKANTTEKAIVNQGRPANGNVVNLTNSDEVEDNAHSSSPLRLEFYSGNTSSKALTRSSLSLEATNNAQKEIQDQLTSLEEELAKIKEENMSLLSERDAWEVRARNSIDRLYSFRKENEHQLFILKHENELMSNAEKQSRQMVNSLSQRLHCLQIAVESGVEERKKQEEYIHMLQNECAKVKIELQEQNKCVERLTVELDKNTQFPRRITEETGQILVNALSEIAAVESNANCAEVSLPISLSRNPTFTTQGCSICLANEKNMAFGCGHMTCLECGSKIRKCHICRRKITIRIRLFPD

5. Real-time fluorescent quantitative PCR analysis of GsSIE3 expression pattern

cDNA of organs of 3-week old wild soybean seedlings and cDNA of organs of 3-week old wild soybean seedlings with primers GsSIE3-qPCR-F (SEQ ID NO. 5) and GsSIE3-qPCR-R (SEQ ID NO. 6) and DNA of organs of 3-week old wild soybean seedlings with 200mM NaCl or 50mM NaHCO ₃ Or 15% PEG or 10. Mu. MABA for 1 h.

From qRT-PCR results, the GsSIE3 gene was expressed in various organs of wild soybean plants, wherein the root expression level was relatively high, indicating that the GsSIE3 gene may be involved in salt stress response (see A and C in FIG. 1). With NaCl and NaHCO ₃ The results after 1h treatment of wild soybean plants showed that the expression of GsSIE3 can be affected by NaCl and NaHCO ₃ (see B and D in FIG. 1).

6. RT-PCR analysis of GsSIE3 in NaCl and NaHCO ₃ Expression patterns under stress

Wild soybean seedlings of 3 weeks old were treated with 100mM NaCl and 50mM NaHCO, respectively ₃ After 1h of treatment, samples were taken at the indicated times, which indicated that the transcript levels of GsSIE3 were driven by NaCl and NaHCO ₃ Upregulation increased GsSIE3 expression by about 2-fold and 3-fold.

Amino acid sequence alignment of the GsSIE3 protein with SIE3 family proteins in different plants using GeneDOC revealed that the similarity of the GsSIE3 protein to GmSIE3 in soybean was 100% and that the C-terminal of the SIE3 family protein was highly conserved with diversity at the N-terminal (see fig. 2).

According to SMART database, the functional domain and domain characteristics of GsSIE3 are found, and the result is shown in figure 3, wherein the GsSIE3 protein comprises four functional domains, and most importantly, the amino acid sequence comparison analysis of the C-terminal conserved RING-Ubox domain shows that the GsSIE3 comprises 1566bp complete ORF and codes 522 amino acidsThe protein has a molecular weight of about 58kDa. GsSIE3 has a highly conserved C3HC4 RING motif with other homologous proteins, its RING motif belongs to the HC subgroup and the RING domain is located at positions 477 to 522, near the C-terminus, E3 ubiquitin ligase activity requires RING and Zn ²⁺ Cys and His residues conserved in the sequence.

Example 2: interaction of GsSnRK1 with GsSIE3

1. Yeast binary hybridization to verify interaction of GsSnRK1 and GsSIE3

Construction of pGBKT7-GsSnRK1 and pGADT7-GsSIE3 expression vectors

1. Acquisition of GsSnRK1 Gene

The total cDNA of wild soybean is used as a template, and BD-GsSnRK1-SmaIF (SEQ ID NO. 7), BD-GsSnRK1-SalIR (SEQ ID NO. 8) primers and a PrimeSTAR Max DNAPolymerase kit are used for PCR amplification, so that PCR amplification products, namely GsSnRK1 genes, are obtained.

2. Construction of recombinant vector pGBKT7-GsSnRK1

And (3) respectively carrying out double enzyme digestion and connection on the pGBKT7 vector and the PCR amplification product by using restriction enzymes SmaI and SalI to obtain a pGBKT7-GsSnRK1 recombinant vector, and carrying out sequencing verification on the pGBKT7-GsSnRK1 recombinant vector.

Sequencing results showed that: the pGBKT7-GsSnRK1 recombinant vector is obtained by replacing a DNA fragment between SmaI and SalI enzyme cutting sites of the pGBKT7 vector with a GsSnRK1 gene and keeping other sequences of the pGBKT7 vector unchanged. pGBKT7-GsSnRK1 recombinant vector expresses GsSnRK1 protein.

3. Construction of recombinant vector pGADT7-GsSIE3

PCR amplification is carried out by taking pEASY-Blunt Simple-GsSIE3 plasmid as a template and adopting AD-GsSIE3-SmaIF (SEQ ID NO. 9) and AD-GsSIE3-SmaIR (SEQ ID NO. 10) primers and a PrimeSTARMax DNAPolymerase kit to obtain a PCR amplification product. The pGADT7 vector was digested with restriction enzyme SmaI, and SmaI cleavage site and homology arm to the vector portion were added to the upstream and downstream of GsSIE3 gene by PCR. The pGADT7 vector is subjected to single enzyme digestion by SmaI, and the enzyme digestion product is recovered and purified by gel and then is connected with the PCR product by homologous recombination enzyme. The obtained vector was named pGADT7-GsSIE3 after identification.

Sequencing results showed that: the pGADT7-GsSIE3 recombinant vector is obtained by inserting the SmaI restriction enzyme site of the pGADT7 vector into the GsSIE3 gene through homologous recombination and keeping other sequences of the pGADT7 vector unchanged. pGADT7-GsSIE3 recombinant vector expresses GsSIE3 protein.

(II) transformation of Yeast Y2HGold

The method comprises the steps of transforming saccharomycetes Y2HGold with two vectors pGBKT7-GsSnRK1 and pGADT7-GsSIE3, two empty vectors pGBKT7 and pGADT7-GsSIE3, two vectors pGBKT7-GsSnRK1 and pGADT7 and two vectors pGBKT7 and pGADT7 respectively to obtain plasmids pGBKT7-GsSnRK1 and pGADT7-GsSIE3, pGBKT7-GsSnRK1 and pGADT7, and specific steps of transforming saccharomycetes Y2HGold of pGBKT7 and pGADT7 respectively, and the specific steps of transforming saccharomycetes Y2HGold Chemically Competent Cell are referred to.

As shown in FIG. 4, the test group of yeast strains containing pGBKT7-GsSnRK1 and pGADT7-GsSIE3 recombinant vectors were able to grow normally on SD/-Trp/-Leu/-His (containing 20mM 3-AT) medium, while the blank control groups pGBKT7 and pGADT7 and the negative control groups pGBKT7 and pGADT7-GsSIE3, pGBKT7-GsSnRK1 and pGADT7 were unable to grow normally, and the result of X-alpha-gal staining further confirmed the result, indicating the interaction relationship between GsSnRK1 protein and GsSIE3 protein.

2. Arabidopsis protoplasts verify GsSIE3 interactions and localization

Construction of pCAM3301-EGFP-GsSIE3 vector

1. Acquisition of GsSIE3 Gene

PCR amplification is carried out by taking the pEASY-Blunt Simple-GsSIE3 plasmid as a template and adopting pCAM3301-EGFP-GsSIE 3F (SEQ ID NO. 11) and pCAM3301-EGFP-GsSIE 3R (SEQ ID NO. 12) primers and PrimeSTARMax DNAPolymerase (TaKaRa) kit to obtain a PCR amplification product, namely GsSIE3 gene.

2. Construction of pCAM3301-EGFP-GsSIE3 vector

And (3) carrying out single enzyme digestion and connection on the pCAM3301-EGFP vector by using restriction enzyme BamHI (New EnglandBiolabs) to obtain a pCAM3301-EGFP-GsSIE3 recombinant vector, and carrying out sequencing verification on the pCAM3301-EGFP-GsSIE3 recombinant vector.

Sequencing results showed that: the pCAM3301-EGFP-GsSIE3 recombinant vector is a vector obtained by inserting a BamHI enzyme cutting site of the pCAM3301-EGFP vector into a GsSIE3 gene and keeping other sequences of the pCAM3301-EGFP vector unchanged. Recombinant vector pCAM3301-EGFP-GsSIE3 expresses GsSIE3 protein.

(II) Arabidopsis protoplast transformation

The pCAM3301-EGFP-GsSIE3 vector is transformed into an Arabidopsis protoplast by adopting a polyethylene glycol method (specific method is shown in the description of a preparation and transformation kit of the Zhongkey plant protoplast), the Arabidopsis protoplast transformed with the pCAM3301-EGFP-GsSIE3 vector and the pCAM3301-EGFP empty vector is selected, and the Arabidopsis protoplast is loaded into a tablet and observed by using a laser confocal microscope. The results are shown in FIG. 5: the GsSIE3 protein is localized in the cytoplasm.

(III) extraction of Arabidopsis protoplast protein and Westernblot detection

The total protein is extracted after the phase Guan Zhili is expressed transiently in the arabidopsis protoplast, and the interaction relation between GsSnRK1 and GsSIE3 is analyzed by adopting a Co-IP technology. Immunoprecipitation (i.e., IP) of HA-GsSIE3 from all lysates by utilizing anti-HA, and Western blot detection of Myc-GsSnRK1 protein by anti-Myc antibody; and immunoprecipitation of Myc-GsSnRK1 from all lysates using anti-Myc, and Westernblot detection of HA-GsSIE3 protein by anti-HA antibody. The results are shown in FIG. 6B, where there is interaction between GsSnRK1 and GsSIE3 and protein complexes can be formed.

3. In vitro interaction of GsSnRK1 with GsSIE3

Construction of (one) protein expression vectors

1. Construction of recombinant vector pET32b-GsSnRK1

1) Acquisition of GsSnRK1 Gene

PCR amplification is carried out by taking pGBKT7-GsSnRK1 plasmid as a template and adopting pET-HA-GsSnRK1-SalIF (SEQ ID NO. 13), pET-HA-GsSnRK1-XhoIR (SEQ ID NO. 14) primer and PrimeSTARMax DNAPolymerase (TaKaRa) kit to obtain PCR amplification products, namely GsSnRK1 genes.

2) Construction of recombinant vector pET32b-GsSnRK1

And (3) respectively carrying out double enzyme digestion and connection on the pET32b vector and the PCR amplification product by using restriction enzymes SalI (New EnglandBiolabs) and XhoI (New EnglandBiolabs) to obtain a pET32b-GsSnRK1 recombinant vector, and carrying out sequencing verification on the pET32b-GsSnRK1 recombinant vector.

Sequencing results showed that: the pET32b-GsSnRK1 recombinant vector is obtained by replacing a DNA fragment between SalI and XhoI cleavage sites of the pET32b vector with a GsSnRK1 gene and keeping other sequences of the pET32b vector unchanged. The pET32b-GsSnRK1 recombinant vector expresses GsSnRK1 protein.

2. Construction of recombinant vector pET32b-GsSIE3

1) Acquisition of GsSIE3 Gene

The pEASY-Blunt Simple-GsSIE3 plasmid is used as a template, and pET-HA-GsSIE3-EcoRVF (SEQ ID NO. 17) and pET-HA-GsSIE3-EcoRVR (SEQ ID NO. 18) primers and PrimeSTAR Max DNAPolymerase (TaKaRa) kit are used for PCR amplification, so that a PCR amplification product, namely GsSIE3 gene, is obtained.

2) Construction of recombinant vector pET32b-GsSIE3

And (3) carrying out single enzyme digestion on the pET32b vector by adopting restriction enzyme EcoRV (New EnglandBiolabs), and then connecting GsSIE3 with the vector subjected to enzyme digestion purification by utilizing homologous recombinase to obtain the pET32b-HA-GsSIE3 recombinant vector.

Sequencing results showed that: the pET32b-GsSIE3 recombinant vector is obtained by single enzyme cutting of EcoRV of the pET32b vector, inserting the GsSIE3 gene, and keeping other sequences of the pET32b vector unchanged. The pET32b-GsSIE3 recombinant vector expresses GsSIE3 protein.

(II) GST-Pull Down

After prokaryotic expression, 50. Mu.l of GST-SnRK1 protein purified was incubated with GST filler in PBS solution at 4℃for 2h, then with His-GsSIE3 at 4℃for 2h, followed by washing with PBS solution and detection by Westernblot, as shown in FIG. 6A, gsSIE3 was able to bind to GsSnRK1 in vitro.

(III) analysis of GsSIE3 ubiquitin ligase Activity

1. Functional analysis of GsSIE3 ligase ligation

To determine the manner of attachment of polyubiquitin chains, we constructed Flag-Ub (WT), flag-Ub (K48) and Flag-Ub (K63) vectors and purified them for use in vitro ubiquitination assays, the results are shown as C in fig. 7 a and 7, with K48 protein being essentially identical to the results with WT protein, while K63 ubiquitin ligase activity is almost absent and the same results are obtained in vivo ubiquitination assays.

2. Autoubiquitination of GsSIE3

RING-Ubox domain and four mutants thereof (K9R, K26R, K29R, K36R) were constructed. The results are shown in FIG. 7B, where the addition of the wild-type RING-Ubox domain and its mutants resulted in accumulation of E3-Ub and the formation of high molecular weight bands was clearly observed. The K29R and K36R mutants have similar activities to the RING-Ubox domain. The K9R and K26R mutants were less ubiquitinated than the wild-type RING-Ubox domain. These data indicate that K9 and K26 of the RING-Ubox domain may be self ubiquitination sites of GsSIE 3.

(IV) phosphorylation analysis of GsSnRK and GsSIE3

Prediction of GsSnRK1 phosphorylation site on GsSIE3 by GsSnRK1 protein to perform phosphorylation function

The phosphorylation of GsSnRK1 protein was performed by an on-line tool (http:// ppsp. Biocuckoo. Org) and predicted by the GsSnRK1 phosphorylation site on GsSIE 3.

The results show that the 49 th amino acid lysine (K) of the GsSnRK1 protein is an important amino acid for the GsSnRK1 to perform the phosphorylation function, and threonine (T) at the 514 th site of the GsSIE3 protein is a putative phosphorylation site of the GsSnRK 1.

1. Construction of recombinant vector pET32b-GsSnRK1 (K49M)

1) Acquisition of GsSnRK1 (K49M) Gene

The base AAG of the GsSnRK1 gene sequence encoding the 49 th amino acid is replaced by ATG, so that the 49 th amino acid of the GsSnRK1 protein is mutated from lysine (K) to methionine (M), the mutated GsSnRK1 gene is synthesized again by people and is named as GsSnRK1 (K49M), and the GsSnRK1 (K49M) protein encoded by the GsSnRK1 (K49M) gene has no phosphorylation function.

PCR amplification is carried out by taking GsSnRK1 (K49M) gene as a template and adopting pET-HA-GsSnRK1 (K49M) -SalIF (SEQ ID NO. 15), pET-HA-GsSnRK1 (K49M) -XhoIR (SEQ ID NO. 16) primers and PrimeSTARMax DNAPolymerase (TaKaRa) kit to obtain PCR amplification products, namely the GsSnRK1 (K49M) gene with enzyme cutting sites.

2) Construction of recombinant vector pET32b-GsSnRK1 (K49M)

And (3) respectively carrying out double enzyme digestion and connection on the pET32b vector and the PCR amplification product by using restriction enzymes SalI (New EnglandBiolabs) and XhoI (New EnglandBiolabs) to obtain a pET32b-GsSnRK1 (K49M) recombinant vector, and carrying out sequencing verification on the pET32b-GsSnRK1 (K49M) recombinant vector.

Sequencing results showed that: the pET32b-GsSnRK1 (K49M) recombinant vector is a vector obtained by replacing a DNA fragment between SalI and XhoI cleavage sites of the pET32b vector with a GsSnRK1 (K49M) gene and keeping other sequences of the pET32b vector unchanged. The pET32b-GsSnRK1 (K49M) recombinant vector expresses GsSnRK1 (K49M) protein.

2. Construction of recombinant vector pET32b-GsSIE3 (T514A)

1) Acquisition of the GsSIE3 (T514A) Gene

The base ACC of the GsSIE3 gene sequence encoding 514 th amino acid is replaced by GCC, so that the 514 th amino acid of the GsSIE3 protein is mutated from threonine (T) to alanine (A), a primer pair with nucleotide sequences shown in SEQ ID NO.23 and SEQ ID NO.24 is adopted to amplify a T514 site mutated gene and named GsSIE3 (T514A), and the GsSIE3 (T514A) protein encoded by the GsSIE3 (T514A) gene does not have the phosphorylation capacity of GsSnRK1 protein.

PCR amplification is carried out by taking GsSIE3 (T514A) gene as a template and adopting pET-HA-GsSIE3 (T514A) -EcoRV (SEQ ID NO. 19), pET-HA-GsSIE3 (T514A) -EcoRVR (SEQ ID NO. 20) primer and PrimeSTARMax DNAPolymerase (TaKaRa) kit to obtain PCR amplification products, namely the GsSIE3 (T514A) gene with enzyme cutting sites.

2) Construction of recombinant vector pET32b-GsSIE3 (T514A)

And (3) carrying out single enzyme digestion on the pET32b vector by adopting restriction enzyme EcoRV, and then connecting GsSIE3 (T514A) with the vector subjected to enzyme digestion purification by utilizing homologous recombinase to obtain the pET32b-HA-GsSIE3 (T514A) recombinant vector.

Sequencing results showed that: the pET32b-GsSIE3 (T514A) recombinant vector is a vector obtained by single digestion of EcoRV of the pET32b vector, insertion of the GsSIE3 (T514A) gene and maintenance of other sequences of the pET32b vector. The pET32b-GsSIE3 (T514A) recombinant vector expresses GsSIE3 (T514A) protein.

Expression and purification of proteins

The protein expression vectors pET32b-GsSnRK1, pET32b-GsSnRK1 (K49M), pET32b-GsSIE3 and pET32b-GsSIE3 (T514A) are respectively transformed into competent E.coli BL 21. BL21 E.coli containing pET32b-GsSnRK1, pET32b-GsSnRK1 (K49M), pET32b-GsSIE3 and pET32b-GsSIE3 (T514A) protein expression vectors were obtained and protein expression was induced, respectively.

Purifying the expressed GsSnRK1, gsSnRK1 (K49M), gsSIE3 and GsSIE3 (T514A) proteins respectively, wherein the purification of the GsSnRK1 and GsSnRK1 (K49M) proteins is performed by using a Myc fusion protein purification kit provided by Shanghai Setaria research industry Co., ltd, and specific steps are shown in a kit specification; gsSIE3 and GsSIE3 (T514A) proteins were purified using the well-known century His-Tagged Pro tein Purifica tion Kit kit, and specific steps are described in the kit specification.

(six) Phos-tag ^TM Detection of GsSnRK1 phosphorylation of GsSIE3

By using Phos-tag ^TM The kit is used for respectively detecting the phosphorylation level of GsSnRK1 to GsSIE3 and GsSnRK1 to GsSIE3 (T514A), and the specific operation steps are detailed in Phos-tag ^TM Kit instructions.

The result is shown as B in fig. 8, C in fig. 8 and D in fig. 8: gsSnRK1 has a phosphorylating effect on GsSIE3, and GsSnRK1 has no phosphorylating effect on GsSIE3 (T514A). The GsSnRK1 protein has phosphorylation effect on GsSIE3 protein, and the 514 th amino acid T of GsSIE3 is a key phosphorylation site of GsSnRK 1.

(seventh) Western blot detection of GsSnRK1 phosphorylation of GsSIE3

The phosphorylation levels of GsSnRK1 to GsSIE3, gsSnRK1 to GsSIE3 (T514A), and GsSnRK1 (K49M) to GsSIE3 (T514A) were detected using Westernblot, respectively. The presence or absence of phosphorylation was detected using a ppqdsub antibody, the content of GsSIE3 and GsSIE3 (T514A) was detected using a HA antibody, and the content of GsSnRK1 and GsSnRK1 (K49M) was detected using a Myc antibody.

The results are shown as a in fig. 8 and E in fig. 8: the phosphorylation of GsSnRK1 on GsSIE3 was detected with the pPKDsub antibody, whereas GsSnRK1 had no phosphorylation on GsSIE3 (T514A) and GsSnRK1 (K49M) on GsSIE 3. Again, it was demonstrated that GsSnRK1 protein has a phosphorylation effect on GsSIE3 protein, and amino acid K at position 49 of GsSnRK1 is an important amino acid for GsSnRK1 to perform a phosphorylation function, and amino acid T at position 514 of gssnsie 3 is a key phosphorylation site of GsSnRK 1.

(eight) modulation of GsSIE3 ubiquitin ligase function by GsSnRK1

The ubiquitination experiments were performed by incubating phosphorylated GsSIE3 with GsSnRK1 and GsSnRK1 (K49M), respectively.

As shown in FIG. 9A, the phosphorylated form of GsSIE3 enhances the activity of its ligase. Then, the ability of GsSIE3 phosphorylation status to affect its E3 ligase activity was also examined. GsSIE3 and its GsSIE3 (T514A), gsSIE3 (T495A) and Flag-Ub were purified for ubiquitination analysis. As shown in FIG. 9B, gsSIE3 (T514A) showed reduced self-ubiquitination activity, and similar results were observed by anti-Flag immunoblotting analysis.

Regulation of GsSIE3 stability by GsSnRK1

Different transgenic hairy root crude protein extracts (WT, gsSnRK1, gsSnRK (K49M)) were incubated with purified GsSIE3 and GsSIE3 (T514A).

As a result, as shown in FIG. 10, in the presence of ATP, gsSIE3 degraded much faster than GsSnRK1 (K49M) and GsSIE3 (T514A), but slower than GsSnRK1 overexpressing plants. These results indicate that GsSnRK1 may regulate the stability of GsSIE3, whereas GsSnRK 1-mediated phosphorylation of GsSIE3 is essential for its degradation. To further confirm the results, we generated GsSnRK1 over-expression and GsSnRK1 (K49M) over-expressed transgenic hairy roots in the GsSIE3 over-expression background and treated with Cycloheximide (CHX) to inhibit subsequent protein synthesis. The results are shown in FIG. 10, where overexpression of GsSnRK1 resulted in decreased GsSIE3 protein levels. In contrast, overexpression of GsSnRK1 (K49M) was more stable. Furthermore, in transgenic hairy roots against GsSIE3 (T514A), gsSIE3 degraded much slower than wild-type GsSIE 3. The addition of MG132 can effectively reduce protein degradation. These results indicate that GsSnRK1 phosphorylates GsSIE3 negatively regulating its stability and allowing it to be degraded by the 26S proteasome.

Example 3: genetic transformation of GsSIE3 and expression analysis in transgenic soybeans

1. Agrobacterium rhizogenes K599 mediated genetic transformation of transgenic soybean hairy roots and phenotypic analysis of plants under saline-alkali stress

1. Construction of pPBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 expression vector

1) Obtaining GsSnRK1 (K49M) gene by taking the GsSnRK1 (K49M) gene as a template, and carrying out PCR amplification by using BiFC-GsSnRK1 (K49M) -SmaIF (SEQ ID NO. 21) and BiFC-GsSnRK1 (K49M) -SmaIR (SEQ ID NO. 22) primers and PrimeSTARMax DNAPolymerase (TaKaRa) kit to obtain PCR amplification products, namely the GsSnRK1 (K49M) gene with enzyme cutting sites.

2) Construction of pBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 vector

And (3) respectively carrying out double digestion and connection on the PBEL-BiFC-GsSnRK1-GsSIE3 vector and the PCR amplified product of the GsSnRK1 (K49M) gene by using restriction endonucleases SmaI and SalI to obtain a PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 recombinant vector, and carrying out sequencing verification on the PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 recombinant vector.

Sequencing results showed that: the pBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 recombinant vector is formed by replacing GsSnRK1 fragment between SmaI and SalI cleavage sites of the pBEL-BiFC-GsSnRK1-GsSIE3 vector with GsSnRK1 (K49M) gene, and other sequences of the pBEL-BiFC-GsSnRK1-GsSIE3 vector are kept unchanged. The resulting vector pPBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 recombinant vector expresses GsSnRK1 (K49M) and GsSIE3 proteins.

2. Construction of pPBEL-BiFC-GsSnRK1-GsSIE3 (T514A) expression vector

1) The GsSIE3 (T514A) gene is obtained by taking the GsSIE3 (T514A) gene as a template, and carrying out PCR amplification by using BiFC-GsSIE3 (T514A) -PmlIF (SEQ ID NO. 27) and BiFC-GsSIE3 (T514A) -PmlIR (SEQ ID NO. 28) primers and PrimeSTARMax DNAPolymerase (TaKaRa) kit to obtain a PCR amplification product, namely the GsSIE3 (T514A) gene with enzyme cutting sites.

2) Construction of PBEL-BiFC-GsSnRK1-GsSIE3 (T514A) vector

The PBEL-BiFC-GsSnRK1-GsSIE3 vector is subjected to single enzyme digestion by using restriction enzyme PmlI, and is connected by homologous recombination enzyme to obtain a PBEL-BiFC-GsSnRK1-GsSIE3 (T514A) recombinant vector, and sequencing verification is carried out on the PBEL-BiFC-GsSnRK1-GsSIE3 (T514A) recombinant vector.

Sequencing results showed that: the pBEL-BiFC-GsSnRK1-GsSIE3 (T514A) recombinant vector is characterized in that the GsSIE3 fragment between the PmlI enzyme cutting sites of the pBEL-BiFC-GsSnRK1-GsSIE3 vector is replaced by the GsSIE3 (T514A) gene, and other sequences of the pBEL-BiFC-GsSnRK1-GsSIE3 vector are kept unchanged. The obtained vector pPBEL-BiFC-GsSnRK1-GsSIE3 (T514A) recombinant vector expresses GsSnRK1 and GsSIE3 (T514A) proteins.

3. Construction of pPBEL-BiFC-GsSnRK1-GsSIE3 expression vector

1) Acquisition of GsSnRK1 and GsSIE3 genes

The PCR products of GsSnRK1 and GsSIE3 are obtained by respectively adopting BiFC-GsSnRK1-SmaIF and BiFC-GsSnRK1-SmaIR primers, biFC-GsSIE3-PmlIF and GsSIE3-PmlIR primers and a PrimeSTARMax DNAPolymerase (TaKaRa) kit according to the method.

2) Construction of pPBEL-BiFC-GsSnRK1-GsSIE3 expression vector

The PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 recombinant vector is obtained by single enzyme digestion of the PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3 vector by connection of homologous recombination enzyme, and sequencing verification is carried out on the PBEL-BiFC-GsSnRK1-GsSIE3 recombinant vector.

Sequencing results showed that: the pBEL-BiFC-GsSnRK1-GsSIE3 recombinant vector is characterized in that GsSIE3 fragments among PmlI enzyme cutting sites of the pBEL-BiFC-GsSnRK1-GsSIE3 vector are replaced by GsSIE3 genes, and other sequences of the pBEL-BiFC-GsSnRK1-GsSIE3 vector are kept unchanged. The obtained vector pPBEL-BiFC-GsSnRK1-GsSIE3 recombinant vector expresses GsSnRK1 and GsSIE3 proteins.

2. Obtaining transgenic soybean hairy root

Soybean Williams82 seeds were sown in soil (soil: vermiculite=1:1) approximately 1-2cm deep. Placing in a constant temperature climatic chamber, watering every day at 28deg.C/20 deg.C/night, and taking young seedlings of 6 d-old cotyledons which are not developed for K599 infection. The K599 Agrobacterium rhizogenes bacterial solutions containing the recombinant vectors pPBEL-BiFC-GsSnRK1, PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3, PBEL-BiFC-GsSnRK1-GsSIE3 (T514A), pBEL-BiFC-GsSnRK1-GsSIE3 and the K599 Agrobacterium rhizogenes bacterial solutions without any vector were injected into the cotyledon sections of the soybean by a syringe, and the soybean cotyledon sections were covered after infection. After hairy roots grow out, the infection sites and the following parts are buried by vermiculite, so that the infection sites and the following parts are kept moist, the temperature is 28 ℃, the illumination is 14 h/the darkness is 10h, the temperature is 20 ℃ at daytime and 28 ℃ at night, and the culture is carried out for 30 days, so that a moist environment is kept. After 30d of hairy roots had grown, when the hairy roots were grown to about 10cm, the main roots were subtracted and the composite plants were buried in the mixed soil (nutrient soil: vermiculite=1:1), water was poured every 3 d. After 45d growth of hairy roots, for identification and subsequent phenotypic analysis.

3. Identification of transgenic Soy hairy roots

1) Identification of transgenic soybean hairy roots of pPBEL-BiFC-GsSnRK1, PBEL-BiFC-GsSnRK1 (K49M) -GsSIE3, PBEL-BiFC-GsSnRK1-GsSIE3 (T514A), pBEL-BiFC-GsSnRK1-GsSIE3

Taking soybean hairy roots with the length of 5mm by using a PCR method, placing the soybean hairy roots into a centrifuge tube, adding 35 mu l of Lysis BufferA, heating for 10min at 95 ℃, standing, and taking 1 mu l of supernatant as a template of a PCR reaction system. PCR amplification is carried out by respectively adopting a BiFC-FW (SEQ ID NO. 25) primer and a BiFC-RW (SEQ ID NO. 26) primer and a PrimeSTARMax DNAPolymerase (TaKaRa) kit, and specific gene fragments carried by pPBEL-BiFC-GsSnRK1, PBEL-BiFC-GsSnRK1 (K49M) -GsSiE3, PBEL-BiFC-GsSnRK1-GsSiE3 (T514A) and pBEL-BiFC-GsSnRK1-GsSiE3 vectors are detected by PCR to obtain PCR amplification products. Specific fragments were cloned, indicating that the relevant genes of interest have been expressed in the transgenic soybean hairy roots.

2. Analysis of GsSnRK1 phosphorylated GsSIE3 in transgenic Soy hairy roots

1. Analysis of in vivo phosphorylation of transgenic Soy hairy root GsSnRK1 GsSIE3

Williams82 soybeans were rooted using Agrobacterium rhizogenes K599 containing the above-described corresponding plasmids pPBEL-BiFC, pPBEL-BiFC-GsSnRK1-GsSiE3, pPBEL-BiFC-GsSnRK1 (K49M) -GsSiE3, pPBEL-BiFC-GsSnRK1-GsSiE3 (T514A), pPBEL-BiFC-GsSnRK1 (K49M) -GsSiE3 (T514A), and after growing hairy roots 30d, the hairy roots were subtracted, and genotyping was performed on the hairy roots by the above-described PCR method, respectively, to confirm integration of the target genes into plant chromosomes. After 45d growing up the hairy root, the transgenic chimeric soybean plants were treated with 200mM NaCl for 2h to extract the hairy root total protein. anti-Myc and anti-HA antibodies were used to confirm the expression of Myc-GsSnRK1 and HA-GsSIE3, respectively, in total protein.

The results are shown in FIG. 11, in which Myc-GsSnRK1 and its mutants and HA-GsSIE3 and its mutants were expressed in the corresponding hairy roots. The transgenic soybean complex plants were treated with 200mM NaCl or 50mM NaHCO ₃ Treated, and protein (+MG 132) was extracted from the transgenic hairy roots. The activity of GsSnRK1 is known to be generally activated by phosphorylation. To determine whether salt stress activated GsSnRK1, the phosphorylation level of GsSnRK1 in soybean was determined using AMPK alpha (Thr 172) antibody. Western blotting showed that GsSnRK1 could be phosphorylated prior to 200mM NaCl treatment, with increased phosphorylation after 200mM NaCl treatment. Meanwhile, to verify whether GsSnRK1 phosphorylates downstream ubiquitin ligase after being activated, PKD antibodies were used to detect the phosphorylation level of GsSIE3. The activity of GsSnRK1 was enhanced by 200 mnacl treatment, resulting in an increase in the level of phosphorylated GsSIE3, but not the phosphorylation of GsSIE3 (T514A), nor the phosphorylation of GsSnRK1 (K49M) of GsSIE3. These results are consistent with in vitro phosphorylation. These results indicate that GsSnRK1 may act as an upstream kinase to phosphogssie 3, which is essential for salt tolerance of soybeans.

3. Phenotype and physiological index analysis of transgenic soybean plants under saline-alkali stress

1. Phenotypic analysis of transgenic soybean plants

After they were cultured in Hoagland's nutrient solution or Hoagland's nutrient solution containing 200mM NaCl, respectively, for 10 days, the surface form and the relevant physiological data were analyzed. All experimental techniques and biology were repeated 3 times each by counting physiological indexes such as root length, fresh weight, dry weight, chlorophyll content, trypan blue staining, NBT staining, DAB staining, etc.

As shown in FIG. 11, the growth status of each group of plants was similar under normal conditions, and after salt treatment, the plants were stagnant in growth with overexpressing empty plants, coexpression GsSnRK1 (K49M)/GsSIE 3 (wt), coexpression GsSnRK1 (wt)/GsSIE 3 (T514A), and coexpression GsSnRK1 (K49M)/GsSIE 3 (T514A) transgenic chimeric soybean plants, showing severe leaf yellowing and wilting. The most preferred transgenic chimeric soybean plants for growth status are those co-expressing GsSnRK1 (wt)/GsSIE 3 (wt), and those over-expressing GsSnRK1 and GsSIE3 alone have growth status between those of the two.

As shown in FIG. 12, under 200mM NaCl treatment, gsSnRK1/GsSIE3 had healthier leaves, showed the highest salt tolerance and the highest root length and biomass, while the mutants containing GsSnRK1 (K49M)/GsSIE 3 or GsSnRK/GsSIE3 (T514A) grew slowly, the leaves appeared to severely wilt, showing lower plant resistance, indicating that GsSnRK1 might act upstream kinase regulation on GsSIE3, feel stress signals, and phosphorylate GsSIE3 in turn, and thus respond to stress. As shown in FIG. 13, 50mM NaHCO compared to 200mM NaCl treatment ₃ The treatment significantly reduced the phenotype exhibited by the plant, the increase in biomass, and the increase in root length. Notably, gsSIE3 also exhibited some resistance, indicating that GsSIE3 confers tolerance to salt stress in soybean to plants. Overall, the kinase activity of GsSnRK1 is essential for GsSIE3 to function, and GsSnRK1 negatively regulates the stability of GsSIE3 protein, thereby increasing the resistance of plants to salt and alkaline stress. Chlorophyll can perform photosynthesis to absorb light energy, and the content of the chlorophyll affects the strength of photosynthesis, and some bad environmental conditions affect the synthesis of chlorophyll. As shown in fig. 14, the chlorophyll content was substantially uniform for each group prior to stress treatment. After treatment with 200mM NaCl and 50mM NaHCO3, the roots of the complexes were injured, resulting in a decrease in chlorophyll content of the leaves of the complexes, wherein the chlorophyll content of GsSnRK1 (K49M)/GsSIE 3 and GsSnRK1/GsSIE3 (T514A) mutants decreased most rapidly, while the chlorophyll content of GsSnRK1/GsSIE3 was decreased most rapidlyMinimal reduction, thus, it can be seen that GsSnRK1/GsSIE3 is more salt tolerant, while GsSnRK1 (K49M)/GsSIE 3 and GsSnRK1/GsSIE3 (T514A) mutants are more sensitive to stress. Malondialdehyde (MDA) is produced by peroxidation of membrane lipid of tissues or organs of a human body, which is damaged by aging or under stress, and the content of Malondialdehyde (MDA) is closely related to aging and stress injury of the human body, and the higher the content of peroxide is, the higher the damage of plants is. Prior to stress treatment, the MDA content of each group was substantially consistent. After treatment with 200mM NaCl and 50mM NaHCO3, the GsSnRK1 (K49M)/GsSIE 3 and GsSnRK1/GsSIE3 (T514A) mutants had the highest MDA content, while the GsSnRK1/GsSIE3 MDA content was the lowest, indicating that GsSnRK1/GsSIE3 is more salt tolerant than the GsSnRK1 (K49M)/GsSIE 3 and GsSnRK1/GsSIE3 (T514A) mutants. Proline (Pro) also reflects a degree of stress resistance to a degree, with higher Pro content and stronger plant resistance. As shown in FIG. 14, the Pro content was substantially consistent for each group prior to stress treatment. After treatment with 200mM NaCl and 50mM NaHCO3, the GsSnRK1/GsSIE3 Pro content was highest, while the GsSnRK1 (K49M)/GsSIE 3 and GsSnRK1/GsSIE3 (T514A) mutants had the lowest Pro content, which also indicated that the co-expressed complex was more salt tolerant than the mutants.

Under salt stress, cells will actively and orderly die and H will be produced in order to maintain the internal environment ₂ O ₂ And O ₂ ^- To regulate various physiological and biochemical processes. As shown in FIGS. 15 and 16, trypan blue, DAB and NBT staining after 200mM NaCl treatment indicated that GsSIE3 and GsSnRK1 leaf portions died and were O-stained compared to empty vector ₂ ^- Oxidation to produce small amounts of H ₂ O ₂ However, most of the leaves of the GsSnRK1 (K49M)/GsSIE 3 and GsSnRK1/GsSIE3 (T514A) mutants die and are oxidized by O2 to produce a large amount of H ₂ O ₂ . Similar phenomena were generated with 50mM NaHCO3 treatment, suggesting that the hairy root of the transgene may have an effect on the aerial parts. In general, gsSIE3 (T514A) can inhibit the normal function of endogenous GsSIE3, and the phosphorylation state of Thr514 in GsSIE3 is critical to the function of the protein in response to NaCl and NaHCO3 stress.

While the invention has been described in terms of preferred embodiments, it is not intended to be limited thereto, but rather to enable any person skilled in the art to make various changes and modifications without departing from the spirit and scope of the present invention, which is therefore to be limited only by the appended claims.

Claims (10)

1. The plant salt-tolerant protein GsSIE3 is characterized in that the amino acid sequence of the plant salt-tolerant protein GsSIE3 is shown as SEQ ID NO. 2.

2. The coding sequence of the plant salt and alkali resistant protein GsSIE3 as claimed in claim 1, wherein the coding sequence is shown in SEQ ID NO. 1.

3. A biological material associated with the coding sequence of claim 2, wherein the biological material is any one of the following materials:

a1 An expression cassette comprising said coding sequence;

a2 A recombinant vector comprising said coding sequence;

a3 A recombinant microorganism comprising said coding sequence.

4. A biomaterial according to claim 3, wherein the biomaterial is any one of the following materials:

a4 A recombinant vector comprising the expression cassette of A1);

a5 A recombinant microorganism comprising the expression cassette of A1);

a6 A) a recombinant microorganism comprising the recombinant vector of A2).

5. Use of a plant salt-tolerant protein GsSIE3 according to claim 1, a coding sequence according to claim 2 or a biological material according to any one of claims 3 or 4 for increasing the salt tolerance of soybeans.

6. The use according to claim 5, characterized in that the use is overexpression of the protein GsSIE3 or the co-expression of the proteins GsSIE3 and GsSnRK1 in plants.

7. Use of a plant salt and alkali resistant protein GsSIE3 of claim 1, a coding sequence of claim 2 or a biological material of any one of claims 3 or 4 for increasing alkali resistance of soybeans.

8. The use according to claim 7, characterized in that the use is overexpression of the protein GsSIE3 or the co-expression of the proteins GsSIE3 and GsSnRK1 in plants.

9. A method for cultivating transgenic soybean hairy roots with salt tolerance, characterized in that the method is to introduce a gene encoding a protein GsSIE3 into soybean hairy roots or to introduce a gene encoding a protein GsSIE3 and a gene encoding a GsSnRK1 protein into soybean hairy roots; the nucleotide sequence of the gene encoding the protein GsSIE3 is shown as SEQ ID NO. 1.

10. A method for cultivating alkali-resistant transgenic soybean hairy roots, characterized in that the method is to introduce a gene encoding a protein GsSIE3 into soybean hairy roots or introduce a gene encoding a protein GsSIE3 and a gene encoding a GsSnRK1 protein into soybean hairy roots; the nucleotide sequence of the gene encoding the protein GsSIE3 is shown as SEQ ID NO. 1.