CN116590340A

CN116590340A - Application of SDD1 gene in regulation and control of nutrient growth of poplar, water saving and drought tolerance and method for obtaining transgenic poplar by overexpression of SDD1 gene

Info

Publication number: CN116590340A
Application number: CN202310746343.1A
Authority: CN
Inventors: 康向阳; 夏宇飞
Original assignee: Beijing Forestry University
Current assignee: Beijing Forestry University
Priority date: 2023-06-25
Filing date: 2023-06-25
Publication date: 2023-08-15

Abstract

The invention belongs to the technical field of plant biology, and relates to application of an SDD1 gene in regulating and controlling nutrient growth, water conservation and drought tolerance of poplar, and application of serine protease SDD1 for encoding bacillus subtilis (Bacillus subtilis) protease in regulating and controlling plant stomatal density, drought resistance or/and nutrient growth. The invention can reduce plant stomatal density by genetic transformation over-expressing PagSDD1 gene, improve plant water utilization efficiency, further save water and enhance drought resistance, and promote plant nutrition growth by positively regulating and controlling PagLHCB2.1 and PagGRF5 gene expression. The over-expression SDD1 gene is applied to reducing the pore density of poplar, promoting the nutrition growth, saving water and drought, and providing gene resources and technical methods for cultivating plant varieties with low water consumption and high yield.

Description

Application of SDD1 gene in regulation and control of nutrient growth of poplar, water saving and drought tolerance and method for obtaining transgenic poplar by overexpression of SDD1 gene

Technical Field

The invention belongs to the technical field of genetic engineering, in particular to a woody plant gene and application thereof, and particularly relates to a poplar PagSDD1 gene and application thereof and a method for obtaining a transgenic plant of the gene.

Background

It is well known that many genes have a causal pleiotropic function. The over-expression of most stress-resistance related genes can lead to dwarfing of plants. For example, transformation of poplar with ERF194 gene of AP2/ERF family has increased drought tolerance, but plant growth is inhibited (Wang, fan et al 2022). Soybean over-expressed MYB14 plants are dwarfed and have improved drought tolerance, but have relatively higher yields when grown at high density under field conditions (Chen, yang et al 2021). HARDY is an AP2/ERF-like transcription factor identified in Arabidopsis mutants, which exhibits drought resistance by enhancing root strength, branching and cortical cells, and in rice, the gene-overexpressed plants exhibit higher biomass in the upper part under good irrigation conditions, guarantee of water supply by increasing root biomass under drought stress, and increase in water utilization efficiency (Karaba, dixit et al 2007). The poplar over-expression PtmiR169o plant obviously improves photosynthetic rate, and roots and stems show obvious growth advantages, mainly by inhibiting the expression of a target gene PtNF-YA6 to reduce the water loss rate of leaves and enhance drought resistance (Jiao, lian et al 2021). At present, research reports of functional genes with forward regulation of plant vegetative growth and drought resistance are fresh.

The stomata consist of a pair of guard cells, which have the effect of regulating the exchange of gases for photosynthesis, and at the same time the loss of water, etc. (Danzer, mellott et al 2015, chen, wu et al 2020). The stomata are asymmetrically divided from undifferentiated meristematic blast (MMC) to form meristematic blast, which is then differentiated into guard blast, and the guard cell is generated by symmetrical division. Basic helix-loop-helix (bHLH) transcription factors play a central direct regulatory role in these stages. The bHLH transcription factor SPEECHLESS (SPCH) initiates the stomatal cell lineage by inducing a first asymmetric division to give rise to meristematic cells. MUTE and FAMA direct the differentiation of meristematic cells into guard blasts (GMCs) and subsequently Guard Cells (GC), respectively. Meanwhile, the air hole is indirectly regulated by a plurality of positive regulating factors and negative regulating factors in the air hole forming process, for example, EPF1 and EPF2 are both negative regulating factors for air hole forming, and can reduce the SPCH level so as to inhibit air hole forming. Besides inhibiting the formation of air holes, EPF1 can also regulate the water utilization efficiency and drought resistance of plants to be positive regulation factors for the formation of air holes by regulating the density of air holes, and researches show that the EPF1 has a certain influence on the drought resistance of plants. SDD1 has been reported to be a stomatal density inhibitor which produces extracellular signals through meristem/protective blast cells and relies on TMM activity to inhibit stomatal development, but SDD1 has not been reported to date to affect drought resistance of plants and how to affect vegetative growth.

Disclosure of Invention

The invention aims to improve the yield and drought resistance of poplar, and provides application of a poplar PagSDD1 gene in regulation and control of air pore density, drought resistance and nutrition growth and obtaining of transgenic poplar with low air pore density and high drought resistance, wherein the gene can reduce the air pore density; the genetic engineering technology is utilized to over-express the PagSDD1 gene of the poplar, so that the pore density of the leaf of the obtained transgenic poplar is obviously reduced, and the drought resistance of the poplar is obviously enhanced; through the PagSDD1 gene which is over-expressed in the transgenic poplar, the expression of PagLHCB2.1 and PagGRF5 genes is promoted, so that the nutritional growth of the transgenic poplar is promoted, the yield of the poplar is improved, and the method has important significance for germplasm innovation of the poplar, strong drought resistance and breeding of high-yield poplar varieties.

In order to achieve the purpose of the invention, the invention is realized by the following technical scheme:

in one aspect, the invention provides a poplar PagSDD1 gene.

Wherein the poplar is preferably silver adenophora. In addition to poplar, other woody plants such as eucalyptus, pagodatree, pine, and the like are also suitable.

In particular, the PagSDD1 gene sequence is: SEQ ID NO.3.

On the other hand, the invention provides an application of the SDD1 gene in regulating and controlling the nutrient growth of poplar, water conservation and drought tolerance.

The application of the poplar PagSDD1 gene in regulating and controlling the pore density, drought resistance and/or nutrient growth of poplar.

In particular, the regulation of the pore density of the poplar refers to the reduction of the pore density of the poplar leaves; the drought resistance is to increase the drought resistance of poplar and reduce the water loss rate of poplar; the vegetative growth is to obviously increase the plant height and the basal diameter of poplar and promote the growth of poplar.

In particular, the vegetative growth is to promote the expression of PagLHCB2.1 and PagGRF5 genes of poplar by over-expression of PagSDD1 genes, so as to promote the nutrient absorption and growth of poplar, increase the plant height and the basal path of poplar and improve the yield of poplar.

In particular, excessive PagSDD1 expression reduces the pore density in poplar, enhances drought resistance and reduces poplar moisture damage; by promoting the expression of PagLHCB2.1 and PagGRF5 genes, the nutrient growth of poplar is promoted

In a second aspect, the invention provides an application of serine protease SDD1 gene of bacillus subtilis (Bacillus subtilis) protease in regulating and controlling stomatal density, drought resistance or/and enhancing plant nutrition growth of woody plants.

Wherein the woody plant is poplar, eucalyptus, pagodatree, pine, preferably Populus delphinii.

In particular, the regulation of the stomatal density of woody plants means the reduction of the stomatal density of plant leaves; the drought resistance refers to the performance of the plants for resisting drought, and the moisture loss rate of woody plants is reduced; the vegetative growth is to obviously increase the plant height and the basal diameter of woody plants and promote the plant growth.

In a third aspect, the invention provides a recombinant expression vector comprising the nucleotide sequence of poplar PagSDD 1.

Wherein, the recombinant expression vector also comprises a plant over-expression vector pBI121-GFP.

In particular, the recombinant expression vector is an over-expression vector 35S, pagSDD1-GFP.

In a fourth aspect, the present invention provides a use of excess PagSDD1 expression to reduce stomatal density in poplar, and to enhance drought resistance and promote vegetative growth by promoting expression of paglhcb2.1, pagGRF5 genes, comprising the steps of:

cloning the poplar PagSDD1 gene;

step two, pagSDD1 is connected with a plant over-expression vector to form an over-expression vector;

step three, transferring the over-expression vector in the step two into an agrobacterium tumefaciens GV3101 strain to obtain an agrobacterium tumefaciens strain GV3101 containing the over-expression vector;

And step four, transferring the agrobacterium in the step three into 84K poplar, screening by kanamycin to obtain a resistant seedling, extracting plant DNA, and performing positive detection by PCR to obtain a transgenic poplar plant. The stomatal phenotype was observed under scanning electron microscopy.

And fifthly, counting the stomatal density of the wild plants and the transgenic plants obtained in the step four.

And step six, performing drought test by using 10 wild control poplar and 10 over-expressed poplar, and watering 2d after 8d of water-deficient treatment of the saturated water-absorbing transgenic strain and the wild poplar. Survival and wilting status were observed for the control wild-type and over-expressed poplars. The fully expanded leaves collected from the fully watered plants were measured for water loss and immediately weighed, and then leaf weights were measured at 0.5, 1, 1.5, 2, 2.5 and 3 hours. The average blade weight loss percentage over time is plotted.

And seventhly, carrying out plant height and base diameter measurement statistics on the wild poplar and the transgenic poplar.

And step eight, detecting the expression level of PagLHCB2.1 and PagGRF5 genes of the wild poplar and the transgenic poplar.

The over-expression PagSDD1 gene reduces the pore density of the transgenic plant and enhances drought resistance; the vegetative growth of a transgenic poplar is promoted by promoting expression of the PagLHCB2.1 and PagGRF5 genes.

The observation of the air hole density in the fifth step comprises the following steps: observing the morphological characteristics of air holes of wild plants and transgenic plants under a scanning electron microscope; stomatal densities of wild-type plants and transgenic plants were counted.

The drought stress treatment in the fifth step comprises the following steps:

performing drought test on 10 wild control poplar and 10 over-expressed poplar, and watering 2d after 8d of water-deficient treatment on the saturated water-absorbing transgenic line and the wild poplar;

observing the survival rate of wild control poplar and over-expressed poplar;

the fully expanded leaves collected from the fully watered plants were measured for water loss and immediately weighed, and then leaf weights were measured at 0.5, 1, 1.5, 2, 2.5 and 3 hours. The average blade weight loss percentage over time is plotted.

The plant phenotype observation in the fifth step comprises the following steps: carrying out plant height measurement statistics on wild poplar and transgenic poplar; and performing base diameter measurement statistics on the wild poplar and the transgenic poplar.

The expression levels of PagLHCB2.1 and PagGRF5 are detected according to the following method: primer design is carried out on PagACTIN, pagLHCB2.1 and PagGRF5 genes; real-time fluorescent quantitative PCR detection is carried out on PagLHCB2.1 and PagGRF5 genes, and the relative expression quantity is calculated.

In a fifth aspect, the present invention provides a method for obtaining a transgenic poplar plant, wherein the transgenic poplar plant is a poplar grown with low stomatal density, high drought resistance and high nutrition, comprising the steps of:

in particular, the transgenic poplar plant is a poplar with low pore density, high drought resistance and high nutrition growth, which is obtained by utilizing the over-expression PagSDD1 gene.

Step 1, cloning a poplar PagSDD1 gene;

step 2, connecting the cloned PagSDD1 gene to a plant over-expression vector to form an over-expression vector;

step 3, transferring the over-expression vector formed in the step 2) into agrobacterium to obtain agrobacterium strain containing the over-expression vector;

step 4, transferring the agrobacterium comprising the over-expression vector obtained in the step 3) into aspen 84K, and screening by kanamycin to obtain a resistant seedling;

and 5, extracting DNA of the resistant plant, and carrying out PCR amplification and positive detection to obtain the transgenic poplar plant.

Wherein, the cloning of the poplar PagSDD1 gene in the step 1) is carried out according to the following method:

1-1), designing a gene specific primer (PagSDD 1-F/R) based on the nucleotide sequence of the PagSDD1 gene;

1-2) obtaining cDNA under the action of reverse transcriptase by taking the extracted Yang Shuzong RNA as a template;

1-3) PagSDD1 Gene was amplified from cDNA by PCR amplification using poplar cDNA as a template.

In particular, the specific primers are as follows:

forward primer PagSDD1-F: ATGTCTAAGGAATCCAAAATAC (SEQ ID NO. 1);

reverse primer PagSDD1-R: TCACTTCCAGGTCACTGAAAT (SEQ ID NO. 2).

Wherein, the plant over-expression vector in the step 2) is pBI121-GFP or pCambia1300, preferably pBI121-GFP.

In particular, the over-expression vector is 35S, namely PagSDD1-GFP, namely the plant over-expression vector containing PagSDD1 genes.

In particular, the method of ligating the cloned PagSDD1 gene to the plant overexpression vector pBI121-GFP was as follows:

2-1), carrying out PCR amplification by taking the cloned PagSDD1 gene as a template to obtain the PagSDD1 gene containing the pBI121-GFP vector joint primer; wherein the PCR amplification forward primer is pBI121-PagSDD1-F, and the reverse primer is pBI121-PagSDD1-R;

2-2), connecting the PagSDD1 sequence containing the pBI121-GFP vector joint primer to the plant over-expression empty vector pBI121-GFP by a seamless cloning method, then adopting a freeze thawing method to convert the connection product into escherichia coli DH5 alpha competence, carrying out colony PCR detection on the converted monoclonal bacteria, extracting plasmids from positive bacteria, and obtaining the over-expression vector pBI121-PagSDD1 containing PagSDD1 genes.

In particular, xbaI cleavage site is introduced into the forward primer in step 2-1), and SalI cleavage site is introduced into the reverse primer.

In particular, the forward primer pBI121-PagSDD1-F in step 2-1): CGGGGGACTCTAGAATGTCTAA GGAATCCAAAATAC (SEQ ID NO. 4); reverse primer pBI121-PagSDD1-R: ACTAGTCAGTCGAC TCTTCCAGGTCACTGAAATGG (SEQ ID NO. 5).

Particularly, the method also comprises the steps of carrying out positive screening detection on the monoclonal bacteria of escherichia coli transformed by a freeze thawing method, carrying out PCR detection by taking a single colony as a template, extracting plasmids from the single colony if the size of the single colony is about 2300bp, sequencing, comparing the sequencing result with a target gene sequence, and obtaining positive vector plasmids, namely plasmids pBI121-PagSDD1 of overexpression vectors containing PagSDD1 genes, if the sequencing result is completely consistent with the target gene sequence.

Particularly, the method also comprises the steps of carrying out PCR detection on the monoclonal escherichia coli on the transformed flat plate, taking the monoclonal bacteria as a template, carrying out gel electrophoresis, and comparing with a Maker, judging that the stripe size is about 2300bp, and the stripe size is positive; then adding positive bacteria into LB liquid medium added with kanamycin for expansion culture, and extracting plasmids to obtain positive plasmids, thus forming the PagSDD 1-containing overexpression vector pBI121-PagSDD1.

Wherein, the Agrobacterium in step 3) is preferably a GV3101 strain.

In particular, the PagSDD1-GFP is transferred into the Agrobacterium GV3101 strain to obtain the Agrobacterium tumefaciens strain 35S containing the PagSDD1-GFP-GV3101 (i.e., the PagSDD1 gene-containing overexpression vector Agrobacterium).

In particular, the method for transferring PagSDD1-GFP into agrobacterium GV3101 strain by using freeze thawing method is as follows: placing the agrobacterium tumefaciens competence in an ice water mixing state in ice bath, then adding a plant overexpression vector pBI121-PagSDD1 containing PagSDD1 genes into the agrobacterium tumefaciens, uniformly mixing, and then sequentially standing on ice for 5min, liquid nitrogen for 5min, 37 ℃ water bath for 5min and ice bath for 5min; wherein, the plant over-expression vector pBI121-PagSDD1 containing PagSDD1 gene is added into each 100 mu l of agrobacterium competence in an amount of 0.01-1 mu g; then 700 mu l of LB culture medium or YEB liquid culture medium without antibiotics is added, and shaking culture is carried out for 2-3 h at 28 ℃; and then carrying out centrifugal treatment, discarding part of supernatant, reserving about 100 mu l of supernatant, gently blowing and beating the centrifuged sediment, re-suspending the sediment bacterial blocks, coating the re-suspension bacterial liquid on an LB or YEB plate containing antibiotics, and inversely placing the plate in a 28 ℃ incubator for 2-4 days until bacterial colonies grow on the plate, thus obtaining the PagSDD1 gene-containing overexpression vector agrobacterium.

In particular, the antibiotic-containing LB or YEB plate medium is: LB or YEB plate medium containing 50. Mu.g/ml Kan (kanamycin) or both 50. Mu.g/ml Kan and 20. Mu.g/ml Rif (rifampin) or 50. Mu.g/ml Rif; wherein when the plate contains only 50 mug/ml Kan, culturing at 28 ℃ for 48 hours; when 50 mug/ml Kan and 20 mug/ml Rif are added into the flat plate at the same time, the culture is carried out for 60 hours at 28 ℃; if the plate used contains 50. Mu.g/ml Rif, it is incubated at 28℃for 72-90h.

Wherein, in the step 4), agrobacterium 35S containing an over-expression vector, pagSDD1-GFP-GV3101 is transferred into a poplar 84K of Populus deltoides, and kanamycin is used for screening to obtain a resistant seedling.

In particular, the specific operation steps of the agrobacterium transfer into 84K poplar are as follows:

4-1) pretreatment of explants

Placing the poplar explant in a differentiation medium for differentiation culture to obtain a pretreated explant;

4-2) preparing the agrobacteria dip-dyeing bacteria liquid

Transforming the plant overexpression vector pBI121-PagSDD1 into agrobacterium competence through a freeze thawing method, detecting through colony PCR, and then selecting positive single colonies to inoculate into a liquid suspension culture medium for liquid suspension culture to prepare agrobacterium infection bacterial liquid containing the plant overexpression vector pBI121-PagSDD 1;

4-3) Dip dyeing treatment

Soaking the pretreated explant after differentiation culture in agrobacterium infection bacterial liquid containing plant overexpression vector pBI121-PagSDD1 for 10-15min, inoculating the explant into infection-co-culture medium, and carrying out infection treatment under dark condition to obtain the infection treated explant;

4-4) resistant bud screening treatment

Inoculating the dip-dyed explant into a selective differentiation medium, and screening the resistant buds;

4-5) rooting treatment of resistant buds

When the growth of the resistance buds growing on the selective differentiation medium reaches 1-2cm, shearing by using sterile scissors, inoculating to the selective rooting medium, rooting and culturing, and obtaining the positive plants after DNA detection, namely the over-expression plants, namely the poplar plants with low pore density, improved drought resistance and enhanced nutrition growth.

In particular, the conditions for the differentiation culture in step 4-1) are: the temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; the differentiation culture time is 2-4 days.

In particular, the explant is a leaf of poplar, preferably a leaf of a 84K tissue culture seedling of Populus deltoides grown for 4 weeks.

In particular, the differentiation culture is performed after cutting the leaves.

In particular, the culture medium for the differentiation culture is as follows: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the liquid suspension medium in step 4-2) is a YEB liquid medium containing kanamycin and rifampicin.

In particular, the concentration of kanamycin in the liquid suspension medium is 50mg/L and the concentration of rifampicin is 25mg/L.

In particular, the suspension culture conditions are: the temperature is 27-29 ℃; the rotation speed is 180-200rpm.

In particular, the OD600 of the agrobacterium infection bacterial liquid containing the plant over-expression vector pBI121-PagSDD1 is 0.6-0.8.

In particular, the colony PCR assay is: and (3) selecting monoclonal agrobacterium, taking 35S on an expression vector pBI121 as an upstream primer F (CTATCCTTCGCAAGACCCTTC, SEQ ID NO. 6), taking a section of sequence on a target gene PagSDD1 as a downstream primer R (TCACTTCCAGGTCACTGAAAT, SEQ ID NO. 2), performing colony PCR amplification, and performing gel electrophoresis to obtain a positive strip 2300bp, namely a positive single colony.

In particular, the infection-co-culture medium in step 4-3) is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the conditions of the infection-co-culture: the co-culture temperature is 25+/-2 ℃; dark culture for 2-3 days.

In particular, the method also comprises the step 4-3A), the explant subjected to the dip-dyeing treatment is washed for 20-30min by using distilled water containing cephalosporin, then is washed for 3-5 times by using distilled water, and is subjected to the screening treatment of the resistant buds after the water is absorbed.

In particular, the selective differentiation medium in step 4-4) is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5mg/L+Kan 30mg/L+Tim 200 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the culture conditions of the resistant bud screening treatment are: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

In particular, the selective rooting medium in step 4-5) is: 1/2MS minimal medium+NAA 0.02mg/L+IBA 0.05mg/L+Kan 30mg/L+Tim 200 mg/L+agar 6 g/L+sucrose 30g/L.

In particular, the rooting culture conditions are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

Wherein, the positive detection in the step 5) is gel electrophoresis of PCR amplification products, and the positive detection has a band of about 2300 bp.

In particular, the method also comprises a step 6) of observing the stomatal phenotype of the transgenic poplar plant and the wild poplar under a scanning electron microscope.

Step 6, counting the stomatal density of the transgenic plant obtained in the step 5); and the stomatal density of wild type plants was counted.

In particular, step 7 is also included, and drought tests are performed with 10 wild-type control poplars and 10 overexpressed poplars.

Drought stress test (water-deficient treatment of plants under the precondition of controlling water saturation):

the transgenic lines and wild poplar after positive detection are watered for 2d after 8d of water shortage treatment. Survival and wilting status were observed for the control wild-type and over-expressed poplars. The fully expanded leaves collected from the well watered transgenic poplars and wild type poplars were measured for water loss and immediately weighed and leaf weights were measured at 0.5, 1, 1.5, 2, 2.5 and 3 hours. The average blade weight loss percentage over time is plotted.

In particular, the method also comprises a step 8 of measuring the plant height and the basal diameter of the wild poplar and the transgenic poplar by using a tape measure and a vernier caliper and counting the measurement results.

In particular, the method also comprises a step 9 of detecting the expression quantity of PagLHCB2.1 and PagGRF5 genes of the wild poplar and the transgenic poplar and calculating the relative expression quantity.

PagSDD1 is a pore density inhibitor separated from poplar, and excessive expression of PagSDD1 in poplar plants can obviously reduce pore density and enhance drought resistance of plants;

The PagSDD1 gene which is overexpressed promotes the poplar to achieve nutrient absorption and improves the growth, the growth speed and the yield of the poplar by promoting the expression of PagLHCB2.1 and PagGRF5 genes.

The PagSDD1 gene can regulate drought resistance and nutrient growth, so cloning the gene has important significance for genetic engineering breeding of poplar.

Through the search of the prior art documents, no report related to the PagSDD1 gene of the present invention in affecting the vegetative growth of poplar has been found. This function is the first time the present invention proposes.

The PagSDD1 gene is cloned from poplar, an over-expression vector containing the PagSDD1 gene is constructed, agrobacterium tumefaciens GV3101 is used for mediating, and a leaf disc method is adopted to transform the PagSDD1 gene over-expression vector into poplar; the integration condition of the exogenous target gene PagSDD1 is detected by PCR, and the pore density of the transgenic poplar is observed by a scanning electron microscope, so that the pore density of the obtained transgenic poplar with the excessive expression PagSDD1 is obviously reduced, and the drought resistance and the vegetative growth are obviously enhanced.

Compared with Wild Type (WT), the pore density of the over-expressed PagSDD1 poplar obtained by the method is obviously reduced, the water utilization efficiency is improved, and the over-expressed PagSDD1 gene can promote the vegetative growth of the poplar by promoting the expression of downstream PagLHCB2.1 and PagGRF5 genes.

The invention discloses a new function and a new application of PagSDD1 genes, namely, the PagLHCB2.1 and PagGRF5 genes are promoted to express so as to promote the nutrition growth of poplar, and meanwhile, the pore density is reduced so as to enhance the drought tolerance of poplar, which is helpful for the nutrition growth and the genetic improvement of the resistance of woody plants and provides an excellent target gene for molecular design breeding.

In the invention, poplar is taken as an example for explanation, and because the function difference of homologous genes in different species is not large, the homologous genes of the genes in other woody plants may have similar functions if the regulation and control of the pore density, the improvement of drought resistance or/and the enhancement of the nutrition growth function of the genes are proved in the poplar.

Compared with the prior art, the invention has the following advantages: it was found that the stomatal density inhibitor PagSDD1 enhances drought resistance and promotes poplar growth. The invention changes the expression condition of the corresponding genes in the poplar plant by using a genetic engineering means, reduces the pore density, and provides a new strategy for enhancing the drought resistance of the poplar and improving the yield of the poplar. Previous studies only reported that SDD1 has the function of reducing the pore density, but reports on how it affects vegetative growth are rare. Therefore, the PagSDD1 provided by the invention not only can reduce the pore density and enhance the drought resistance of poplar, but also can promote the growth of poplar and increase the yield of poplar by promoting the expression of a growth regulating factor PagGRF5 and a photosynthesis related gene PagLHCB2.1, thus providing a star gene for obtaining high-yield and high-drought resistance materials for molecular design and breeding of poplar.

Drawings

FIG. 1 is an agarose gel electrophoresis of a PCR assay performed on poplar positive plants overexpressing PagSDD 1; where markers 1-9 are positive plants, P is positive control, and WT is non-transformed wild type plant, i.e., negative control.

FIG. 2 is a graph showing that PagSDD1 gene regulates stomatal density in poplar; pore density observations for overexpressed PagSDD1 poplar (PagSDD 1-OE) and wild-type (WT). Wherein the overexpressing lines (PagSDD 1-OE-7 and PagSDD 1-OE-8) showed a significantly reduced stomatal density.

FIG. 3A is a graph of the growth survival of the overexpressing strain (PagSDD 1-OE), the wild-type strain, under drought stress, with the overexpressing strain (PagSDD 1-OE) showing higher survival under drought stress.

FIG. 3B is a graph of water loss measurements for a well-watered over-expressed strain (PagSDD 1-OE), wild-type strain; the overexpressing strain (PagSDD 1-OE) showed a lower water loss rate.

FIG. 4A is a graph showing the results of strain height measurement of the overexpressing strain (PagSDD 1-OE) and the wild-type strain, and the overexpressing strain (PagSDD 1-OE) shows a higher strain height.

FIG. 4B is a graph showing the results of the determination of the base diameters of the overexpressing strain (PagSDD 1-OE) and the wild-type strain, and the overexpressing strain (PagSDD 1-OE) shows a larger base diameter.

FIG. 5A is a graph showing the results of higher expression levels of PagLHCB2.1 gene regulated by PagSDD1 in an overexpressed strain (PagSDD 1-OE) and a wild-type strain, wherein the overexpressed strain (PagSDD 1-OE) shows high expression levels of PagLHCB2.1 gene.

FIG. 5B is a graph showing the results of higher expression levels of PagGRF5 gene regulated by PagSDD1 in the overexpressed strain (PagSDD 1-OE) and the wild-type strain, wherein the overexpressed strain (PagSDD 1-OE) shows higher expression levels of PagGRF5 gene.

Detailed Description

The present invention will be further described with reference to the accompanying drawings, in order to fully explain the objects, technical features and technical effects of the present invention.

The following describes embodiments of the present invention in detail: the present embodiment is implemented on the premise of the technical scheme of the present invention, and a detailed implementation manner and a specific operation process are provided, but the protection scope of the present invention is not limited to the following embodiments. The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer.

In the present invention, various vectors known in the art, such as commercially available vectors including plasmids, cosmids, etc., may be used.

The agrobacterium involved in the invention is agrobacterium tumefaciens (Agrobacterium tumefaciens), the strain is GV3101, and the strain can be publicly purchased from the market.

EXAMPLE 1 cloning of the poplar PagSDD1 Gene

1. Extraction of poplar genome total RNA

Taking 84K poplar leaf tissue, placing the leaf tissue in liquid nitrogen for grinding, adding the leaf tissue into a 1.5mL Eppendorf (EP) centrifuge tube containing lysate, and extracting total RNA according to the specification of TIANGEN kit after full shaking. The total RNA mass was identified by agarose gel electrophoresis and then the RNA concentration was determined on a spectrophotometer.

The total RNA concentration extracted from poplar leaf tissue in this example was: 568 ng/. Mu.L.

In the specific embodiment of the invention, the RNA extraction takes the leaf tissue of the populus tremulosa 84K as an example, and other tissues of populus tremulosa (such as populus tremulosa) or other woody plants such as leaf and terminal bud are suitable for the invention, so that the RNA is extracted.

2. Cloning of the Poplar PagSDD1 Gene

2A, using the extracted Yang Shuzong RNA as a template, calculating the dosage (1.76 mu L) according to the concentration of the RNA, and obtaining cDNA under the action of reverse transcriptase;

2B, the following gene-specific primers (PagSDD 1-F/R) were designed based on the nucleotide sequence of the PagSDD1 gene:

forward primer PagSDD1-F: ATGTCTAAGGAATCCAAAATAC (SEQ ID NO. 1),

reverse primer PagSDD1-R: TCACTTCCAGGTCACTGAAAT (SEQ ID NO. 2).

2C, amplifying PagSDD1 genes from the total cDNA by PCR (polymerase chain reaction) amplification, wherein the PCR amplification procedure and the reaction system are as follows;

PCR amplification procedure: pre-denaturation at 94 ℃ for 4min, and entering a cyclic amplification stage: cycling for 30 times at 94 ℃ for 30s,55 ℃ for 30s and 72 ℃ for 1 min; the reaction was terminated by incubating at 72℃for 5min, and the PCR product was stored at 4 ℃.

PCR reaction system: 10 mu L Taq enzyme, 8 mu L ddH ₂ O, 0.5. Mu.L of the primer PagSDD1-F/R, 1. Mu.L of DNA, and a total volume of 20. Mu.L.

2D, PCR amplified product was recovered, purified and sequenced (Optimus Praeparata Co., ltd.), pagSDD1 sequence (SEQ ID NO. 3) in poplar was obtained.

EXAMPLE 2 construction of plant expression vector containing PagSDD1 Gene

The PagSDD1 sequence of poplar obtained in example 1 was constructed on plant overexpression vector pBI121-GFP to obtain plant overexpression vector pBI121-PagSDD1 containing PagSDD1 gene.

1. In order to facilitate the construction of the over-expression vector, a forward/reverse primer (pBI 121-PagSDD 1-F/R) for cloning the PagSDD1 transcription factor is designed, and an XbaI cleavage site is introduced into the forward primer, a SalI cleavage site is introduced into the reverse primer, and the sequence of the pBI121-PagSDD1-F/R primer is as follows:

forward primer pBI121-PagSDD1-F: CGGGGGACTCTAGAATGTCTAAGGAATCCAAAATAC

(SEQ ID NO.4)；

Reverse primer pBI121-PagSDD1-R: ACTAGTCAGTCGACTCTTCCAGGTCACTGAAATGG (SEQ ID NO. 5).

2. PCR amplification was performed using the PagSDD1 gene obtained in example 1 as a template to obtain a PagSDD1 gene containing a pBI121-GFP vector adapter primer, wherein the PCR amplification procedure and reaction system were as follows;

PCR reaction system: 10 mu L Taq enzyme, 8 mu L ddH ₂ O, 0.5. Mu.L of the primer pBI121-PagSDD1-F/R, 1. Mu.L of DNA, and a total volume of 20. Mu.L.

The PCR product was recovered and purified to obtain PagSDD1 sequence containing pBI121-GFP vector adapter primer.

3. The sequence of PagSDD1 containing the pBI121-GFP vector adapter primer cloned in the step 2 is connected to an over-expression empty vector pBI121-GFP by adopting a seamless cloning method, then the connection product is transformed into E.coli DH5 alpha competence by adopting a freeze thawing method (E.coli DH5 alpha is a strain commonly used for plasmid cloning), and monoclonal bacteria on a plate after transformation are subjected to PCR detection, wherein the monoclonal bacteria are used as templates. If the band size is about 2300bp compared with Maker, the monoclonal bacterium is sent to a gene detection company for sequencing, and if the sequencing result is completely consistent with the target gene sequence, the bacterium is positive.

Then adding the positive bacteria into LB liquid medium added with kanamycin, extracting plasmids after amplification culture, obtaining positive plasmids at the moment, constructing a plant overexpression vector, and obtaining a plant overexpression vector pBI121-PagSDD1 containing PagSDD1 genes.

E.coli DH5 alpha competent freeze thawing method transformation steps:

1. DH5 alpha competent cells were removed from-80℃and rapidly inserted into ice, after 5 minutes the pellet was thawed, the ligation product was added and gently mixed by hand-pulling the EP tube bottom (avoiding sucking with a gun), and left to stand in ice for 25 minutes.

2.42 ℃ water bath heat shock for 45 seconds, quickly put back on ice and stand for 2 minutes, and shake can reduce conversion efficiency.

3. To the centrifuge tube, 700. Mu.l of a sterile medium (LB liquid medium) containing no antibiotics was added, and after mixing, resuscitated at 37℃for 60 minutes at 200 rpm.

The cells were collected by centrifugation at 4.5000rpm for 1 minute, and about 100. Mu.l of the supernatant was left to gently blow the resuspended pellet and spread on LB medium containing kanamycin.

5. The plates were placed in an incubator at 37℃overnight to obtain monoclonal bacteria.

The seamless cloning conditions were: information seamless cloning of enzyme (purchased from Takara Bio Inc.), incubation was performed at 50℃for 15 minutes.

The seamless cloning method is conventional in the art. The seamless cloning is that the tail end of the vector and the tail end of the primer have 15-20 homologous bases, and thus, the two ends of the obtained PCR product are respectively provided with 15-20 bases with homology to the sequence of the vector, and the two ends are complementarily paired into a ring by virtue of action force among the bases, so that the PCR product can be directly used for transforming host bacteria without enzyme connection, and a linear plasmid (ring) entering the host bacteria can repair a notch by virtue of an own enzyme system.

Example 3 Agrobacterium tumefaciens-mediated genetic transformation of PagSDD1 overexpression vector to obtain transgenic poplar plants

1. Obtaining agrobacterium tumefaciens engineering bacteria containing PagSDD1 over-expression vector

The plant overexpression vector pBI121-PagSDD1 containing PagSDD1 gene constructed in example 2 was transferred into Agrobacterium tumefaciens GV3101 (purchased from Wei-di Co.) by freeze thawing method, and colony PCR detection verification was performed using the gene primers (pBI 121-PagSDD1-F, pBI121-PagSDD 1-R) in example 2, the band size was about 2300bp as a positive single colony, namely, the Agrobacterium tumefaciens engineering bacterium containing the PagSDD1 gene overexpression vector (i.e., the agrobacterium tumefaciens engineering bacterium containing the overexpression vector pBI121-PagSDD 1) was obtained, wherein: the steps of GV3101 Agrobacterium transformation (freeze thawing method) are as follows:

First,: taking agrobacterium tumefaciens competence stored in a test tube at-80 ℃ at room temperature, and inserting the test tube into ice when part of the agrobacterium tumefaciens competence is melted and is in an ice water mixing state;

then: adding 0.01-1 μg of plasmid DNA (namely pBI121-PagSDD1 plasmid) into 100 μl of agrobacteria competence, dialing the bottom of the tube, mixing, sequentially standing for 5min on ice, in liquid nitrogen, in 37 ℃ water bath and in ice bath respectively;

and then following: 700. Mu.L of LB medium (5 g/L yeast extract, 10g/L peptone, 10g/L sodium chloride, water to a constant volume of 1L, sterilization at 121℃for 15 min) or YEB liquid medium (10 g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, water to a constant volume of 1L, sterilization at 121℃for 15 min) without antibiotics was added, and the culture was performed at 28℃for 2 to 3 hours with shaking.

Then: centrifuging at 6000rpm for 1min, removing part of supernatant, collecting about 100 μl supernatant, gently blowing off the centrifuged precipitate, re-suspending the pellet, coating on LB or YEB plate containing corresponding antibiotics, and culturing in 28 deg.C incubator for 2-4 days until colony grows on the plate; wherein:

the LB or YEB plate culture medium containing the corresponding antibiotics is as follows: LB or YEB plate medium containing 50. Mu.g/ml Kan (kanamycin) or both 50. Mu.g/ml Kan and 20. Mu.g/ml Rif (rifampin) or 50. Mu.g/ml Rif; when the plate only contains 50 mug/ml Kan, culturing at 28 ℃ for 48 hours; when 50 mug/ml Kan and 20 mug/ml Rif are added into the flat plate at the same time, the culture is carried out for 60 hours at 28 ℃; if the plate used contains 50. Mu.g/ml Rif, it is incubated at 28℃for 72-90h; in this example, the pellet suspension was plated on LB plate medium containing 50. Mu.g/ml Kan.

The plasmid was the overexpression vector pBI121-PagSDD1 plasmid obtained in example 2.

Positive screening detection: performing colony PCR amplification by taking an agrobacterium single colony as a template, wherein:

colony PCR amplification procedure: pre-denaturation at 94 ℃ for 4min, and entering a cyclic amplification stage: cycling for 30 times at 94 ℃ for 30s,55 ℃ for 30s and 72 ℃ for 1 min; the reaction was terminated by incubating at 72℃for 5min, and the PCR product was stored at 4 ℃.

Colony PCR reaction system: 10 mu L Taq enzyme, 8 mu L ddH ₂ O, 0.5. Mu.L of primers pBI121-PagSDD1-F/pBI121-PagSDD1-R, 1. Mu.L of Agrobacterium single colony, and a total volume of 20. Mu.L.

The band is positive bacteria with about 2300bp through PCR amplification. The positive result shows that the plant over-expression vector containing PagSDD1 is successfully transformed into the agrobacterium tumefaciens strain to obtain the agrobacterium tumefaciens engineering bacterium containing the over-expression vector of PagSDD1 gene.

2. Pre-culture (i.e., differentiation culture) of explants

Cutting off the leaf of the tissue culture seedling of the populus deltoidea 84K growing for 4 weeks, cutting the leaf vein perpendicular to the leaf vein main vein by using scissors in an ultra-clean workbench, cutting off the main vein, and cutting out wounds at three positions of the base part of the leaf, the middle part of the leaf and the tip of the leaf, so that agrobacterium is convenient to enter plant cells. The middle part of the blade is perpendicular to the blade vein, cuts off the main vein, but does not cut off the blade, and the cutting part of the middle part of the blade basically forms an axisymmetric structure along the main vein of the blade;

The sheared leaf discs were then individually plated into petri dishes (9 cm diameter) containing solid differentiation medium for differentiation culture for 3 days (typically 2-4 days) to obtain pretreated leaf explants, wherein: the differentiation medium is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; culture conditions: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark.

3. Preparation of an infectious microbe liquid

Inoculating the positive single colony obtained in the step 1 into 50ml (each bottle) of YEB liquid culture medium (10 g/L yeast extract, 10g/L peptone, 5g/L sodium chloride, adding water to a fixed volume to 1L, sterilizing at 121 ℃ for 15 min) added with 50mg/L kanamycin and 25mg/L rifampicin, and performing liquid suspension culture, wherein the liquid suspension culture temperature is 27-29 ℃; the rotating speed is 180-200rpm; culturing until the bacterial liquid is uniform and consistent, and the OD600 of the bacterial liquid reaches 0.7 (usually 0.6-0.8), and obtaining the GV3101 agrobacterium infection bacterial liquid containing the plant overexpression vector pBI121-PagSDD 1.

4. Treatment of infestation

Soaking the leaf explant which is pretreated (namely, subjected to differentiation culture) for 3 days in agrobacterium tumefaciens infection bacterial liquid containing a plant overexpression vector pBI121-PagSDD1 for 15min (usually 10-15 min); then taking out the leaf and sucking the bacterial liquid on the surface of the leaf to dryness by using sterile filter paper; then, respectively spreading the leaf explants into a culture dish (with the diameter of 9 cm) filled with an infection-co-culture medium, and carrying out infection treatment under dark conditions to obtain the leaf explants subjected to the infection treatment, wherein: the infection-co-culture medium was: MS minimal medium+NAA 0.05mg/L+6-BA 0.5 mg/L+agar 6 g/L+sucrose 30g/L; conditions of infection-co-cultivation: the co-culture temperature is 25+/-2 ℃; dark culture for 2 days (usually 2-3 days) and obtaining infection-in vitro leaves.

5. Screening treatment of resistant shoots

Washing the infected-in-vitro leaves with distilled water containing cephalosporin for 25min (usually 20-30 min), wherein the concentration of cephalosporin in the distilled water containing cephalosporin is 50mg/L (usually 40-55 mg/L); respectively washing with distilled water for 4 times (usually 3-5 times) for 2min each time, and sucking water with sterilized filter paper; then, respectively spreading the leaves into a culture dish filled with a selective differentiation medium, and screening the resistant buds, wherein the selective differentiation medium is: MS minimal medium+NAA 0.05mg/L+6-BA 0.5mg/L+Kan 30mg/L+Tim200 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions for the resistant bud screening treatment were as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark; the resistant buds are screened and cultured for about 1 week, the wound parts of the leaves start to deform, the leaves show waving, and the resistant buds grow out for about 2 weeks.

6. Rooting culture of resistant buds

When the growth of the resistance buds growing on the selective differentiation medium reaches 1-2cm, respectively shearing by using sterile scissors, and respectively inoculating to the selective rooting medium for rooting culture, wherein the selective rooting medium is: 1/2MS minimal medium+NAA 0.02mg/L+IBA 0.05mg/L+Kan 30mg/L+Tim200 mg/L+agar 6 g/L+sucrose 30g/L; the culture conditions for the resistant rooting culture are as follows: the culture temperature is 25+/-2 ℃, the illumination is 2000lx, and the illumination period is 16h light/8 h dark. Rooting culture time is 2-4 weeks, and regenerated plants are obtained.

7. PCR detection of transgenic poplar plants

DNA detection was performed on regenerated plants obtained by rooting culture and non-transformed wild type plants, respectively, by the operation of a novel plant genomic DNA extraction kit (DP 320-03, tiangen Biochemical technology (Beijing) Co., ltd.).

1-2 leaves of the regenerated plant and the non-transformed wild plant obtained after the antibiotic screening are ground by liquid nitrogen, DNA extraction is carried out by adopting a novel plant genome DNA extraction kit of Tiangen biochemical technology Co., ltd, and the collected DNA is placed at-20 ℃ for standby.

PCR amplification was performed using the extracted DNA as a template, and 10. Mu.L of Taq enzyme and 8. Mu.L of ddH were added to the PCR tube ₂ O, 0.5. Mu.L of detection primer F/R, 1. Mu.L of DNA, and 20. Mu.L of total volume, wherein:

the positive detection of over-expressed plants and non-transformed wild type plants was performed by designing forward detection primer F (CTATCCTTCGCAAGACCCTTC, SEQ ID No. 6) and reverse detection primer R (TCACTTCCAGGTC ACTGAAAT, SEQ ID No. 2) based on the sequence of plant over-expression vector pBI121-GFP and the gene sequence of PagSDD 1.

The PCR procedure is that the pre-denaturation is carried out for 4min at 94 ℃, and the cyclic amplification stage is carried out: cycling for 30 times at 94 ℃ for 30s,55 ℃ for 30s and 72 ℃ for 1 min; the reaction was terminated by incubating at 72℃for 5min, and the PCR product was stored at 4 ℃.

And (3) carrying out electrophoresis separation on the PCR product for 20min under the constant pressure of 120V in 1.2% agarose gel, checking the band of the target gene (PagSDD 1 gene) by using a gel imager, and judging that the plant is positive after electrophoresis detection and the band which accords with the length of the target gene (about 2300 bp) is present, wherein the detection result is shown in figure 1.

As can be seen from FIG. 1, positive plants can be amplified with specific DNA fragments (1-9 in FIG. 1) using designed PCR specific detection primers (F/R), and the positive plants are labeled PagSDD1-OE. Whereas no fragment was amplified using non-transformed wild-type poplar (WT) genomic DNA as a template. P represents the positive plasmid pBI121-PagSDD1, i.e., a positive control.

In the embodiment, the plant over-expression vector is used for transforming agrobacterium tumefaciens GV3101 to obtain a plant over-expression vector-containing PagSDD1 agrobacterium tumefaciens strain for transforming poplar, and the constructed agrobacterium tumefaciens strain is used for transforming poplar to obtain a transgenic poplar plant detected by PCR. The acquisition of the transgenic poplar plant provides direct material for screening the poplar plant line with lower pore density, higher water utilization efficiency and high biomass.

Test example 1 observation of pore Density

Leaf stomata of wild type and transgenic poplar (PagSDD 1-OE) obtained in example 3 were analyzed using a scanning electron microscope.

Leaves of positive plants PagSDD1-OE-7 and PagSDD1-OE-8 were selected, fixed with 2.5% glutaraldehyde and rinsed 3 times with 0.1M phosphate buffer PB (pH 7.4) for 15min each. After this time, it was transferred to 1% osmium tetroxide (OsO 4) prepared at 0.1M PB (pH 7.4) and fixed at room temperature for 1-2 hours. Subsequently, the mixture was rinsed 3 times with 0.1M phosphate buffer PB (pH 7.4) for 15 minutes each. The washed tissue and tissue were dehydrated in 30%, 50%, 70%, 80%, 90%, 95%, 100% alcohol for 15min each time and immersed in t-butanol for 30 min. The samples were dried in a K850 critical point dryer (Quorum Technologies ltd., lewes, UK) and then placed on a conductive carbon film double sided tape onto an ion sputter sample station for metal spraying for about 30 s. The image was observed and photographed with a scanning electron microscope. Determining the air pore density through an image, wherein the observation result is shown in figure 2, and the PagSDD1 gene regulates the air pore density in poplar; wherein the overexpressing lines (PagSDD 1-OE-7 and PagSDD 1-OE-8) showed a significantly reduced stomatal density, indicating that PagSDD1 negatively regulates poplar stomatal density.

Test example 2 drought stress experiment

10 wild-type plants (WT) grown in a greenhouse (illumination cycle: 16h illumination/d; temperature 22-25 ℃) and 10 positive overexpressing plants (10 PagSDD 1-OE) were taken for drought testing.

All plants were kept in pots (length. Times. Width. Times. Height, 10 cm. Times. 10 cm. Times.10 cm) and trays of appropriate size. Transgenic poplar and wild poplar are watered for 2d after 8d of water-deficient treatment. The wilting of wild type and transgenic plants after drought stress treatment was observed, and the observation results are shown in fig. 3A.

The fully expanded leaves collected from the well watered transgenic poplars and wild type poplars were measured for water loss and immediately weighed and leaf weights were measured at 0.5, 1, 1.5, 2, 2.5 and 3 hours. The average blade weight loss percentage over time is plotted and the measurement is shown in fig. 3B.

As shown in fig. 3A and 3B, the PagSDD1 gene can significantly enhance drought resistance of poplar; the over-expression strain (PagSDD 1-OE-7 and PagSDD 1-OE-8) shows higher survival rate and lower water loss rate under drought stress, which indicates that the over-expression of PagSDD1 can obviously improve the drought resistance of poplar.

Test example 3 transgenic poplar growth trait determination

Measuring the plant heights of the wild type plants and the transgenic plants respectively when seedlings grow for 20d, 30d and 40d under normal culture conditions by using a tape measure, wherein the measurement results are shown in figure 4A; the diameters of the wild type plants and the transgenic plants were measured under normal culture conditions for 20d, 30d and 40d of seedling growth by using a vernier caliper, and the measurement results are shown in fig. 4B.

As shown in fig. 4A, 4B, the PagSDD1 gene promotes vegetative growth in poplar; wherein the overexpressing strain (PagSDD 1-OE) shows a higher strain height and base diameter. Wherein FIG. 4A shows that the overexpressing lines (PagSDD 1-OE-7 and PagSDD 1-OE-8) show higher plant heights at 20 days, 30 days and 40 days of growth, and FIG. 4B shows that the overexpressing lines (PagSDD 1-OE-7 and PagSDD 1-OE-8) show larger base diameters at 20 days, 30 days and 40 days of growth, indicating that overexpressing PagSDD1 significantly promotes poplar growth.

The embodiment determines the plant height and the base diameter of the transgenic poplar, adopts a strategy of transforming PagSDD1 over-expression vector, discovers that the over-expression of PagSDD1 gene can obviously promote the vegetative growth of the poplar, and provides powerful experimental evidence for carrying out transcriptional regulation research by utilizing the gene so as to promote the vegetative growth of the poplar.

Test example 4 fluorescent quantitative PCR detection of PagLHCB2.1 and PagGRF5 Gene expression levels

Total RNA was isolated from overexpressed PagSDD1 poplar (PagSDD 1-OE) and WT poplar leaves obtained in example 3 using a plant Total RNA extraction kit (Tiangen, china, cat DP 432), respectively. RNA quality and concentration were measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, waltham, mass., USA).

First strand cDNA was synthesized from total RNA using a cDNA synthesis kit (Tiangen, china, cat KR 106).

UsingTop Green qPCR SuperMix (TRANSGEN, china, cat AQ 132-22) kit and reaction system thereof, carrying out real-time quantitative polymerase chain reaction (RT-qPCR) on a Applied Biosystems 7500 real-time fluorescent quantitative PCR instrument, and measuring the expression levels of PagLHCB2.1 and PagGRF 5; />The reaction system of the Top Green qPCR SuperMix kit is shown in table 1. The reaction conditions for RT-qPCR are shown in Table 2.

TABLE 1Top Green qPCR SuperMix reaction system of kit

TABLE 2 reaction conditions for RT-qPCR

Gene-specific primers were obtained by direct query of primer data qPrimerDB (https:// biodb. Swu. Edu. Cn/qPrimerdb) (see Table 3). 2 ^-ΔΔCt The method is used to calculate the relative expression level of genes. PagACTIN is an internal reference gene, and Ct value is used as a control, so that the expression amounts of PagLHCB2.1 and PagGRF5 are calculated, and the relative expression amount of PagLHCB2.1 is shown in figure 5A; the relative expression levels of PagGRF5 are shown in FIG. 5B.

Table 3 RT-qPCR primer Table:

primer name	Primer sequences
		PagActin-F	ATTGTGCTCAGTGGTGGTTC，SEQ ID NO.7
PagActin-R	AAGGGCAGTGATTTCCTTGC，SEQ ID NO.8
		PagLHCB2.1-Q-F	GAAACTCAGATGTTTGCCTTGT，SEQ ID NO.9
PagLHCB2.1-Q-F	AAGCAGTTTCAGTTCCACTACT，SEQ ID NO.10
		PagGRF5-Q-F	CCAAAACAACAAAAGCAGTGTC，SEQ ID NO.11
PagGRF5-Q-R	CATCAAAGAAACGGTGAACAGT，SEQ ID NO.12

As shown in fig. 5A and 5B, the expression level of paglhcb2.1 and PagGRF5 in the poplar over-expressed PagSDD1 was significantly higher than that in WT, indicating that the over-expression of PagSDD1 promoted the expression of paglhcb2.1 and PagGRF 5.

PagLHCB2.1 and PagGRF5 are genes capable of promoting photosynthesis or growth of plants, so that PagSDD1 is shown to promote vegetative growth of poplar by promoting expression of PagLHCB2.1 and PagGRF5 genes.

The poplar PagSDD1 gene can reduce the pore density, enhance the drought resistance of plants and promote the vegetative growth. The invention provides a gene for regulating and controlling the nutrient growth of poplar, which lays a solid foundation for utilizing the gene to create poplar germplasm with high drought resistance and high yield.

The foregoing describes in detail preferred embodiments of the present invention. It should be understood that numerous modifications and variations can be made in accordance with the concepts of the invention without requiring creative effort by one of ordinary skill in the art. Therefore, all technical solutions which can be obtained by logic analysis, reasoning or limited experiments based on the prior art by the person skilled in the art according to the inventive concept shall be within the scope of protection defined by the claims.

Claims

1. An application of SDD1 gene in regulating and controlling the nutritive growth of poplar, saving water and resisting drought.

2. Use of a serine protease SDD1 gene that is a subtilisin-like (Bacillus subtilis) protease for regulating stomatal density, drought resistance, or/and enhancing vegetative growth in woody plants.

3. The method for obtaining the transgenic poplar plant is characterized in that the transgenic poplar plant is a poplar with low pore density, high drought resistance and high nutrition growth;

the PagSDD1 gene overexpression can reduce the pore density of poplar, enhance the drought resistance of plants and promote the vegetative growth of plants;

the application comprises the following steps:

step one, cloning the poplar PagSDD1;

step two, pagSDD1 is connected with a plant overexpression vector pBI121-GFP to form an overexpression vector 35S, wherein PagSDD1-GFP;

transferring PagSDD1-GFP into agrobacterium tumefaciens GV3101 strain to obtain agrobacterium tumefaciens strain GV3101 containing the over-expression vector;

and step four, transferring the agrobacterium in the step three into 84K poplar, screening by kanamycin to obtain a resistant seedling, and performing positive detection by PCR to obtain a transgenic poplar plant.

And fifthly, through stomatal observation, drought stress treatment and plant phenotype observation, the stomatal density in the transgenic plant of the excessive expression PagSDD1 is obviously reduced, and the drought resistance and the vegetative growth are obviously enhanced.

4. The method of claim 3, wherein the over-expression of the PagSDD1 gene reduces stomatal density and enhances drought resistance in the transgenic plant; the vegetative growth of a transgenic poplar is promoted by promoting expression of the PagLHCB2.1 and PagGRF5 genes.

5. The method of claim 3, wherein the pore density observation in step five comprises the steps of: observing the morphological characteristics of air holes of wild plants and transgenic plants under a scanning electron microscope; stomatal densities of wild-type plants and transgenic plants were counted.

6. A method according to claim 3, wherein the drought stress treatment in step five comprises the steps of:

observing the survival rate of wild control poplar and over-expressed poplar;

7. The method of claim 3, wherein said plant phenotype observation in step five comprises the steps of: carrying out plant height measurement statistics on wild poplar and transgenic poplar; and performing base diameter measurement statistics on the wild poplar and the transgenic poplar.

8. The method of claim 4, wherein the expression levels of paglhcb2.1 and PagGRF5 are detected as follows: primer design is carried out on PagACTIN, pagLHCB2.1 and PagGRF5 genes; real-time fluorescent quantitative PCR detection is carried out on PagLHCB2.1 and PagGRF5 genes, and the relative expression quantity is calculated.

9. The method for obtaining the transgenic poplar is characterized by comprising the following steps in sequence:

step 1, cloning a poplar PagSDD1 gene;

10. The method according to claim 9, wherein the step of transferring the agrobacterium into the aspen 84K in step 4) comprises the steps of:

4-1) placing the poplar explant in a differentiation medium for differentiation culture to obtain a pretreated explant;

4-2) transforming the plant over-expression vector into agrobacterium competence through a freeze thawing method, detecting through colony PCR, and then selecting positive single colony to inoculate into a liquid suspension culture medium for liquid suspension culture to prepare agrobacterium infection bacterial liquid containing the plant over-expression vector;

4-3) immersing the pretreated explant after differentiation culture in agrobacterium infection bacterial liquid containing plant overexpression vector for 10-15min, inoculating the explant into infection-co-culture medium, and carrying out infection treatment under dark condition to obtain the infection treated explant;

4-4) inoculating the dip-dyeing explant into a selective differentiation medium, and screening the resistant buds;

4-5) when the growth of the resistance buds growing on the selective differentiation medium reaches 1-2cm, shearing by using sterile scissors, inoculating to the selective rooting medium, carrying out rooting culture, and obtaining the positive plants after DNA detection, namely the over-expression plants, namely the poplar plants with low pore density, improved drought resistance and enhanced nutrition growth.