CN116589535A - Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof - Google Patents

Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof Download PDF

Info

Publication number
CN116589535A
CN116589535A CN202310402325.1A CN202310402325A CN116589535A CN 116589535 A CN116589535 A CN 116589535A CN 202310402325 A CN202310402325 A CN 202310402325A CN 116589535 A CN116589535 A CN 116589535A
Authority
CN
China
Prior art keywords
ppe
peach
small peptide
nucleic acid
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202310402325.1A
Other languages
Chinese (zh)
Inventor
陈秋菊
彭福田
肖元松
郭健
罗静静
高阳阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Agricultural University
Original Assignee
Shandong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Agricultural University filed Critical Shandong Agricultural University
Priority to CN202310402325.1A priority Critical patent/CN116589535A/en
Publication of CN116589535A publication Critical patent/CN116589535A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/8269—Photosynthesis
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The application relates to the technical field of biology, and discloses a small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof. The amino acid sequence of the small peptide ppe-miPEP408 is MRCVQKPTRGKSSY. The application discovers that the small peptide ppe-miPEP408 is sprayed on peach trees after being artificially synthesized in vitro, and the measurement results of the expression quantity of related genes and the net photosynthetic rate show that the small peptide ppe-miPEP408 can increase the expression quantity of the genes and the photosynthesis related genes, so that the expression quantity of the target genes of the ppe-miR408 is reduced, and the net photosynthetic rate of the peach trees is increased. The related results indicate that ppe-mipp 408 can improve photosynthesis of peach trees. The ppe-miPEP408 can be used for researching the functions of miR408 in peach, and simultaneously provides a new method and strategy for developing a more environment-friendly and efficient regulator for improving photosynthesis of peach trees, and has a very high application prospect.

Description

Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof
Technical Field
The application relates to a small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof in the field of biotechnology.
Background
Peach fruit is one of the favorite fruits of people. In recent years, manufacturers have not reasonably cultivated the peaches because of the pursuing yield on one side, and the quality of the peaches is deteriorated. With the increase of economic level, the requirements of consumers on the quality of fruits are higher and higher, and the quality of fruits determines the price of the fruits. How to improve the fruit quality of peach becomes an important direction of peach fruit research. The substances determining the quality (sugar, acid, aroma, etc.) in the fruit are derived directly or indirectly from photosynthesis. Peach is a camptotheca acuminata, and the improvement of photosynthesis of peach trees can improve the quality of peach fruits as can be seen from various cultivation measures (fertilization measures, she Guobi, tree vigor and the like) at present.
The factors influencing photosynthesis of peach trees include an intrinsic factor and an extrinsic factor, and under the condition that the extrinsic factor is determined, the photosynthesis is regulated and controlled from the gene level, which is certainly an important way for improving the fruit quality, and is also a theoretical basis for high-light-efficiency breeding. The current results of the photosynthesis mechanisms derived from model plants can be seen: various protein complexes such as photosystem II (PSII), cytochrome b6f complex (Cyt b6 f), photosystem I (PSI) and ATP synthase (ATPase) are all components involved in regulating photosynthesis of plants. In addition, in model plants, many transcription factors and mirnas are now also found to be involved in photosynthesis, such as HY5, SPL7, miR408, and the like.
miRNA is an endogenous small molecule RNA, and participates in the growth and development process of plants by regulating and controlling target genes. The miR408 is a miRNA which is highly conserved in terrestrial plants, and a plurality of researches show that after miR408 is over-expressed, the stress resistance of the plants can be increased, photosynthesis of arabidopsis, rice and the like can be increased, and biomass is further increased. However, these studies have been conducted mainly on plants of the Arabidopsis, rice and other modes, but have been conducted only rarely on fruit trees. In recent studies, it has been found that the miRNA gene encoding miRNA is capable of producing mature miRNA, and that its primary transcript (pri-miRNA) can also encode a short peptide (miPEP) by increasing the abundance of its corresponding pri-miRNA (Laurebergues et al, 2015). In addition, the miPEP can also increase the expression level of the corresponding MIRNA gene by in vitro addition after artificial synthesis, thereby further playing a role. The discovery of mipp allows for simple methods of studying mirnas. However, at present, only a few mipps are found in a few plants such as arabidopsis, alfalfa and grape, but not yet in others. The miPEP can act at the synthesis site like a plant hormone or transported from the synthesis site to the action site and then take effect again; however, unlike hormones, the essence of the mipp is a protein, and excessive mipp can be degraded into amino acids, and can be absorbed and utilized by plants again, so that the environmental pollution is avoided. Therefore, the research on miRNA related to photosynthesis in fruit trees and the exploration on the corresponding miPEP are of great significance to the research on the development of regulators for improving the photosynthesis of fruit trees.
Disclosure of Invention
The application aims to solve the technical problem of how to improve the yield and quality of peach trees.
A first object of the present application is the use of any one or more of Y1-Y5 of the small peptide ppe-miPEP 408:
the application of Y1 in promoting photosynthesis of peach;
application of Y2 in increasing weight of single peach fruit
Use of Y3 for increasing peach yield;
the application of Y4 in improving the content of soluble solids in peach fruits;
the application of Y5 in improving the quality of peach fruits;
the small peptide ppe-miPEP408 is a polypeptide with an amino acid sequence of SEQ ID NO. 3.
In the application, the small peptide ppe-miPEP408 can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.
In the above application, the application is to spray the solution containing the small peptide ppe-mipp 408 on peach trees from the hard pit stage to the fruit ripening stage.
The solution is a solution with a solute of small peptide ppe-mipp 408 and a solvent of water, and the concentration of the solution can be 0.2 mu M-0.4 mu M.
The spraying is preferably once a week.
A second object of the application is the use of any one or more of Z1-Z5 of substances that increase gene expression:
use of Z1 in promoting photosynthesis of peach;
application of Z2 in increasing weight of single peach fruit
Use of Z3 to increase peach yield;
the application of Z4 in improving the content of soluble solids in peach fruits;
application of Z5 in improving the quality of peach fruits;
the gene encodes the small peptide ppe-mipp 408.
In the above application, the substance for improving gene expression is a biological material related to the small peptide ppe-mipp 408; the biological material is any one of the following B1) to B5):
b1 A nucleic acid molecule encoding the small peptide ppe-mipp 408;
b2 An expression cassette comprising the nucleic acid molecule of B1);
b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);
b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);
b5 A transgenic plant line containing the nucleic acid molecule of B1) and its progeny, or a transgenic plant line containing the expression cassette of B2) and its progeny, or a transgenic plant line containing the recombinant vector of B3) and its progeny.
Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.
In the above application, in the biological material, B1) the nucleic acid molecule is a cDNA molecule or a DNA molecule whose coding sequence of the coding strand is SEQ ID No. 2.
Wherein SEQ ID NO.2 in the sequence table encodes a small peptide shown as SEQ ID NO.3 in the sequence table.
In the above applications, the expression cassette containing the nucleic acid molecule described in the biological material B2) refers to a nucleic acid molecule capable of expressing the small peptide ppe-miPEP408 in a host cell, and the nucleic acid molecule may include not only a promoter for initiating transcription of the small peptide ppe-miPEP408 gene, but also a terminator for terminating transcription of the small peptide ppe-miPEP408. Further, the expression cassette may also include an enhancer sequence.
Recombinant expression vectors containing the gene expression cassettes can be constructed using existing plant expression vectors.
In the above applications, the recombinant microorganisms in the biological material may be yeast, bacteria, algae and fungi.
The application also protects a small peptide ppe-miPEP408, which is specifically a polypeptide with an amino acid sequence of SEQ ID NO. 3;
the application also protects the biological material related to the small peptide ppe-miPEP 408; the biomaterial is any one of the following B1) to B5):
b1 A nucleic acid molecule encoding the small peptide ppe-mipp 408;
b2 An expression cassette comprising the nucleic acid molecule of B1);
b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);
b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);
b5 A transgenic plant line containing the nucleic acid molecule of B1) and its progeny, or a transgenic plant line containing the expression cassette of B2) and its progeny, or a transgenic plant line containing the recombinant vector of B3) and its progeny.
Wherein, the nucleic acid molecule B1) is specifically a cDNA molecule or a DNA molecule of which the coding sequence of the coding chain is SEQ ID NO. 2.
In order to solve the technical problems, the application also provides a plant reagent which is used for improving photosynthesis of peaches and/or increasing the weight of single peaches and/or increasing the yield of peaches and/or increasing the content of soluble solids of peaches and/or increasing the quality of peaches.
The plant reagent provided by the application contains the small peptide ppe-miPEP408 or/and biological materials related to the small peptide ppe-miPEP408.
The active ingredient of the plant agent can be the small peptide ppe-mipp 408 or/and biological material related to the small peptide ppe-mipp 408, the active ingredient of the plant agent can also contain other biological ingredients or/and non-biological ingredients, and the other active ingredient of the plant agent can be determined by a person skilled in the art according to peach photosynthesis and/or peach weight and/or peach yield and/or peach soluble solid content and/or peach quality improving effect.
In order to solve the technical problems, the application also provides a method for producing the peach variety with high photosynthetic rate and/or single fruit weight and/or high yield and/or high content of soluble solid matters in fruits and/or good fruit quality.
The method for producing the peach variety with high photosynthetic rate and/or high single fruit weight and/or high yield and/or high content of soluble solid matters in fruits and/or good fruit quality comprises the steps of introducing a gene encoding the small peptide ppe-mipPEP 408 into a target peach variety to obtain the peach variety with high photosynthetic rate and/or high single fruit weight and/or high yield and/or high content of soluble solid matters in fruits and/or good fruit quality; the photosynthetic rate is high, and/or the weight and/or the yield of single fruits are high, and/or the content of soluble solids in fruits is high, and/or the quality of fruits is good, and the photosynthetic rate is high, and/or the yield is high, and/or the quality of fruits is high, and is high, compared with that of the target peach variety.
In the above method, the nucleic acid molecule may be modified before being introduced into the target plant to obtain better expression effect.
In the method, the peach variety with high photosynthetic rate and/or high single fruit weight and/or high yield and/or high content of soluble solids in the fruit and/or good fruit quality can be a transgenic plant or a plant obtained by conventional breeding technologies such as hybridization and the like.
In the above methods, the transgenic plants are understood to include not only first to second generation transgenic plants but also their progeny. For transgenic plants, the gene may be propagated in that species, and may be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, calli, whole plants and cells.
The application discloses a small peptide capable of improving photosynthesis of peach trees: ppe-mipp 408. The application discovers that a primary transcript (pri-miR 408) of ppe-miR408 in peach trees can code a small peptide ppe-miPEP408 capable of improving the expression quantity of the small peptide ppe-miPEP408. The small peptide is sprayed on peach trees after being artificially synthesized in vitro, and the measurement results of the expression quantity of related genes and the net photosynthetic rate show that the ppe-miPEP408 can increase the expression quantity of the self gene (ppe-miR 408) and the photosynthesis related genes, so that the expression quantity of the target genes of the ppe-miR408 is reduced, and the net photosynthetic rate of the peach trees is increased. The related results indicate that ppe-mipp 408 can improve photosynthesis of peach trees. The ppe-miPEP408 can be used for researching the functions of miR408 in peach, and simultaneously provides a new method and strategy for developing a more environment-friendly and efficient regulator for improving photosynthesis of peach trees, and has a very high application prospect.
Drawings
FIG. 1 shows the conservation of miR408 mature form and the spatial-temporal expression pattern in peach in example 1 of this application. A of FIG. 1 is an alignment of miR408 precursor sequences in multiple species, osa-miR408 is a rice miR408 precursor sequence, ath-miR408 is an Arabidopsis miR408 precursor sequence, nta-miR408 is a tobacco miR408 precursor sequence, ppe-miR408 is a peach miR408 precursor sequence, sly-miR408a and sly-miR408b are miR408 precursor sequences of tomatoes, and the Consensus is a conserved sequence. B in FIG. 1 and C in FIG. 1 are tissue expression pattern analyses of ppe-miR408 in peach, and R in the figures is root. The data shown in the figures are mean ± standard deviation, repetition number is 3, and the different lowercase letters represent significance analysis results P < 0.05.
FIG. 2 is a diagram showing analysis of the initial transcription site of the primary transcript of the ppe-miR408 gene in example 1 according to the application. FIG. 2A is a schematic diagram of primer design, and FIG. 2B is the result of gel electrophoresis analysis of PCR products.
FIG. 3 is a diagram of an open reading frame analysis within the transcript sequence upstream of the ppe-miR408 precursor in example 1 according to the application. Dark grey is the short reading frame and corresponding amino acid sequence analyzed in the first reading mode; italics are short reading frames analyzed in the second reading mode and the corresponding amino acid sequences; the light grey is the short reading frame and the corresponding amino acid sequence analyzed by the third reading mode; underlined are the precursor sequences.
FIG. 4 shows the effect of the short reading frame analyzed in example 1 of the present application on the expression level of the ppe-MIR408 gene after transient expression in peach leaves. FIG. 4A is a schematic diagram of a short reading frame construction vector, FIG. 4B is a schematic diagram of the design of primers for detecting the expression level of the ppe-MIR408 gene, and FIG. 4C is a schematic diagram of qRT-PCR analysis of the relative expression level of the ppe-MIR408 gene. The data shown in the figures are mean ± standard deviation, repetition number is 3, x represents the significance analysis result P < 0.05, and x represents the significance analysis result P <0.01.
FIG. 5 is a graph showing the results of analysis of the target gene of ppe-miR408 in peach in example 1 according to the application. FIG. 5A is a sequence alignment of a target gene and ppe-miR408, FIG. 5B is a result of luciferase activity analysis of cleavage of the target gene by ppe-miR408, and FIG. 5C is a 5' RACE demonstration of cleavage of the target gene by ppe-miR 408.
FIG. 6 shows the expression levels of ppe-MIR408 and its target gene after treatment of ppe-MIPEP408 in example 2 of the present application. FIG. 6A shows the relative expression amount analysis of the ppe-MIR408 gene in the leaves of two kinds of processed peach variety, and FIG. 6B shows the relative expression amount analysis of the target gene in the leaves of two kinds of processed peach variety. The data shown in the figures are mean ± standard deviation, repetition number is 3, x represents the significance analysis result P < 0.05, and x represents the significance analysis result P <0.01.
FIG. 7 shows the effect of ppe-miPEP408 in example 2 of the present application on the expression level of photosynthesis-related genes in two varieties of peach. FIG. 7A shows the effect of ppe-miPEP408 on net photosynthetic rate of peach tree, FIG. 7B shows the effect of ppe-miPEP408 on relative expression of PpPC gene, and FIG. 7C shows the effect of ppe-miPEP408 on relative expression of PpRubiisco and PpFD gene. The data shown in the figures are mean ± standard deviation, repetition number is 3, x represents the significance analysis result P < 0.05, and x represents the significance analysis result P <0.01.
FIG. 8 is a quality analysis of peach fruits treated with ppe-miPEP408 in example 2 of the present application. Fig. 8a is a photograph of fruits of golden honey No.1 and late yellow flat at the time of fruit ripening, and fig. 8B is an analysis of the soluble solids content and single fruit weight in fruits of two peach varieties. The data shown in the figures are mean ± standard deviation, repetition number is 10, x represents the significance analysis result P < 0.05, and x represents the significance analysis result P <0.01.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The quantitative tests in the following examples were all performed in triplicate, and the results were averaged.
The experimental methods in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
The total plant RNA extraction kit is a Transzol total plant RNA extraction kit (catalog number: ET 101) of full gold (TransGen Biotech, beijing).
The cloning vector pMD19-T is a product of Bao bioengineering (Dalian) company with a catalog number of 6013.
The cloning vector pRI101-AN is manufactured by Wohan vast, biotechnology Co., ltd, and the product catalog number is p1785.
The following examples were run using GraphPad prism 7 statistical software and the experimental results were expressed as mean ± standard deviation, with P < 0.05 (x) representing significant differences and P <0.01 (x) representing very significant differences using the IBM SPSS Statistics test.
Example 1
The application aims to study the function of small peptide encoded by the ppe-MIR408 gene in peach trees, focus on finding the small peptide ppe-MIPEP408 with biological activity, spray the small peptide on the peach trees, observe the influence of period on photosynthesis of the peach trees, and provide a certain thought for manufacturing a regulator for improving photosynthesis of the peach trees more environment-friendly.
1. Cloning and analysis of peach MIR408 Gene fragment
Cloning of peach MIR408 gene fragment: the peach ppe-MIR408 gene sequence containing the stem-loop structure is obtained from a plant miRNA database (https:// www.pmiren.com/browse), and a primer is designed according to the sequence, specifically as follows:
MIR408-F1:5’-CATTATTGATGAGGAGGTTGTGGGTA-3’；
MIR408-R1:5’-TGGGGTGAGTAAATTAAGAGGAGGAG-3’。
the RNA of the peach leaf of golden honey No.1 is extracted by using a CTAB method and reversely transcribed into peach cDNA.
The primers designed as above are adopted, peach cDNA is used as a template, high-fidelity enzyme 2X Phanta Flash Master Mix is used for gene cloning, and a reaction system is shown in Table 1:
TABLE 1 reaction system
Adding the components Dosage of
2×Phanta Flash Master Mix 10μL
Peach cDNA 2μL
Upstream primer (10. Mu.M) 1μL
Downstream primer (10. Mu.M) 1μL
ddH 2 O Make up to 20.0 mu L
The reaction conditions for PCR were: pre-denaturation at 98 ℃ for 30s; denaturation at 98℃for 10s, annealing at 58℃for 5s, extension at 72℃for 20s,35 cycles, and finally extension at 72℃for 1min, pausing at 4 ℃.
After the reaction, agarose gel electrophoresis was performed to detect the size and specificity of the bands of the PCR products. And the obtained strip was subjected to glue recovery.
The fragment recovered was ligated to pMD19-T vector (Bao Ri Biotechnology (Beijing) Co., ltd., 6013) and sequenced by Rui Bo XingKe (Jinan) sequencing.
The cloned peach miR408 precursor sequence is called pre-miR408, and the sequence of pre-miR408 is shown in SEQ ID NO.1.
SEQ ID NO.1：
ACAGGGAACAGGTAGAGCATGGATGGAGTTCCCAACAGAAAAATAGAGCTGTTGTGGCTCTACTCATGCACTGCCTCTTCCCTGGCT
By aligning the precursor sequences of miR408 (pre-miR 408) in Arabidopsis, rice, tobacco, peach and other plants, it was found that the precursor sequences of miR408 in different species are very low in homology, but the mature body sequences are highly homologous in multiple plants (see FIG. 1A).
2. Tissue expression pattern analysis
RNA of peach leaves and tender roots of each development stage of golden honey No.1 is extracted by using a CTAB method and reversely transcribed into cDNA.
The relative expression level of ppe-miR408 was detected by using cDNA obtained by inversion as a template and using a 2X UltraSYBR Mixture fluorescent quantitative PCR kit (Kangji Co.).
miR408 neck ring primers for reverse transcription: 5'-gtcacatcgtatcgtgaagctgcgcagctgatgtgacAGCCAGGG-3';
qRT-miR408-F：5’-tgcactagcgtgTGCACTGCCT-3’；
qRT-miR408-R：5’-acatcgtatcgtgaag-3’。
primers for reference gene PpActin:
PpActin-F:5’-GTTATTCTTCATCGGCGTCTTCG-3’；
PpActin-R:5’-CTTCACCATTCCAGTTCCATTGTC-3’。
the reaction system and the reaction procedure were as follows:
TABLE 2 reaction system
Adding the components Dosage of
2×UltraSYBR Mixture 10μL
Peach cDNA 1μL
Upstream primer (10. Mu.M) 0.5μL
Downstream primer (10. Mu.M) 0.5μL
ddH 2 O Make up to 20.0 mu L
The reaction is carried out in an ABI7500 PCR amplification instrument under the conditions of pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 30s and 40 cycles, and finally dissolution profile analysis is carried out: 95℃15s,60℃1min,95℃15s,60℃15s.
The relative expression quantity of miR408 in root system and leaves in a plurality of development stages is analyzed by the qRT-PCR inventor, and the fact that the expression quantity of ppe-miR408 in the root is very low is obtained; the relative expression levels in the leaves at different developmental stages were different, with the highest in fully expanded leaves and the lowest in older leaves (see B of fig. 1 and C of fig. 1).
3. Open reading frame analysis
The primary transcript of the MIRNA gene (pri-miRNA) is capable of encoding small peptides, so the inventors first analyzed the length range of the primary transcript of the ppe-miR408 gene. Based on the existing peach gene, an upstream primer was designed at a different location upstream of the precursor of ppe-miR408, and a downstream primer was designed at the precursor sequence (see FIG. 2A).
Give specific designs of sequences F1, F2, F3, F4, F5, F6, F7 and R
F1:5’-AGTACATGCATTGTCATCTTGGTC-3’；
F2:5’-TTCTCATCTGTATCTTGTACATTCTTC-3’；
F3:5’-AATGCCCCAAGAGAACTCGAAG-3’；
F4:5’-CATTAACCAACTTTTCATTTCTAATTT-3’；
F5:5’-ACCTACTGTTGTCTGTTGTGTGTGAG-3’；
F6:5’-GTGGTGTTGGAGTTTAGTTATGCTTG-3’；
F7:5’-TAGGTAACAAGCCCTGCAAGTC-3’；
R:5’-CATCCATGCTCTACCTGTTCCCTG-3’。
The DNA and cDNA extracted from leaves of peach variety 'golden honey No. 1' are used as templates, and PCR amplification and gel electrophoresis analysis are carried out on the primer pair consisting of F1 and R, the primer pair consisting of F2 and R, the primer pair consisting of F3 and R, the primer pair consisting of F4 and R, the primer pair consisting of F5 and R, the primer pair consisting of F6 and R, and the primer pair consisting of F7 and R.
After the reaction, agarose gel electrophoresis was performed to detect the size and specificity of the bands of the PCR products. And the largest band obtained with the specific primers consisting of F4 and R using cDNA as template was subjected to gel recovery.
The recovered largest fragment was ligated to pMD19-T vector (Bao Ri Biotechnology (Beijing) Co., ltd., 6013) and sequenced by the Rui Bo XingKe (Jinan) sequencing department.
As a result, when the result is seen in FIG. 2B, it can be seen that the transcription initiation site of the ppe-miR408 gene is located approximately 631bp upstream of the precursor. Three reading code analyses were performed on 631bp sequences upstream of the ppe-miR408 precursor using DNAMAN software. The reading frames with more than 100 and less than 3 encoded amino acids were removed, with the remaining reading frames being candidates. A total of 9 candidate reading frames were analyzed, of which the first reading frame had 4 short reading frames (numbered sORF1-1, sORF1-2, sORF1-3, sORF1-4 in sequence), the second reading frame had 3 short open reading frames (numbered sORF2-1, sORF2-2, sORF2-3 in sequence) and the third reading frame had 2 short reading frames (numbered sORF3-1, sORF3-2 in sequence) (see FIG. 3).
4. Construction of plasmids and Agrobacterium transformation:
4.1 construction of plasmid
9 candidate reading frames (9 sORFs are specifically sORF1-1, sORF1-2, sORF1-3, sORF1-4, sORF2-1, sORF2-2, sORF2-3, sORF3-1 and sORF 3-2) are respectively constructed on a plant vector pRI101-AN vector, and a schematic diagram of the constructed vector is shown in FIG. 4A, and the specific steps are as follows:
a small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF1-1 (ATGAGGAGGTTGTGGGTAAGTACTACAAGAAGAAGAAGAGTGTAG), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF1-1 expressing sORF1-1.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF1-2 (ATGCATTGTCATCTTGGTCAATGGAATATTAGATTTGGGTAG), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF1-2 expressing sORF1-2.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF1-3 (ATGTGTGTACGATTTAAAATGGCCTTTGTTGTAGAAATAAATACACAGAAAGGCCAGCAAGGGTTAGGGAAGGGACAAATTAATGTATCCACAAGTTGCAGACTGGTGGGTGGCTGGTGA), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF1-3 expressing sORF1-3.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF1-4 (ATGGATGAGGTGTGTGCAAAAGCCAACAAGAGGTAA), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF1-4 expressing sORF1-4.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF2-1 (ATGCCCCAAGAGAACTCGAAGAAACTAATTTGTTCCAATGAATATTTTTTTTAA), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF2-1 expressing sORF2-1.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF2-2 (ATGTATCCACAAGTTGCAGACTGGTGGGTGGCTGGTGACAATTGA), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF2-2 expressing sORF2-2.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF2-3 (ATGAGGTGTGTGCAAAAGCCAACAAGAGGTAAATCATCCTATTAA, shown as SEQ ID NO. 2), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF2-3 expressing sORF2-3.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF3-1 (ATGAATATTTTTTTTAATAATAATTGTTTTCCTTTCTGGTAA), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF3-1 expressing sORF3-1.
A small fragment between the recognition sequences of vector pRI101-AN vector restriction enzymes NdeI and EcoRI was replaced with sORF3-2 (ATGGAATATTAG), and the other sequences of vector pRI101-AN were kept unchanged, to obtain recombinant vector pRI101-AN-sORF3-2 expressing sORF3-2.
4.2 Agrobacterium transformation
Respectively converting 9 recombinant vectors obtained in 4.1 into DH5 alpha escherichia coli competence, picking single spots on a screening culture medium, and sequencing to obtain 9 recombinant escherichia coli monoclone with correct sequencing result, wherein the method comprises the following steps of:
the recombinant vector pRI101-AN-sORF1-1 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF1-1.
The recombinant vector pRI101-AN-sORF1-2 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF1-2.
The recombinant vector pRI101-AN-sORF1-3 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF1-3.
The recombinant vector pRI101-AN-sORF1-4 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF1-4.
The recombinant vector pRI101-AN-sORF2-1 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF2-1.
The recombinant vector pRI101-AN-sORF2-2 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF2-2.
The recombinant vector pRI101-AN-sORF2-3 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF2-3.
The recombinant vector pRI101-AN-sORF3-1 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF3-1.
The recombinant vector pRI101-AN-sORF4-1 is transformed into DH5 alpha escherichia coli competence and sequenced to obtain recombinant escherichia coli DH5 alpha-pRI 101-AN-sORF3-2.
9 recombinant escherichia coli monoclonals with correct sequencing results are respectively inoculated into 5mL LB liquid culture medium containing Kan, placed in a shaking table with the rotation speed of 200rpm at 37 ℃ for overnight culture, and centrifuged at 10,000rpm for 5min at room temperature to collect bacteria; after the medium was removed, 9 plasmids were extracted with a plasmid extraction kit (nuuzan biotechnology Co., ltd.) and the concentration of the plasmids was measured using a NanoDrob 2000 micro-spectrophotometer; taking 1 mu L of 9 plasmids extracted, respectively adding 20 mu L of fresh-melted Agrobacterium tumefaciens GV3101 competent, standing on ice for 30min, freezing 1min by liquid nitrogen, performing heat shock at 37 ℃ for 1min, then placing on ice for 2min, finally adding 500 mu L of YEP liquid culture medium, placing in a shaking table at 28 ℃ for 200rpm, shaking for 2-3h, finally coating in a YEP solid culture medium containing rifampicin and Kan, and culturing for 2d in a culture box at 28 ℃ to obtain 9 recombinant agrobacteria, wherein the method comprises the following steps of:
recombinant Agrobacterium GV3101-pRI101-AN-sORF1-1 containing recombinant vector pRI101-AN-sORF1-1.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF1-2 containing recombinant vector pRI101-AN-sORF1-2.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF1-3 containing recombinant vector pRI101-AN-sORF1-3.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF1-4 containing recombinant vector pRI101-AN-sORF1-4.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF2-1 containing recombinant vector pRI101-AN-sORF2-1.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF2-2 containing recombinant vector pRI101-AN-sORF2-2.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF2-3 containing recombinant vector pRI101-AN-sORF2-3.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF3-1 containing recombinant vector pRI101-AN-sORF3-1.
Recombinant Agrobacterium GV3101-pRI101-AN-sORF3-2 containing recombinant vector pRI101-AN-sORF3-2.
5. Transient expression of genes
The 9 types of Agrobacterium containing sORFs (GV 3101-pRI101-AN-sORF1-1, GV3101-pRI101-AN-sORF1-2, GV3101-pRI101-AN-sORF1-3, GV3101-pRI101-AN-sORF1-4, GV3101-pRI101-AN-sORF2-1, GV3101-pRI101-AN-sORF2-2, GV3101-pRI101-AN-sORF2-3, GV3101-pRI101-AN-sORF3-1, GV3101-pRI101-AN-sORF 3-2) obtained in the above 4 were introduced into the leaves of the 'golden honey 1' fully expanded by vacuuming to transfer into peach leaves of empty vector GV3101-pRI101-AN as a control group. Then placing the leaves in a culture dish paved with wet filter paper, culturing in dark for 24 hours, and culturing in light for 48 hours; leaves were then harvested and snap-frozen with liquid nitrogen for analysis of the ppe-MIR408 gene expression.
Primers were designed within the primary transcript upstream of the ppe-miR408 precursor (FIG. 4B), specific primer sequences were:
ppe-MIR408-F:5’-CAGCAAGGGTTAGGGAAGGGACAAAT-3’；
ppe-MIR408-R:5’-GCACACACCTCATCCATCAGCTCC-3’；
PpActin-F:5’-GTTATTCTTCATCGGCGTCTTCG-3’；
PpActin-R:5’-CTTCACCATTCCAGTTCCATTGTC-3’。
the relative expression level of the ppe-MIR408 gene was detected by qRT-PCR, and the amount of the ppe-MIR408 gene was detected by using a 2X UltraSYBR Mixture fluorescent quantitative PCR kit (well known as century Co.) with the inverted cDNA as a template.
The reaction system and the reaction procedure were as in table 2 above.
The reaction is carried out in an ABI7500 PCR amplification instrument under the conditions of pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 30s and 40 cycles, and finally dissolution profile analysis is carried out: 95℃15s,60℃1min,95℃15s,60℃15s.
As a result, when the result is seen in FIG. 4C, it can be seen that 4 reading frames in the first reading frame format, sORF1-1 reduced the expression level of ppe-MIR408, and the other three reading frames and 2 sORFs in the third reading frame format had no significant effect on the expression level of ppe-MIR 408; in the second reading mode, sORF2-2 and sORF2-3 can obviously increase the expression level of the ppe-MIR408, and sORF2-3 can increase the expression level of the ppe-MIR408 to the greatest extent, which means that the biological activity of sORF2-3 is the highest. The small molecule peptide corresponding to sORF2-3 is named ppe-miPEP408 and consists of 14 amino acid residues, and the specific amino acid sequence is: MRCVQKPTRGKSSY (SEQ ID NO. 3).
6. Target gene analysis
6.1 Fluosphorium experiment analysis of cleavage of target Gene by ppe-miR408
By predicting the target gene, the target gene of ppe-miR408 in peach is related gene encoding copper-containing protein, and alternatives are: ppBBP1 (Basic blue protein 1) (LOC 18767781), ppBBP2 (Basic blue protein 2) (LOC 18788262), ppUCL3 (Uclacyanin-3) (LOC 18786386). FIG. 5A is a sequence alignment of the target gene and ppe-miR 408.
The agrobacterium containing pre-miR408 comprises the following specific construction methods: the small fragment between the recognition sequences of the vector pGreenII 62-SK restriction endonuclease XbaI and EcoRI is replaced by a precursor sequence of ppe-miR408, other sequences of the vector pGreenII 62-SK are kept unchanged, a recombinant vector for expressing the ppe-miR408 is obtained, the recombinant vector is transformed into DH5 alpha escherichia coli competence and sequenced, a plasmid with correct sequencing is extracted, the plasmid with correct sequencing is transformed into GV3101 competence (Jinan Shuo Biotech Co., AC 1002) of the agrobacterium containing pSoup helper plasmid, and PCR identification is carried out, so that recombinant agrobacterium GV 3101-pGreenII 62-SK-pre-miR408 of the recombinant vector containing the ppe-miR408 precursor is obtained.
The agrobacterium containing target genes comprises the following specific construction methods: the small fragments between the recognition sequences of the vector pGreenII 0800 vector restriction enzymes XbaI and EcoRI are respectively replaced by the target genes of the alternative sequences, and other sequences of the vector pGreenII 0800 are kept unchanged, so that the recombinant vectors for expressing the target genes are obtained: pGreen II 0800-PpBBP1, pGreen II 0800-PpBBP2, pGreen II 0800-PpUCL3. And respectively transforming each recombinant vector containing the target gene into DH5 alpha escherichia coli competence, sequencing, extracting plasmids with correct sequencing, transforming into GV3101 agrobacterium tumefaciens competence containing pSoup auxiliary plasmids, and carrying out PCR identification to obtain recombinant agrobacterium GV3101-pGreen II 0800-PpBBP-1, GV3101-pGreen II 0800-PpBBP-2 and GV3101-pGreen II 0800-PpUCL3 containing the target gene recombinant vectors.
PpBBP1:
ATGTCTGAGCAGGGAAGAGGCAGTGCAGGAACCATAGGAGTGGTGGTAGTTTTATGCCTAATGGTTCAGCTGGGATGCAGCAACGCAGCCACTTATAAGGTTGGAGAGTCTGGTGGCTGGAGCTTCAACACAGATAGCTGGCCTAATGGAAAGCAATTTAGAGCTGGCGATGTGCTTTCATTCAACTATGATCCAACACTACACAATGTGGTAGCTGTGGACAAGGGTGGCTACAGCAGCTGCACAACTCCGAATGGTGCAAAGGTGTATAAATCTGGAAAGGACCAAATAAGGCTAGGGAGGGGACAAAACTACTTCATATGCAATTTTCCAGGGCATTGCCAGTCTGGGATGAAGATTGCTATCAATGCTGTTTAG
PpBBP2:
ATGGGTCAGGGTAGAGGCAGTGCAGGGGTTGGTGTGGTTTTGGTGATGTGCCTGAGTTTGCTGCTGCTCCAATGTGAATGGGCTGAAGCCAGAAGCTACACTGTTGGGGATGCAGGTGGTTGGACGTTTAACGTTGCTGGGTGGCCTAAGGGGAAGTCATTTAGAGCCGGTGACGTGCTTGTTTTCAACTACGCGTCTTCTGCTCACAATGTGGTTGCTGTGAACAAGGCTGGGTATCAGACATGTAGCTCTCCAAGAGCTGCCAAAGTCTTTCAGACTGGGAAAGATCAGATCAAGCTTGCTAAAGGACAGAACTTCTTCATTTGCAATTTCCCAGGCCACTGCCAATCTGGCATGAAAATTGCCATCACTGCAGCCTAG
PpUCL3:
ATGGCCATAGCAACAGCGCTAGTAATTTTGCTGCTTGCAGCCCCAGCAGTTTATG
GAGTGCAGCACACTGTTGGTGACACAGCTGGCTGGGAATCAAATGTAGATTATG
TCACTTGGGCTGCTAGTAAAACCTTCACTGTTGGTGACACTCTTTTGTTCACCTA
TGGTGCTTCCCACTCAGTGGATCAAGTAAATCAAGCAGGCTACAGTAGTTGCAG
TTCAAGCAATGCCATCGGAACCCATAGTGATGGGAACACATCAATCCCCCTCTC
ACAAGCTGGTCCAGTCTACTTCATCTGCCCTACTCCAGGTCACTGTGCCAGTGG
CATGAAGGTTACAGTCACTGTTGTGGCAGCTGGCAGCCCTCCTACCACTTCTCC
CACAACTCCATCTCCACCCACCTCCACTCCGTCTCCACCCACCTCCACTCCGTCT
CCACCCACCACTCCTGCCAGCAATAATGGTTCGTCGCCGCCACCCCCGCCACCT
TCCGGAGCAGCAGCTCTTAGCATGAATATGCTTGGGGTTCCACTTGCGCTGGCA
ACCTTGGTTGCATTCATGGGCTAGGGAGGAGGCAGTGCGGTTGATCTTTTTCTTT
CTTCTTTCTAATAATTGACCGGACATATTGTTGTGTTGTATTGTGTTGAATTGGTG
TGATGTTAGATGAGAGATGTTAGAT
The agrobacterium containing pre-miR408 is co-injected into the lamina of nicotiana benthamiana with various agrobacterium containing target genes. Dark culture for 24h and light culture for 48h, and in vivo imager observation of luciferase activity to determine the cleavage function of ppe-miR408 on the target gene, the result is shown in B of FIG. 5.
6.2 demonstration of cleavage of target Gene by ppe-miR408 with 5' RACE
Extracting total RNA of peach leaf, and reverse transcribing with predicted target gene specific primer to obtain cDNA.
The target gene specific primers were as follows:
a specific downstream primer for the target gene PpBBP1, 5'-CAATGCCCTGGAAAATTGCATATGAA-3';
a specific downstream primer for the target gene PpBBP2, 5'-GCTCTAAATGACTTCCCCTTAGGC-3';
a specific downstream primer 5'-ATCTAACATCTCTCATCTAACATCAC-3' for the target gene PpUCL3.
The reverse transcription system was 20.0. Mu.L, 4 tubes per gene inversion; the cDNA of each gene was collected in a 1.5mL centrifuge tube, and the cDNA was purified by precipitation with 2.5-fold ethanol; the purified cDNA was treated with terminal phosphorylase (TDT), and the reaction system was described in TaKaRa. The system is as in Table 3:
TABLE 3 reaction system
Uniformly mixing the components according to the system, and then treating for 30min at 37 ℃; 150. Mu.L of RNase-free water was added; adding an equal volume of extract (chloroform: isoamyl alcohol=24:1) and uniformly mixing; centrifuging at 10,000rpm at 4deg.C for 10min; repeating extraction once; taking the supernatant, adding 5 mu L of 3M NaAC and 2.5 times of absolute ethyl alcohol, and precipitating for 1h at-20 ℃; centrifuging at 10,000rpm at 4deg.C for 20min; discarding the supernatant, drying the precipitate in an ultra-clean workbench, dissolving in 20 mu L of sterile water, and performing two-round nested PCR reaction by taking the precipitate as a template; the PCR product is recovered by agarose gel, cloned into pMD19-T vector, transformed into DH5 alpha escherichia coli competence, and subjected to monoclonal sequencing to determine the cut site of the target gene.
The common upstream primer of the first round of PCR is adopter TAATACGACTCACTATAGGGGGGGGGG; the downstream primer is a specific downstream primer of each target gene for reverse transcription; common upstream primer F of the second round PCR: TAATACGACTCACTTAGGG, and the downstream primers are PpBBP1-R2 respectively: TTGTCCCCTCCCTAGCCTTATTTGGT, ppBBP2-R2: CAGCAACGTTAAACGTCCAACCAC, ppUCL3-R2: CACAACAATATGTCCGGTCAATTATT.
The results are shown in FIG. 5C.
The target gene for ppe-miR408 was PpBBP1 (Basic blue protein), ppBBP2 (Basic blue protein 2), ppUCL3 (Uclacyanin 3) as demonstrated by the luciferase assay and the 5' RACE assay (see FIG. 5).
Example 2
The test material is a grafted peach tree grown for 5 years, the stock is wild peach, and the varieties are golden honey No.1 and late Huang Pan respectively.
Based on the expression levels of ppe-MIR408 in the individual sORF treatment groups in example 1, sORF that increased the expression level of ppe-MIR408 most was selected as sORF2-3, and its corresponding small peptide (named ppe-MIPEP408, small peptide sequence: MRCVQKPTRGKSSY, shown in SEQ ID NO. 3) was synthesized artificially.
When two varieties of peach fruits enter into a hard-stone period, the artificially synthesized small peptide ppe-miPEP408 is prepared into two concentrations of 0.2 mu M miPEP408 solution and 0.4 mu M miPEP408 solution by clean water, and the two concentrations are sprayed on peach trees in the evening or in the morning, and 4 strains are sprayed on each variety at each concentration. The spraying is carried out once a week until the peach fruits are ripe, and the spraying is carried out for about 3-4 times, and the fruit ripe is carried out in this example for 4 times. The two varieties are respectively compared with the Control (CK) that only clean water is sprayed without spraying the ppe-miPEP408.
1. Net photosynthesis
The net photosynthetic rate of the leaf was measured by the photosynthetic apparatus the next morning of the last spray, and the measurement result is shown in A of FIG. 7, which shows that the net photosynthetic rate of the treatment group is significantly higher than that of the control group.
2. qRT-PCR detection
Sampling was performed the next morning of the last spray.
The freshly developed young leaves were used to detect the relative expression levels of the ppe-MIR408,3 target genes PpBBP1 (Basic blue protein), ppBBP2 (Basic blue protein), ppUCL3 (Uclacyanin 3) and the photosynthetic related gene PpPC, ppRubisco, ppFd by qRT-PCR.
The primers for ppbp 1 were:
PpBBP1-F:5’-CGTTCACGGGTGAGCTACAT-3’；
PpBBP1-R:5’-TGGCGAACAGCTCTGCATTA-3’；
the primers for ppbp 2 were:
PpBBP2-F:5’-CGTTTAACGTTGCTGGGTGG-3’；
PpBBP2-R:5’-AGCCTTGTTCACAGCAACCA-3’；
the primers for PpUCL3 were:
PpUCL3-F:5’-CAAGCAATGCCATCGGAACC-3’；
PpUCL3-R:5’-GCACAGTGACCTGGAGTAGG-3’；
the primers for PpFd were:
PpFd-F:5’-TTCCTCCTGGTGAAAACCCAAAGA-3’；
PpFd-R:5’-AGCACGGCGGACACACAAACT-3’；
the primers for PpPC were:
PpPC-F:5’-GCCGTTAAGTTTGCAGCCTC-3’；
PpPC-R:5’-GCAACACCTCAATGGCCAAG-3’；
the primers for PpRubisco were:
PpRubisco-F:5’-GGAGCACAAGAACCCCTCTGAAC-3’；
PpRubisco-R:5’-GGAACCCGAACCACATCTATAACATC-3’；
the primers for the reference gene ppact are:
PpActin-F:5’-GTTATTCTTCATCGGCGTCTTCG-3’；
PpActin-R:5’-CTTCACCATTCCAGTTCCATTGTC-3’。
the reaction system and the reaction procedure were as in table 2 above.
The reaction is carried out in an ABI7500 PCR amplification instrument under the conditions of pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 30s and 40 cycles, and finally dissolution profile analysis is carried out: 95℃15s,60℃1min,95℃15s,60℃15s.
The results show that the ppe-miPEP408 with two concentrations can increase the expression level of the ppe-MIR408 gene in two peach varieties and the expression level of the corresponding 3 target genes is obviously reduced (FIG. 6), and the results show that the ppe-miPEP408 sprayed in vitro can play a role.
As a result of examining the expression level of Plastocyanin (PC) in peach leaves, it was found that the expression level of PpPC in the ppe-miPEP408 treated group was significantly higher in the two peach varieties than in the control group (B of FIG. 7). And in the 0.2 mu M and 0.4 mu M ppe-miPEP408 treated groups, the expression level of the photosynthesis-related gene PpRubisco was significantly higher than that of the control group; in contrast, the amount of PpFD gene expressed in 0.2. Mu.M of ppe-miPEP408 treated `golden Honey No. 1` leaves was not significantly different from that in the control group, and the amount of PpFD expressed in 0.4. Mu.M of ppe-miPEP408 treated `golden Honey No. 1` leaves and late yellow flat leaves treated at both concentrations was significantly higher than that in the control group (C of FIG. 7). The results further demonstrate that in vitro applied ppe-mippe 408 can act to increase photosynthesis in peach leaves.
2. Fruit yield and quality
Harvesting mature fruits, and measuring the weight of single fruits and the content of soluble solids.
As a result, as shown in FIG. 8, it can be seen that the soluble solids content of the peach fruits of the two varieties is significantly increased, and the weight of the single fruit is also increased. The results show that the in vitro addition of ppe-mipp 408 also improved the yield and quality of peach fruit.
In conclusion, the ppe-MIR408 gene of peach can code a short peptide ppe-MIPEP408, and the short peptide can increase the expression quantity of the corresponding ppe-MIR408 gene, so that the net photosynthetic rate of peach trees is improved, and the quality of peach fruits is improved. The ppe-mipPEP 408 can be used to make bioregulators that enhance photosynthesis in peach trees.
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims (10)

1. Use of any one or more of Y1-Y5 of the small peptide ppe-mipp 408:
the application of Y1 in promoting photosynthesis of peach;
application of Y2 in increasing weight of single peach fruit
Use of Y3 for increasing peach yield;
the application of Y4 in improving the content of soluble solids in peach fruits;
the application of Y5 in improving the quality of peach fruits;
the small peptide ppe-miPEP408 is a polypeptide with an amino acid sequence of SEQ ID NO. 3.
2. The use according to claim 1, characterized in that the use is to spray a solution containing the small peptide ppe-mipp 408 onto peach trees during the period from hard-core to fruit ripening.
3. Use of any one or more of Z1-Z5 of a substance that increases gene expression:
use of Z1 in promoting photosynthesis of peach;
application of Z2 in increasing weight of single peach fruit
Use of Z3 to increase peach yield;
the application of Z4 in improving the content of soluble solids in peach fruits;
application of Z5 in improving the quality of peach fruits;
the gene encodes the small peptide ppe-mipp 408 as set forth in claim 1.
4. A use according to claim 3, characterized in that: the substance for increasing gene expression is a biological material related to the small peptide ppe-mipp 408 according to claim 1; the biological material is any one of the following B1) to B5):
b1 A nucleic acid molecule encoding the small peptide ppe-mipp 408;
b2 An expression cassette comprising the nucleic acid molecule of B1);
b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);
b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);
b5 A transgenic plant line containing the nucleic acid molecule of B1) and its progeny, or a transgenic plant line containing the expression cassette of B2) and its progeny, or a transgenic plant line containing the recombinant vector of B3) and its progeny.
5. The use according to claim 4, characterized in that: b1 The nucleic acid molecule is a cDNA molecule or a DNA molecule, the coding sequence of which is SEQ ID NO. 2.
6. The small peptide ppe-mipp 408 according to claim 1.
7. The biomaterial associated with the small peptide ppe-mipp 408 according to claim 6, wherein the biomaterial is any one of the following B1) to B5):
b1 A nucleic acid molecule encoding the small peptide ppe-mipp 408;
b2 An expression cassette comprising the nucleic acid molecule of B1);
b3 A recombinant vector comprising the nucleic acid molecule of B1) or a recombinant vector comprising the expression cassette of B2);
b4 A recombinant microorganism comprising the nucleic acid molecule of B1), or a recombinant microorganism comprising the expression cassette of B2), or a recombinant microorganism comprising the recombinant vector of B3);
b5 A transgenic plant line containing the nucleic acid molecule of B1) and its progeny, or a transgenic plant line containing the expression cassette of B2) and its progeny, or a transgenic plant line containing the recombinant vector of B3) and its progeny.
8. The biomaterial according to claim 7, wherein the nucleic acid molecule of B1) is a cDNA molecule or a DNA molecule whose coding sequence of the coding strand is SEQ ID No. 2.
9. Plant agent, characterized in that it comprises the small peptide ppe-mipp 408 according to claim 6, or the biological material according to claim 7 or 8, which is an agent that increases photosynthesis and/or increases weight of peach fruits and/or increases yield and/or increases soluble solids content and/or increases quality of peach fruits.
10. A method for producing a peach variety having a high photosynthetic rate and/or a high single fruit weight and/or yield and/or a high content of fruit soluble solids and/or a good fruit quality, comprising introducing a gene encoding the small peptide ppe-mippe 408 of claim 5 into a desired peach variety to obtain a peach variety having a high photosynthetic rate and/or a high single fruit weight and/or yield and/or a high content of fruit soluble solids and/or a good fruit quality; the photosynthetic rate is high, and/or the weight and/or the yield of single fruits are high, and/or the content of soluble solids in fruits is high, and/or the quality of fruits is good, and the photosynthetic rate is high, and/or the yield is high, and/or the quality of fruits is high, and is high, compared with that of the target peach variety.
CN202310402325.1A 2023-04-11 2023-04-11 Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof Pending CN116589535A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310402325.1A CN116589535A (en) 2023-04-11 2023-04-11 Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310402325.1A CN116589535A (en) 2023-04-11 2023-04-11 Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof

Publications (1)

Publication Number Publication Date
CN116589535A true CN116589535A (en) 2023-08-15

Family

ID=87594559

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310402325.1A Pending CN116589535A (en) 2023-04-11 2023-04-11 Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof

Country Status (1)

Country Link
CN (1) CN116589535A (en)

Similar Documents

Publication Publication Date Title
CN110872598B (en) Cotton drought-resistant related gene GhDT1 and application thereof
CN105753953B (en) Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant
CN110713529A (en) Application of VvDUF642 gene in causing abortion of plant seeds
CN116218876A (en) Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof
CN109762828B (en) Apple fruit hexose transporter gene MdHT2.2 and application thereof
CN110577960A (en) pear lignin synthesis gene PbMC1a/1b and application thereof in genetic improvement of fruit quality
CN117511975A (en) Application of LecRK27 gene in improving fruit uniformity and yield
CN113564198A (en) Application of RNAi (ribonucleic acid interference) on PALM1 gene to increase number of small leaves of leguminous forage
CN110669782B (en) Application of soybean sugar transporter gene GmSWEET39
CN112626069A (en) Soybean gma-miR4359b gene, expression vector thereof, preparation method and application thereof
US20210395764A1 (en) Method for obtaining ricin/rca-free castor-oil plant seeds, ricin/rca-free castor-oil plants, method for identifying ricin/rca-free castor-oil plants, polynucleotides, constructs and uses thereof
CN114958906B (en) Gene and promoter related to low potassium stress of tobacco and application of gene and promoter
CN110041417A (en) A kind of hexose transport albumen and its encoding gene and application
CN105585623A (en) Cultivating method for disease-resistant TaMYB-KW gene-transferred wheat, related biomaterials and application
CN113881685B (en) Gene PpHSP20-like1 for promoting plant organ to produce red color and application thereof
CN116589535A (en) Small peptide ppe-miPEP408 for regulating photosynthesis of peach trees and application thereof
CN107723293B (en) Cotton fiber development related gene GbWRKY32 and expression vector and application thereof
CN110343155B (en) Vaccinium myrtillus fruit acetylated anthocyanin specific transporter VcMATE2
CN113234753A (en) Cultivation, identification and application of maize microfilament depolymerizing factor ADF7 transgenic plant
CN113337522A (en) Application of cotton GhNFYC4 gene in promoting plant flowering
CN114516908B (en) Rice grain shape regulatory protein HOS59, encoding gene and application thereof
CN117210490B (en) PCHR gene for regulating and controlling malus plant self-flower fructification and application thereof
CN106754932A (en) A kind of DNA molecular STTM miR482a and its application
JPH09201190A (en) Highly iron-containing plant produced by molecular breeding and method for producing the plant
CN116041457A (en) IbTIP1 gene derived from sweet potato, protein coded by same and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination