CN107723293B

CN107723293B - Cotton fiber development related gene GbWRKY32 and expression vector and application thereof

Info

Publication number: CN107723293B
Application number: CN201610648301.4A
Authority: CN
Inventors: 陈全家; 曲延英; 倪志勇; 加得拉·吐留汗
Original assignee: Xinjiang Agricultural University
Current assignee: Xinjiang Agricultural University
Priority date: 2016-08-09
Filing date: 2016-08-09
Publication date: 2023-07-28
Anticipated expiration: 2036-08-09
Also published as: CN107723293A

Abstract

The invention discloses a cotton fiber development related gene GbWRKY32, the base sequence of which is shown in SEQ ID NO: 1. The inventor clones the WRKY transcription factor GbWRKY32 from the island cotton for the first time, verifies the application of the GbWRKY32 gene in enhancing the cotton fiber quality, and provides important theoretical support for improving the cotton fiber quality breeding. In addition, the method for enhancing the cotton fiber quality can effectively enhance the fiber quality of target cotton, is simple and convenient, has good repeatability, has no influence on the growth and development of cotton, and is suitable for popularization and application.

Description

Cotton fiber development related gene GbWRKY32 and expression vector and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to the field of cotton genetic engineering, and more particularly relates to a cotton fiber development related gene, and an expression vector and application thereof.

Background

The total cotton yield in China is the first world, but the fiber quality is single, and the domestic requirement for high-quality cotton fibers cannot be met. Good conditions are required for the formation of good fiber quality. Genotype, hormone, light, temperature are all major factors affecting fiber quality formation. Traditional cotton breeding has contributed greatly to the improvement of fiber quality over a long period of time. However, in recent years, the traditional breeding enters the cervical flask period, and a new variety with excellent quality is difficult to be deduced through a conventional breeding method. With the development of bioinformatics, cotton molecular biology, genomics and other subjects, the development of molecular means for improving cotton fiber quality brings wide prospects.

The synchronous improvement of cotton fiber quality and yield by transgenic technology is the main work of cotton breeding in China. The whole cotton fiber development process is regulated by a plurality of transcription factors and genes. The related genes obtained by separation at present cannot systematically elucidate the mechanism of cotton fiber development. There is thus still a need to identify transcription factors and genes involved in cotton fiber development. The functional and molecular mechanism studies of WRKY transcription factors in the process of superior fiber formation in island cotton are not clear enough and extensive studies are required to elucidate the mechanism therein.

Disclosure of Invention

The present invention aims to solve at least one of the technical problems in the related art to some extent. For this purpose, an object of the present invention is to propose a cotton fiber development related gene GbWRKY32.

The present invention has been completed based on the following findings by the inventors: transcription factors are regulatory proteins that activate or repress transcription of multiple target genes in an organism. Is involved in the processes of plant growth, aging, signal transduction, substance metabolism regulation and control, etc. The WRKY domain consists of a C end and an N end of a zinc finger structure, wherein the N end contains a highly conserved amino acid sequence consisting of WRKYGQK, and can be specifically combined with w-box in a gene promoter so as to play a role in transcriptional regulation. WRKY has tissue-specific characteristics and is expressed in tissues such as leaves, stems, flowers, vascular tissues, fruits and the like of different plants. The expression of the method has the characteristics of rapidness, transiently and the like. In contrast to other species, cotton WRKY genes, particularly subgroups I and II, are amplified by multiple whole genome repeats and tandem repeats. Transcriptome analysis suggests that many WRKY genes are involved in specific fiber development processes such as fiber initiation, elongation and maturation.

The inventor clones WRKY gene from island cotton 'New sea 21' according to previous research, and names the WRKY gene as GbWRKY32, and the base sequence of the WRKY gene is shown as SEQ ID NO: 1.

In another aspect of the invention, the polypeptide of SEQ ID NO:1 to a vector pCAMBIA1304 to obtain a cotton fiber development related gene plant expression vector pCAMBIA1304-GbWRKY32.

In a third aspect of the present invention, there is provided a method of improving the quality of cotton fibers, the method comprising the steps of:

cloning cotton fiber development related genes;

constructing a cotton fiber development related gene plant expression vector;

and transferring the plant expression vector of the cotton fiber development related gene into cotton by using an agrobacterium infection method.

Further, the cotton fiber development related gene is GbWRKY32, and the base sequence of the gene is shown in SEQ ID NO: 1.

Further, the cotton fiber development related gene plant expression vector is pCAMBIA1304-GbWRKY32.

In a fourth aspect of the present invention, the improvement of cotton fiber quality by hybridization comprises the steps of:

hybridization is carried out on cotton with cotton fiber development related gene GbWRKY32 as male parent or female parent and female parent or male parent without the gene;

and screening the cotton fiber quality of the offspring to obtain the cotton variety with high-quality fiber.

According to the embodiment of the invention, the expression of the GbWRKY32 gene can enhance the drought resistance of cotton.

The inventor clones the WRKY transcription factor GbWRKY32 from the island cotton for the first time, verifies the application of the GbWRKY32 gene in enhancing the cotton fiber quality, and provides important theoretical support for improving the cotton fiber quality breeding. In addition, the method for enhancing the cotton fiber quality can effectively enhance the fiber quality of target cotton, is simple and convenient, has good repeatability, has no influence on the growth and development of cotton, and is suitable for popularization and application.

Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Drawings

The foregoing and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings, in which:

FIG. 1 shows an RNA agarose electrophoresis pattern of sea island cotton Nepala 21 in one embodiment of the invention;

FIG. 2 shows an RT-PCR amplified agarose electrophoresis of the GbWRKY32 gene in one embodiment of the invention;

FIG. 3 shows a predicted GbWRKY32 protein affinity/hydrophobicity plot in one embodiment of the invention;

FIG. 4 shows a transgenic tobacco exogenous gene integration test diagram in one embodiment of the invention;

FIG. 5 shows a q-PCR detection of transgenic plants in one embodiment of the invention;

FIG. 6 shows a plant height comparison of wild type plants with positive plants in one embodiment of the invention;

FIG. 7 shows a graph of leaf number comparison of wild type plants versus positive plants in one embodiment of the invention;

FIG. 8 shows a graph comparing flowering numbers of wild type plants with positive plants in one embodiment of the present invention.

Detailed Description

The following detailed description of the invention is illustrative, and is not to be construed as limiting the invention.

Unless otherwise noted below, the reagents and equipment referred to in the examples below, which are not specifically addressed, may be from conventional commercial products.

Experimental reagent

DNAmarker (DL 2000), DNA marker (DL 15000+2000), agarose gel DNA recovery kit, plasmid miniprep kit were purchased from Beijing Tiangen (Tian Gen) Biochemical technology Co., ltd; transStartFast Pfu DNA Polymerase kit, E.coli (E.coli) DH 5. Alpha. Competence from Beijing complete gold (Trans Gen Biotech) Biotechnology Co., ltd; revertAid First Strand cDNA Synthesis Kit available from Siemens Feier (Thermo Scientific) technology; pMD19-T vectors were purchased from TaKaRa Dalian, takara; other reagents are all of domestic analytical purity. Primer synthesis was performed by Beijing Huada (BGI) biosciences and sequencing work was performed by Shanghai American season (Majorbio) biosciences.

Main instrument and equipment

Ultraviolet spectrophotometer (Colibri Spectrometer), gradient PCR instrument (Eppendorfpro), electrophoresis apparatus (model six DYY-6D), ultra clean bench (Box-SD-CJ-1 FD), constant temperature incubator (ZHICHENG ZHWY-200D).

Example 1

Cloning and bioinformatics analysis of cotton fiber development gene GbWRKY32

1. Material

Sea island cotton "Xinhai 21" was used as a test material (both were supplied by Xinjiang agricultural university crop genetic breeding laboratory). The sea island cotton 'Xinhai 21' has strong ringing property, good quality and high and stable yield, and is the optimal material for researching sea island cotton fibers.

2. Method and results

2.1 extraction of Total RNA from island Cotton

(1) Preparing an RNA extracting solution: 2% CTAB,4% PVP,100mmol. L ^-1 Tris-HCl(pH 8.0)，25mmol.L ^-1 EDTA(pH 8.0)，2mol.L ^-1 NaCl；

(2) Taking 200-300 mg of sea island cotton leaves, adding liquid nitrogen, grinding for three times, rapidly transferring the materials into a 2mL centrifuge tube, adding 1mL of extracting solution preheated in advance (65 ℃) and 1% of beta-mercaptoethanol, oscillating for 15sec, uniformly mixing, and shaking for 2-3 times in the middle of water bath at 65 ℃ for fully uniformly mixing and preheating;

(3) Adding chloroform of 0.6 times volume, mixing, standing for 10min, and centrifuging at 12000rpm for 20min at 4deg.C;

(4) Transferring the supernatant to a new 2mL centrifuge tube, adding 0.6 times of chloroform for re-extraction, and repeating for 2 times;

(5) The upper aqueous phase was taken and added 1/10 times the volume of 3mmol.L ^-1 Placing NaAC and isopropyl alcohol with the same volume into the temperature of minus 20 ℃ to precipitate for 4 hours;

(6) Centrifuging at 12000rpm at 4deg.C for 20min, washing the precipitate with 70% ethanol, and air drying;

(7) Adding proper amount of DEPC H ₂ O was dissolved and stored at-80 ℃.

The total RNA content of the extracted island cotton was measured by a Colibri Spectrometer ultraviolet spectrophotometer. The results indicate that the OD of the total RNA extracted _260/280 The value is above 2.0, and after 3ul total RNA is subjected to agarose gel electrophoresis of 1%, the 28S rRNA and the 18S rRNA are bright, clear and free of tailing, and the requirement of subsequent experiments is met (figure 1).

2.2 Synthesis of first strand cDNA

The first strand cDNA was synthesized using the total RNA of the extracted sea-island cotton fresh sea 21 leaves as a template, as specified by Thermo company RevertAid First Strand cDNA Synthesis Kit.

(1) The following reagents were added in order to the RNase-free PCR tube:

(2) After mixing 12 μl of the mixture, incubating at 65deg.C for 5min, centrifuging, and cooling;

(3) The following components are added in sequence;

(4) Gently mixing, and centrifuging;

(5) Incubating at 42 ℃ for 60min;

(6) Heating at 70deg.C for 5min to terminate the reaction;

(7) The cDNA was kept at-80℃until use.

2.3 internal control detection

The sequence of the reference primer in UBQ7 is as follows:

UBQ7F:5’-GACCTACACCAAGCCCAAGAAG-3’

UBQ7R:5’-TGAGCCCACACTTACCACAATAGT-3’

the reaction system is as follows:

internal reference detection PCR procedure:

the resulting PCR products were electrophoretically detected on a 1.2% agarose gel.

2.4 cloning and sequencing of the GbWRKY Gene

According to Unigene sequences obtained by screening a cotton fiber development transcriptome library, gbWRKY32, gbWRKY40 and GbHCT gene primers are designed, and the sequences are as follows:

the PCR amplification system is the same as the reference detection reaction system. The amplification procedure was:

pre-denaturation at 94℃for 4min

And detecting the PCR product by electrophoresis. The band of interest was purified and ligated to pMD19-T in the following ligation system:

e.coli DH5 alpha competent cells are transformed by 10ul of connecting solution, the cells are coated on LB solid medium containing 50mg/mL ampicillin, single colony is picked up after being placed in a constant temperature incubator (37 ℃) for 10-12 hours, PCR detection is carried out, the result shows that the ORF of the gene is 1077bp (figure 2), 358 amino acid residue proteins are encoded, the predicted theoretical molecular weight of the protein is 39.288kD, and the isoelectric point is 5.02.. Sequencing the bacterial liquid with correct detection by Shanghai Mei-Quaternary company (Majorbio), wherein the sequencing result shows that the base sequence is shown as SEQ ID NO: 1.

2.5 Sequence analysis of GbWRKY Gene

Using NCBI dataBlast @ in libraryhttp://blast.ncbi.nlm.nih.gov/Blast.cgi) The program performs alignment of homologous sequences; analyzing physicochemical properties of the protein by DNAMAN software; protScale for affinity/hydrophobicity analysis ^[120] Software [ (software)http://expasy.org/tools/protscale.html) The method comprises the steps of carrying out a first treatment on the surface of the SMART software for protein domain analysishttp:// smart. Embl-heidel-berg. De); phylogenetic tree analysis is done by the MEGE software. 2. Tertiary structure division Made of SOPMA(http:// metadatabase. Org/wiki/SOPMA) software and Swiss-Model (http:// swissmodel expasy org) software predictions ^[121] . Corresponding genomic DNA sequences were obtained by searching using Gossypium barbadense Annotation Project (Http:// chip. Cropdb. Org) using GSDS2.0 #http:// gsds.cbi.pku.edu.cn/index.php) And analyzing the gene structure on line.

The results of the hydrophilic-hydrophobic nature of the GbWRKY32 protein were analyzed by (http:// expasy. Org/tools/ProtScale. Html) ProtScale on-line bioinformatics software and showed that: the GbWRKY32 protein was the least hydrophobic at position 119, scored-3.58 (proline), the most hydrophilic at position 333, scored +2.59 (leucine). Indicating that the protein is a hydrophilic protein (FIG. 3). BLAST search genome database of island cottonHttp/(cotton. Cropdb. Org) found the GbWRKY32 radical Gbscaffold4329.4.0 due to the corresponding island cotton genomeThe sequence, the chromosome position is Gbscaffold4329:112360-113975, the whole length is 1616bp.

Using GSDS 2.0%http://gsds.cbi.pku.edu.cn/index.php) On-line analysis of the GbWRKY32 gene structure found that GbWRKY32 contained two introns and three exons.

Example 2

Construction of plant expression vectors

Primers for adding cleavage sites Nco I and Bgl II are designed according to pCAMBIA1304 vector and GbWRKY32 gene sequences, and the sequences are as follows:

GbW1-1304-F:5'-TTTCCATGGATGGCTGTGGAATTGATGAT-3'，GbW1-1304-R:5'-TTTAGATCTAGATGACTCAAGAACCAAAGGTG-3'。

PCR amplification is carried out by taking pMD19-T-GbWRKY32 recombinant plasmid as a template, the obtained target fragment is purified, and the recovered product and pCAMBIA1304 vector are respectively carried outPerforming double enzyme digestion, wherein the enzyme digestion system is as follows: 5. Mu.L each of Nco I and Bgl II, 10 XBuffer 5. Mu.L, ddH ₂ O15. Mu.L, double cleavage recovery product/pCAMBIA 1304 plasmid 20. Mu.L, total volume 50. Mu.L. At T ₄ The connection is carried out under the action of ligase, and the connection system is as follows: t (T) ₄ Ligase Buffer 0.5. Mu.L, pCAMBIA1304 Vector 10. Mu.L, target DNA recovery fragment 5. Mu.L, 10 XLigase Buffer 2.5. Mu.L, ddH ₂ A total volume of O2. Mu.L of 20. Mu.L; placing the strain into a constant-temperature water bath kettle at 22 ℃ for connecting for 20min, transforming escherichia coli DH5 alpha, placing the strain into a constant-temperature incubator at 37 ℃ for culturing for 12h, and picking single colonies. Bacterial liquid PCR was performed and then sent to the Majorbio company for sequencing, and the results prove that the pCAMBIA1304-GbWRKY32 sequence is correct.

Example 3 functional verification of GbWRKY32 Gene

Competent preparation and transformation of Agrobacterium

(1) Streaking the cryopreserved Agrobacterium EHA105 glycerol bacteria on solid YEB medium containing rifampicin, and culturing at 28℃for about 2d;

(2) Picking single colony, inoculating in 5mLYEB liquid culture medium, and shake culturing at 28deg.C for about 2d;

(3) Sucking 2ml of cultured bacterial liquid into 50mLYEB liquid culture medium for continuous culture until OD ₆₀₀ ＝0.6；

(4) Transferring the bacterial liquid into a sterile centrifuge tube, carrying out water bath for 30min, and centrifuging at 4000rpm for 10min;

(5) With 2mL of 20mM CaCl ₂ Re-suspending the thalli, sub-packaging the thalli into a sterile centrifuge tube according to 200 mu L of each tube, and preparing the agrobacterium competent cells;

(6) Adding 5-8 mu L of plasmid DNA of plant expression vector into the prepared agrobacteria competent cells for 5min in ice bath;

(7) Transfer to liquid nitrogen and freeze for 8min. Rapidly heating in 37deg.C water bath for 5min;

(8) Adding 800 mu L of YEB culture medium at 28 ℃ for pre-culture for 4-5 hours at 250 r/min;

(9) Coating a YEB solid plate containing kanamycin, and culturing for 24-48 hours at 28 ℃ to ensure that agrobacterium colonies grow out;

(10) Single colony is picked up, and the bacterial liquid PCR is performed by shaking.

Then, the agrobacterium EHA105 strain is transformed by using the recombinant plasmid with correct sequence, and bacterial liquid PCR identification is carried out to obtain 1077bp target band, which proves that the pCAMBIA1304-GbWRKY32 recombinant plasmid has been successfully transferred into agrobacterium.

Acquisition of aseptic seedlings

A small amount of the raw tobacco seeds was taken with a 1.5mL EP tube. Treatment with 75% ethanol on an ultra clean bench for 30s followed by 10% H ₂ O ₂ (Hydrogen peroxide) treating for 10-15 min, flushing the medicine on the seed epidermis with sterile water for multiple times, and then culturing on MS culture medium for 16h/8h in a light-dark way.

Dip-dyeing of raw tobacco

Preparing solid YEB (containing Kan 50mg/L and Rif 50 mg/L) culture medium, streaking to culture recombinant plasmid pCAMBIA-WRKY32, inoculating to 5mL (containing Kan 50mg/L and Rif 50 mg/L) liquid culture medium, shake culturing at 28deg.C and 250rpm for 36 hr, and expanding culture to OD according to a ratio of 1:100 ₆₀₀ Centrifugation at 4000rpm around 0.8 for 10min. The obtained bacterial liquid is resuspended to OD by using MS liquid culture medium ₆₀₀ Taking the strong leaf under the aseptic environment at about 0.6, and beating the leaf into small discs with the diameter of 1cm by using a sterilized puncher. Placing the leaves into the resuspended bacterial liquid, culturing for 15-30 min at 28 ℃ in an oscillating way, taking out the leaves, and sucking the bacterial liquid on the surface by sterile filter paper. Leaf surface downward, inoculated on co-culture medium (MS+1.0 mg/L6-BA+0.1 mg/LNAA, pH 5.8) at 25℃in the dark for 2d, after which leaf surface was transferred to differentiation screening medium (MS+1.0 mg/L6-BA+0.1 mg/L NAA+20mg/L Hyg+500mg/L Cef, pH 5.8). And subculturing for 10-15 d for one time until the callus and the resistant buds are differentiated. When the adventitious bud length is more than 3cm, cutting and inserting the adventitious bud length into rooting culture medium (1/2MS+0.1 mg/L NAA+20mg/L Hyg+300mg/L Cef, pH 5.8), growing adventitious roots for about two weeks, and transplanting the seedling into soil (soil: vermiculite=2:1) for culture. Obtaining transgenic plants.

Molecular detection of transgenic tobacco

The total DNA of transgenic tobacco is extracted, recombinant plasmid pCAMBIA-WRKY32 is used as positive control, wild tobacco is used as negative control, and primers with enzyme cutting sites and specific primers with Hyg sites are used for DNA level detection. The sequence is as follows:

GbW1-1304-F:5'-TTTCCATGGATGGCTGTGGAATTGATGAT-3'，

GbW1-1304-R:5'-TTTAGATCTAGATGACTCAAGAACCAAAGGTG-3'。

Hyg-F:GATGTTGGCGACCTCGTATT,

Hyg-R:TCGTTATGTTTATCGGCACTTT。

RNA is extracted for fluorescence quantitative PCR detection, and qPCR primer sequences are as follows:

GbW1-qP-F：5'-AACCAATCAAAGGTTCTCCTCATC-3'，

GbW1-qP-R：5'-AGATGACTCAAGAACCAAAGGTGC-3'。

the DNA extracted from transgenic tobacco plants is screened by using a primer with double enzyme cutting sites and hygromycin (hygromycin), the DNA of wild plants is used as a negative control, the pCAMBIA1304-GbWRKY32 recombinant plasmid is used as a positive control for amplification, and after electrophoresis detection, 8 plants are amplified to obtain 1077bp specific bands, which primarily shows that the exogenous gene is successfully integrated into the tobacco genome (figure 4).

Real-time fluorescence PCR detection of transgenic tobacco

In order to obtain a positive plant with high fidelity, total RNA of tobacco leaves is extracted, reversely transcribed into cDNA and fluorescent quantitative PCR amplification is carried out. As can be seen from FIG. 5, the expression level of the transgenic GbWRKY32 plant No. 1 is 70 times that of the wild type plant, and the expression levels of the transgenic GbWRKY32 plants No. 2 and No. 3 are about 5 times that of the wild type plant. Wild type plants are hardly expressed. The detection result also shows that the exogenous gene is successfully integrated into the tobacco genome.

Morphological observations of transgenic tobacco

WRKY transcription factors are involved in a number of processes in plant growth including seed germination, morphogenesis, senescence, and the like. The research shows that the GbWRKY32 gene-transferred tobacco grows for 10 days to grow 4-5 new leaves, the wild plants grow 7-8 new leaves, and the number of the GbWRKY32 gene-transferred plants is less than that of the wild plants. The stem of the transgenic plant is thin and long on the change of the stem, and the stem of the wild tobacco is thick and short. The transgenic plants begin to bloom after being transplanted into the soil for about 45d, the wild plants begin to bloom after about 60d, and the GbWRKY32 gene tobacco is more similar to the wild plants in flowering quantity (figures 6, 7 and 8).

Observation of tobacco leaf and stem surface coat

The transgenic GbWRKY32 gene growing at the same time and the leaves and stems of the wild plants with the same size are amplified by 6.3×,40×and80× under a split microscope, and the hair growth condition of the epidermis is observed. The number of leaf coat of transgenic GbWRKY32 plant is found to be significantly more than that of wild type plant, but there is no significant change in length. The same conclusion was reached in the stems. It is suggested that the GbWRKY32 gene may play a role in epidermal hair development.

In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms do not necessarily refer to the same embodiments or examples. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

While embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. An application of cotton GbWRKY32 gene in promoting the development of tobacco epidermis, wherein the base sequence of the GbWRKY32 gene is shown in SEQ ID NO: 1.

2. Use according to claim 1, characterized in that tobacco coat development is promoted by the plant expression vector pCAMBIA1304-GbWRKY32 by expression of the amino acid sequence of SEQ ID NO:1 to the vector pCAMBIA 1304.