CN116497038A

CN116497038A - Alfalfa low temperature resistant gene MfJAZ1 and application thereof

Info

Publication number: CN116497038A
Application number: CN202310655558.2A
Authority: CN
Inventors: 张攀; 王召誉; 张宇; 李涵; 金依凝; 秦立刚; 李冰; 林宇龙; 梅琳琳; 柴璐; 丁德顺; 杨梅; 尹航; 崔国文
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2023-06-05
Filing date: 2023-06-05
Publication date: 2023-07-28
Anticipated expiration: 2043-06-05
Also published as: CN116497038B

Abstract

The invention discloses a low-temperature resistant gene MfJAZ1 of alfalfa and application thereof, belonging to the technical field of plant genetic engineering, wherein the nucleotide sequence of the low-temperature resistant gene MfJAZ1 is shown as a sequence 1, the full length of the MfJAZ1 is 1176bp, and the molecular formula is C ₁₁₈₁ H ₁₈₈₅ N ₃₂₅ O ₃₈₂ S ₁₂ The molecular weight is 27.13kDa, and the application of the low temperature resistant gene MfJAZ1 of alfalfa in improving the cold resistance or low temperature resistance of plants to the environment is also disclosed, which contributes to the cultivation of excellent cold resistant plants.

Description

Alfalfa low temperature resistant gene MfJAZ1 and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a low-temperature resistant gene MfJAZ1 of alfalfa and application thereof.

Background

Temperature is the primary environmental factor affecting plant growth and development and geographical distribution. Low temperature stress (cold and freeze) is one of the main factors limiting crop growth, yield and quality. Therefore, the response mechanism and tolerance mechanism of the plant under low temperature stress are explored, and the method has very important economic and social values for improving the low temperature tolerance of crops and increasing the crop yield. Under natural conditions, low-temperature stress is divided into cold injury and freeze injury, and the influence of the freeze injury on plants is larger than that of the cold injury, so that ice crystals are formed in plant cells, the cells are promoted to be dehydrated, and mechanical damage is caused to membrane lipid structures. Under low temperature stress, plants produce a series of stress changes to be lower than low temperature damage, such as reduced photosynthesis, increased respiration, changes in cellular metabolic substances, etc. Cold acclimation is to use the change of substances in plants when the plants meet low temperature to expose the plants to a low temperature which is not lethal for a certain time, thereby improving the tolerance of the plants to low temperature stress.

The alfalfa industry is the pillar industry of the grass industry in China, but winter low temperature in northern areas is always a main environmental factor for limiting alfalfa growth and overwintering. The low temperature resistance of the improved alfalfa variety is the key for ensuring the safety of the alfalfa variety, and is a key scientific problem to be solved in the alfalfa breeding field. The alfalfa is perennial forage grass of the genus alfalfa of the family Leguminosae, has strong adaptability and low temperature resistance which is superior to that of the alfalfa, and contains a plurality of resistance genes which are not possessed by the alfalfa. The alfalfa is improved by developing the excellent stress resistance gene of the alfalfa, so that an excellent cultivar is cultivated, and the yield and quality of the alfalfa can be improved. Therefore, the research on the low temperature resistance of the alfalfa has important economic and social values for improving the low temperature tolerance of crops and increasing the yield of the crops.

Disclosure of Invention

In view of the above, the invention aims to provide a low-temperature resistant gene MfJAZ1 of alfalfa and application thereof, so as to cultivate excellent alfalfa varieties.

The invention solves the problems by adopting the following technical scheme:

the low temperature resistant gene MfJAZ1 of alfalfa is shown in sequence 1, and the specific nucleotide sequence of the low temperature resistant gene MfJAZ1 is as follows:

sequence 1:

AAGCAGTGGTATCAACGCAGAGTACGGGGGATCCAAAACAACAACACAAAGAATCATTCACACTTTCATTCTTATTACAACGCGTTTTGTTTTCTCTCTCTCTCTTGAGTCTTGAATATCATCATCTCTAACTATGTCTACCTCATCGGAATATTCAGAAGTTTCCGGCAACAAACCACCGGCGAAGTCACCGGAGAAAACAACTTTCTCTCAAACATGTAGTTTATTGAGTCAATATATTAAGGAAAAGGGTTGCTTCAAAGATCTTTCTCTTGGTATCACATGCAACGCAGACCCTTCTGGGTCTTCTGAGACTTCTTCTCAATCTGCAACAACCATGAACTTGTTTCCAACCATGGAAAACAATTTGACACAAAAGAACCTTACAACTATGGATTTGCTCACTCCACAAGCTTCTTTGAACAATTCCAATGCTATCAAGGGACCTAAAGCTGCACAATTGACAATGTTTTATAATGGTCAAGTTATTGTATTTGACGATTTTCCTGCCGACAAAGCACATGAGCTCATGGCTTTTGCTAATAAAGGAATCTCTCAAAGTCAGAACAATTCTGTGTACACTTACACACAGAGCCAGCCTTCATTTCCTCCTAATTTGGTCAGAACTTCGGTTAACACAACCGCTCCAATCGTTCCTACTGTGAACATCATTCCTAGTACTGGCACCGGCACCGGCTCGATTAATGAACACCTTCAAGTGCCTTCCAGACCTAATCTTTGCGATCTGCCAATTATGAGGAAAGCCTCGCTTCATCGGTTTCTGGAGAAGAGAAAGGATAGAATTGCTGCCAATGCACCATATCAAGTTAATAAGCCAGCTGAGTCCATGTCATGGCTTGTGGGTGCAAAATCAACTCAAATTTGATCTCAATTCTCAGCTATAATTTTAATGTAATTTTGAGCATTTTTGTTACAAAAAAACAGATGCTACTTAGTCAGATTTATTTTTGCCGGAATTTTTTAGACAAAGAAGTTTCTGGTTATTTTTTCCTTGACTAGATAGCATTATTAATATTATCATTATTTTTCTTGTTTAATGCACATGGTTAAGATGTAATATGTTATTGGTTTTTTGTTGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAGTACTCTGCGTTGATACCACTGCTTGCCCTATAGTGAGTCGTATTAG。

protparam analysis showed that the MfJAZ1 encoded protein contains 20 basic amino acids, the Ser (12.4%) is highest, the Trp (0.4%) is lowest, 22 positively charged amino acid residues (Arg, lys), and 18 negatively charged amino acid residues (Asp, glu).

The molecular formula of the MfJAZ1 gene is C ₁₁₈₁ H ₁₈₈₅ N ₃₂₅ O ₃₈₂ S ₁₂ Molecular weight of 27.13kDa and theoretical isoelectric point of 8.83; the extinction coefficient is 14440-14690; the instability coefficient is 44.96, an unstable protein; the fat coefficient was 68.32, the average hydrophilic coefficient was-0.444, and it was a hydrophilic protein.

The SOPMA is used for predicting the secondary structure of the MfJAZ1 gene protein, and the protein contains 37 alpha-helices with the ratio of 14.8%,7 beta-turns with the ratio of 2.8%,24 extension chains with the ratio of 9.6% and 182 random coils with the ratio of 72.8%.

The invention also discloses application of the alfalfa low temperature resistance gene MfJAZ1, and application of the alfalfa low temperature resistance gene MfJAZ1 in improving the environmental cold resistance or low temperature resistance of plants, wherein the plants comprise alfalfa, arabidopsis thaliana, tobacco and the like.

The beneficial effects are that:

the MfJAZ1 can reduce the low temperature resistance of plants by regulating ROS clearance, osmotic balance and expression of KIN, ERD10C, COR15A, GSTF, GSTF7, LEA5 and CAT genes, and the result provides a new negative regulation gene for cold-resistant breeding of alfalfa, enriches the research of the low temperature resistant molecular mechanism of alfalfa, and has important significance for improving the yield and quality of alfalfa. In addition, the gene lays a foundation for the application of the gene to other plants to develop low-temperature resistant crops.

Drawings

Fig. 1: electrophoresis detection result diagram, wherein A: total RNA electrophoresis; b: cDNA quality assessment; c: mfJAZ1 CDS sequence electrophoresis band; m:2000bp DNA marker;1-3: electrophoresis strips;

fig. 2: detecting electrophoresis patterns of MfJAZ 15 'and 3' sequences in escherichia coli, wherein lanes 1, 2 and 3 are 5 'sequences, and lane 4 is 3' sequences;

fig. 3: a three-dimensional model of MfJAZ1 protein;

fig. 4: genome Walking Kit specific primer design schematic;

fig. 5: total DNA electrophoresis (using 15000bp DNA Maker), B: chromosome walking electrophoresis (using 2000bp DNA Maker);

fig. 6: the expression pattern of the MfJAZ1 gene of alfalfa; a: tissue-specific expression; b: the relative expression amount of the MfJAZ1 gene changes under low temperature stress; c: the relative expression amount of the MfJAZ1 gene changes under drought stress; d: the relative expression amount of the MfJAZ1 gene changes under salt stress; e: the relative expression amount of the MfJAZ1 gene changes under the alkali stress; f: the relative expression amount of the MfJAZ1 gene changes under the stress of ABA;

fig. 7: verifying an electrophoresis pattern of an MfJAZ1 fragment in the transient expression vector;

fig. 8: subcellular localization of the MfJAZ1 gene in tobacco; transferring the MfAJZ1-GFP recombinant vector and 35S/GFP empty vector into tobacco epidermal cells of Nicotiana benthamiana, and measuring the proportion by weight to 25 mu m;

fig. 9: leaf map of transgenic arabidopsis lines; WT (A), over-expression (B), mutant (C) and complementary (D) plant leaves, scale bar, 0.2cm from left to right

Fig. 10: the transgenic arabidopsis has relative conductivity and MDA change under the stress of 4 ℃ (A) and-5 ℃ (B);

fig. 11: the transgenic arabidopsis has O2 & lt- & gt and SOD activity change under the stress of 4 ℃ (A) and-5 ℃ (B);

fig. 12: transgenic arabidopsis thaliana changes in POD, CAT, GSH activity under stress of 4 ℃ (a) and-5 ℃ (B);

fig. 13: transgenic arabidopsis changes in soluble sugar content, soluble protein content, and proline content under stress of 4 ℃ (a) and-5 ℃ (B).

Fig. 14: CAT gene and POD gene expression levels in transgenic Arabidopsis at 4 ℃ and-5 ℃ under stress;

fig. 15: expression level of KIN gene and LEA5 gene in transgenic Arabidopsis under stress at 4 ℃ and-5 ℃;

fig. 16: ERD10C gene expression levels in transgenic Arabidopsis at 4℃and-5℃stress;

fig. 17: expression level of COR15A Gene and GSTF6 Gene in transgenic Arabidopsis at 4℃and-5℃under stress

Fig. 18: GSTF7 gene expression levels in transgenic Arabidopsis thaliana under stress at 4℃and-5 ℃.

Detailed Description

The invention will be described in detail below with reference to specific embodiments and accompanying drawings:

the test methods used in the examples of the present invention are conventional methods unless otherwise specified. Materials, reagents, and the like used in the examples of the present invention are commercially available unless otherwise specified.

The alfalfa, arabidopsis thaliana and the Benshi tobacco seeds adopted by the invention are provided by a breeding key laboratory of Heilongjiang pasture germplasm resources of northeast agricultural university. Arabidopsis thaliana jaz1 mutant seeds were purchased from Bayer Send technologies Inc. of Fuzhou.

Example 1 plant cultivation

Selecting bright and full alfalfa seeds, sterilizing with 5% NaClO solution for 5min, sterilizing with 70% alcohol solution for 30s, and washing with distilled water for 5 times. The cleaned seeds were placed in a petri dish with tiled moist filter paper and incubated in an incubator at 25℃and 70% humidity. After 5d, the germinated seedlings were transferred to a plug tray filled with vermiculite and placed in an artificial greenhouse, and the diurnal temperature and relative humidity were set at 25 ℃/55% and 20 ℃/70%, respectively. Seedlings were sprayed 1 time with nutrient solution every 2 d.

Example 2 primer design

qPCR primers were designed using Integrated DNATechnologies and primers were detected using Oligoo 6.0. 3' and 5' race amplification specific primers were designed using the cloud platform of nupraise company, wherein 5' race included two primers, 5' gsp and 5' ngsp; the specific primer for 3'race was 3' gsp. The remaining primers were designed by PrimerExpress5.0 software. Specific primer sequence details are shown in Table 1.

TABLE 1 primer sequences

Note that: the lower case letters in the primer sequences are homology arm sequences, and the underlined positions are enzyme cutting site sequences.

Example 3: alfalfa MfJAZ1 gene clone

1. Total RNA extraction and reverse transcription

Healthy alfalfa plants under normal growth conditions are selected, alfalfa leaves are ground, cracked and purified according to the specification of an ultra-pure RNA kit (CWBIO, china) to extract total RNA, the RNA integrity is verified by measuring the concentration and electrophoresis tests, and the RNA is stored in a refrigerator at-80 ℃ after verification. RNA usage was calculated and reverse transcribed into cDNA according to the instructions of HiScript ll Reverse Transcriptase reverse transcription kit (Vazyme, china).

2. Cloning of CDS region of MfJAZ1 Gene

PCR amplification was performed using alfalfa cDNA as template and 2 XTaq Master Mix, and the Taq enzyme PCR reaction system is shown in Table 2, and the reaction procedure is as follows. Agarose gel electrophoresis was performed to verify that 2X was used after the fragment length was observed to be similar to the length of the alfalfa MtJAZ1 fragment in NCBI under UV lightThe Max Master Mix again performed PCR. The high-fidelity PCR reaction system is shown in Table 3, and the reaction procedure is as follows. Mixing PCR product with loading buffer solution, performing 1% agarose gel electrophoresis, performing gel cutting recovery with kit, measuring the concentration of recovered product, labeling, and storing at-20deg.C。

TABLE 2Taq enzyme PCR reaction system

The Taq enzyme PCR reaction procedure was as follows:

TABLE 3 high fidelity PCR reaction system

The high-fidelity PCR reaction procedure was as follows:

analysis of results:

the result obtained by electrophoresis detection of total RNA of the alfalfa seedling is shown in FIG. 1-A, and 28S and 18S bands are clear. The RNA was reverse transcribed using the reverse transcription kit, and cDNA quality was assessed using the MfActin gene as an internal reference, and the results obtained are shown in FIG. 1-B. The gene specific primer (F/R) is designed by taking the MtJAZ1 gene sequence of the medicago sativa of leguminous mode as a template, the inverted medicago sativa DNA is amplified by PCR to obtain the CDS sequence of JAZ1 in the medicago sativa, which is named as MfJAZ1, and agarose gel electrophoresis is carried out to verify the DNA quality, and the obtained result is shown in figure 1-C.

3. Cloning of 3'cDNA and 5' cDNA

According to the obtained intermediate fragment, specific primers are designed at the upstream and downstream, and the 3 'end amplification and the 5' end amplification of the sequence are carried out by using the reference specification of the HiScript-TS 5'/3' RACE Kit. Firstly, RNA is extracted, then 3 'end amplification and 5' end amplification are respectively carried out, the obtained results are shown in figure 2, the cut gel is recovered, the T carrier is transferred, DH5 alpha escherichia coli competence is transformed, and the sequence length obtained by sequencing is respectively 291bp and 133bp. Three-segment sequence splicing is carried out by DNAMAN5.0, and the cDNA sequence with the full length of 1176bp is obtained as follows:

protparam analysis showed that the MfJAZ1 encoded protein contains 20 basic amino acids, the Ser (12.4%) is highest, the Trp (0.4%) is lowest, 22 positively charged amino acid residues (Arg, lys), and 18 negatively charged amino acid residues (Asp, glu). MfJAZ1 has a molecular formula of C ₁₁₈₁ H ₁₈₈₅ N ₃₂₅ O ₃₈₂ S ₁₂ Molecular weight of 27.13kDa and theoretical isoelectric point of 8.83; the extinction coefficient is 14440-14690; the instability coefficient is 44.96, an unstable protein; the fat coefficient was 68.32, the average hydrophilic coefficient was-0.444, and it was a hydrophilic protein.

The SOPMA is used for predicting the secondary structure of the MfJAZ1 gene protein, and the protein contains 37 alpha-helices with the ratio of 14.8%,7 beta-turns with the ratio of 2.8%,24 extension chains with the ratio of 9.6% and 182 random coils with the ratio of 72.8%. The three-dimensional structure of SWISS-MODEL predicted protein is shown in FIG. 3.

Example 4: mfJAZ1 promoter cloning

Total DNA was extracted using Takara Universal Genomic DNA Extraction Kit kit, the specific study was performed according to the method of the specification, and then 3 specific primers were designed based on the 5' -end upstream sequence of the cDNA of MfJAZ1 which had been obtained, the designed primers were reverse complementary primers, SP1, SP2 and SP3, respectively, and the details are shown in Table 1, for nested PCR, and the specific positions of the primers are shown in FIG. 4.

The genomic DNA was extracted from alfalfa and sequenced according to the relevant requirements of the DNA extraction kit, and the results were shown in FIG. 5-A. According to the obtained cDNA fragment, three specific primers SP1, SP2 and SP3 are designed at the upstream, alfalfa genome DNA is used as a template, and chromosome walking kit is used for three times of walking reaction, and the obtained result is shown in figure 5-B. And (3) carrying out glue recovery on the products of the two times, transferring to T-carrier and DH5 alpha conversion competent sequencing, comparing and splicing to obtain the sequence with the length of 933bp.

The promoter sequence was analyzed using plantacare and the analysis results were as follows:

the MfJAZ1 promoter sequence comprises three light response elements of GATA-motif, TCT-motif and G-box, a salicylic acid response element (TCA), 2 MYB Binding Sites (MBS), 4 MYB related elements (a MYB-like and 3 MYBs), a MYBHv1 binding site, an anaerobic induction regulating element (ARE), 2 AT-TATA-boxes, 13 TATA-boxes and 8 CAAT-boxes, wherein the specific MfJAZ1 gene promoter sequence is shown in a sequence table 2:

sequence table 2:

GTCGAGAGAGAAGAAGGAGGAAATGCACCAAAAGGACGTTGCTGCTCCAGGTCACACACAACCGATGTGGTGGGGTGCGCAACCTGTGCAACTGTTTCAGACACGCCTCGCCAGAGCTTTAAGTTTCTATGTTTCCACAAGCTCCACAAAAGGGCAACAAAACGTTGGCTCTCATCGTGTGAAAGATCCTGCACCAAAGCAAATATAGAATCGACAGCACAAACGAAAGGAGTACATGCACGTTGCACTTTCTCCTAAAGCCCAACCCTAAGCCTCACCTGCAAAGCAAAAAAGCAATCAAAGAAAACATGATGAAGATTTTCGAGAGGTCCGTCGCATATAATCTTACTATATATAAGTACCTCCTCCCACATTTATAAACAAATACCTACATTTTAGATATATTAAACATTTAATGAAGATCAAATTCACCAAATATTCAACGGATCTAAAAAGTAGTTATTTATTTATAAATGTGATAGCTAGGAGAGAATAAATAATATCGTATTACATAAAAAATAATGTTTTTTTTTAAGTTGAGTTTGGACAAAACCCAAGAAACATAGGAGACAACTGCAAAGAAAAAAAATAATAAAATAAAAAAAGAAAAAGAGAAGAAGCATCCCTTAGACCAACTTTAAATAAAATCACACACATATTCCTCGTGCTTCAATTTCCCATCCCCAAAAAAGATAAAGACATTAATTTATTCCTCCAATTAAACTTTATACTAATATTAATTATTTCATTTCATTTTCTTATATATATAAGCTAACATAAGATTAACCATCCAAAACAACAACACAAAGAATCATTTCACACTTTCATTCTTATTACAACGCGTTTTGTTTTCTCTCTCTCGAGTCTTGAATATCATCATCTTCAACTATGTCTACCTCATCGGAATATTCAGAAGTTTCCGGCAACAAACCA

example 5: expression pattern analysis

MfJAZ1 expression pattern analysis was performed using alfalfa seedlings grown uniformly for 5 weeks. Firstly, selecting partial seedlings, and tissue sampling of roots, stems and leaves to determine the specific expression condition of MfJAZ1 in each tissue of alfalfa. Then, the seedlings were divided into 5 groups and subjected to low temperature, drought, salt, alkali and ABA stress treatments for 0, 1, 3, 6, 12, 24 hours, respectively. Wherein the low temperature stress treatment temperature is 4deg.C, and the drought, salt and alkali stress treatments respectively use 20% PEG6000, 150mM NaCl and 150mM NaHCO ₃ The aqueous solution is subjected to stress, and the ABA stress treatment is subjected to stress by exogenously spraying 100 mu M ABA. The treated alfalfa seedling tissue was sampled and then subjected to an ultralow temperature refrigerator at-80℃for subsequent real-time fluorescent quantitative PCR (qRT-PCR) analysis.

qRT-PCR method: total RNA was extracted, cDNA was inverted using reverse transcription kit, PCR amplified and electrophoretically verified, and the inverted cDNA was diluted. And taking the MfActin as an internal reference gene, and carrying out quantitative detection on the gene of the sample.

Analysis of results:

as shown in FIG. 6-A, mfJAZ1 expression in alfalfa leaves was highest, while that in stems was lowest. Compared with the root, the expression quantity of the MfJAZ1 in the alfalfa leaves and stems has significant difference (P is less than 0.05) which is 9.17 times and 0.3 times of the expression quantity of the MfJAZ1 at the underground part respectively.

Because the expression quantity of the MfJAZ1 on the leaf of the alfalfa is high, the leaf of the alfalfa is selected to study the response condition of the MfJAZ1 to the adversity stress. Under low-temperature stress, the MfJAZ1 expression quantity shows a trend of rising before decreasing along with the prolongation of stress time, after 4 hours of stress, the MfJAZ1 expression quantity is obviously up-regulated, and the expression quantity reaches the maximum value and is 5.4 times of 0 hour; after 8h of stress, the expression level of MfJAZ1 was significantly reduced (P < 0.05) to 37% of that of 4h compared with 4h of stress (FIG. 6-B). The amount of MfJAZ1 expressed decreased slightly and then increased under drought stress, and increased significantly after 24h of stress (P < 0.05), reaching the highest value, 7.66 times the amount expressed at 0h (fig. 6-C). The gene expression level is obviously reduced (P < 0.05) to the minimum after 6h of salt stress, which is 0.024 times of 0 h; after 24h, the increase was significant (P < 0.05), 10.04 times that of 6h (FIG. 6-D). Under alkali stress, the expression level of the MfJAZ1 gene was continuously decreased to a minimum value of 0.18 times that of WT at 48 hours (FIG. 6-E). Under ABA treatment, the gene expression level was significantly reduced (P < 0.05) at 1h MfJAZ1, 38.5% of WT, followed by no significant differential change over 1h (fig. 6-F). That is, under low temperature stress, the expression of MfJAZ1 in alfalfa leaves tended to increase and then decrease.

Example 6: construction of overexpression and transient expression vectors

The cDNA sequence of MfJAZ1 is used for respectively designing an over-expression Primer and a transient expression Primer by using Primer5 software, wherein the F end Primer of the over-expression Primer and the F end Primer of the transient expression Primer are consistent, the R end of the over-expression Primer contains a stop codon, and the R end of the transient expression Primer does not contain the stop codon. Then, plasmids of DH5 alpha bacterial liquid are extracted and purified according to the specification of a plasmid extraction kit, and PCR amplification is carried out by using Transient (TE) and over-expression (OE) one-step cloning primers containing a protecting base and an enzyme cutting site base by taking the plasmids as templates, and a reaction system is shown in Table 4. After the reaction, 1% agarose gel electrophoresis was performed, the band was observed without errors, and then the insert was recovered, and the concentration was measured and stored at-20 ℃.

TABLE 4 one-step cloning PCR reaction System

Coli containing pCBMBIA1300-35S-sGFP empty vector was placed on a shaker at 37℃and 180rpm, and after turbidity, plasmid was extracted, concentration was determined and labeled. A cleavage reaction system was prepared according to Table 5, cleaved for 6 hours at 37℃and terminated by adding 7. Mu.L of loading Buffer. The digested vector fragment was subjected to 0.8% agarose gel electrophoresis, and the longer fragment was recovered and the concentration was measured after purification. The linearized vector was recombined with the insert according to the one-step cloning kit instructions, the reaction system is shown in table 6, the reaction procedure: cooling at 37 ℃ for 30min on ice for 5min, and taking 5 mu L of product to transform DH5 alpha competence. And (3) obtaining bacterial liquid, performing PCR and electrophoresis verification, extracting plasmids after sequencing and comparison, converting the plasmids into EHA105 competence, coating the bacterial liquid on a YEB plate containing 50 mu g/mL Kan and 20 mu g/mL rifampicin (Rif), culturing for 48-72h in an inverted mode, picking up monoclonal bacterial colonies, transferring the monoclonal bacterial colonies into a YEB liquid culture medium containing the same concentration Kan and Rif, shaking for 60h, mixing positive bacterial liquid with glycerol after PCR detection, and storing the mixture at the temperature of-80 ℃ for later use.

Table 5 enzyme digestion System

TABLE 6 recombination reaction System

Example 7: mfJAZ1 subcellular localization

Selecting plump Nicotiana benthamiana seeds, and culturing the seeds in a pot filled with vermiculite and nutrient soil in a ratio of 1:1. And carrying out transient expression test when 5-6 leaves grow out from the tobacco.

Firstly, carrying out double enzyme digestion on the pCAMBIA1300 vector by BamH1 and SacI restriction enzymes, recovering vector fragments, and recovering and purifying after electrophoresis detection. The MfJAZ1 insert was then recombined with the linearized vector using the transiently expressed one-step cloning primer MfJAZ 1-TE-F/R. Transferring into T carrier, transforming DH5 alpha competence, obtaining bacterial liquid, carrying out MfJAZ1 gene fragment PCR identification, and verifying successful recombination through agarose gel electrophoresis detection as shown in figure 7.

Converting the constructed tobacco transient expression vector 35S-MfJAZ1-GFP into EHA105 competence, transferring the bacterial liquid into a culture medium for culture to logarithmic phase after verification, centrifugally collecting bacterial precipitate, taking 0.5mol/LMES, 1mol/L MgCl2 and 100mmol/L acetosyringone as working liquids, and adjusting OD600 to be 0.2 and 0.4 respectively. The tobacco cells are infected by injecting the tobacco cells into the back of leaf surfaces of Nicotiana benthamiana by an infiltration method, are subjected to dark culture for 48 hours, and are observed under a laser confocal microscope.

Analysis of results: as shown in FIG. 8, the MfJAZ1 gene is located in the nucleus, which indicates that the gene may be involved in important physiological processes such as regulating the growth and development of plants, genetic metabolism and the like.

Example 8: verification of transgenic Arabidopsis thaliana

According to the information of the mutant (SALK_ 011957C) published by TAIR, three specific primers JAZ1-F1, JAZ1-R1 and JAZ1-T1 (specifically shown in table 1) are designed for PCR reaction;

obtaining an infected arabidopsis plant by adopting a transformation method of infecting an arabidopsis inflorescence by agrobacterium;

screening vaccine after the arabidopsis plants are harvested, extracting the genomic DNA of the arabidopsis after the seedlings grow for about 20 days, and carrying out PCR detection;

t-treatment of positive seedlings ₁ Planting in the generation, then T ₂ Planting in the generation of plants, collecting T ₂ The seed is replaced for later use.

WT, over-expressed, mutant, complementation line arabidopsis seedlings were cultivated according to the procedure of example 1. Plants grown consistently after 3 weeks of culture were divided into two groups and subjected to low temperature stress treatment. One group was subjected to stress treatment at 4℃for 1, 3, 6, 12, 24 hours, the other group was subjected to stress treatment at-5℃for 0 (treatment time when the incubator temperature was lowered to-5 ℃), 0.5, 1 hour, and Arabidopsis seedlings grown in room temperature environment were used as controls (controls). The leaves of Arabidopsis under each treatment are respectively collected and stored in a refrigerator at the temperature of minus 80 ℃ for subsequent physiological index measurement. The physiological index measurement method is shown in Table 7, and the obtained results are shown in Table 8 and FIGS. 9-13.

TABLE 7 summary of physiological index measurement methods

TABLE 8 comparison of leaf area, perimeter, leaf Length and leaf width of transgenic lines Arabidopsis thaliana

The results of analysis of FIGS. 9-13 show that:

the overexpression vector pCAMBIA1300-MfJAZ1 is successfully constructed, and the WT Arabidopsis thaliana and the jaz1 mutant are genetically transformed by agrobacterium to obtain the MfJAZ1 overexpression and MfJAZ1 complementary strain. Morphological observations indicate that: the leaf area of the MfJAZ1 over-expressed strain is significantly smaller than that of the WT, JAZ1 mutant and MfJAZ1 complementary strain, and the JAZ1 deletion makes the Arabidopsis leaf narrow. The analysis of the physiological index shows that: under the stress of 4 ℃, the overexpression of MfJAZ1 remarkably improves the relative conductivity of arabidopsis thaliana, and reduces CAT activity and MDA content. The over-expression of MfJAZ1 can obviously increase the relative conductivity, MDA, soluble sugar and proline content of Arabidopsis under the stress of minus 5 ℃ and obviously reduce GSH, CAT and POD contents. However, the response index in the jaz1 mutant exhibited the opposite result.

Example 9: quantitative expression of corresponding genes of transgenic arabidopsis thaliana under low temperature stress

According to the measurement results of the example 8, selecting 4 ℃ stress 24h and-5 ℃ stress 1h which are obvious in response physiological mechanisms in the MfJAZ1 transgenic arabidopsis thaliana, and researching quantitative expression of 8 stress response genes after 4 ℃ stress 24h and-5 ℃ stress 1h on WT, mfJAZ1 overexpression, jaz1 mutant and MfJAZ1 complementary strain arabidopsis thaliana respectively. The qPCR assay was used to detect the expression of MfJAZ1 and 8 stress response genes in transgenic Arabidopsis under low temperature stress, the specific functions of which are shown in Table 9. And taking AtActin as an internal reference gene, and quantitatively detecting a stress response gene of the sample. The results obtained are shown in FIGS. 14-18.

TABLE 9 stress response Gene summary

The results of analysis of FIGS. 14-18 show that:

by analyzing the expression patterns of 8 stress response genes such as KIN, ERD10C, COR A, GSTF6, GSTF7, LEA5, CAT and POD under low temperature stress, the over expression of MfJAZ1 can significantly down-regulate the expression of KIN, ERD10C, COR15A, GSTF6, GSTF7, LEA5 and CAT under low temperature stress, while the expression amount of KIN, ERD10C, COR15A, GSTF6, GSTF7, LEA5 and CAT in the jaz1 mutant can significantly up-regulate. It is shown that MfJAZ1 can reduce the tolerance of plants to low temperature by negatively regulating the expression of stress response genes, and knocking out JAZ1 genes can improve the cold resistance of plants.

The above embodiments are only for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made thereto without departing from the spirit and scope of the technical solution of the present invention, which is intended to be covered by the scope of the claims of the present invention. The technology, shape, and construction parts of the present invention, which are not described in detail, are known in the art.

Claims

1. The alfalfa low temperature resistant gene MfJAZ1 is characterized in that the nucleotide sequence of the low temperature resistant gene MfJAZ1 is shown as a sequence 1.

2. The alfalfa low temperature resistant gene MfJAZ1 as claimed in claim 2, wherein the MfJAZ1 has a total length of 1176bp and a molecular formula of C ₁₁₈₁ H ₁₈₈₅ N ₃₂₅ O ₃₈₂ S ₁₂ The molecular weight was 27.13kDa.

3. The application of the alfalfa low temperature resistant gene MfJAZ1 is characterized in that the alfalfa low temperature resistant gene MfJAZ1 is applied to improving the environmental cold resistance or low temperature resistance of plants.

4. The use of a low temperature resistant gene MfJAZ1 of alfalfa as claimed in claim 3, wherein the use of the low temperature resistant gene MfJAZ1 of alfalfa is for improving the cold resistance or low temperature resistance of alfalfa.

5. The use of a low temperature resistant gene MfJAZ1 of alfalfa as claimed in claim 3, wherein the use of the low temperature resistant gene MfJAZ1 of alfalfa is for improving the environmental cold resistance or low temperature resistance of arabidopsis.

6. The use of a low temperature resistant gene MfJAZ1 of alfalfa as claimed in claim 3, wherein the use of the low temperature resistant gene MfJAZ1 of alfalfa in improving the environmental cold resistance or low temperature resistance of tobacco.