CN116463309A

CN116463309A - Caffeic acid-O-methyltransferase mutant, recombinant vector, recombinant bacterium, preparation method and application thereof

Info

Publication number: CN116463309A
Application number: CN202210030725.XA
Authority: CN
Inventors: 甄珍; 雷严严; 梁朝宁; 唐双焱
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2022-01-12
Filing date: 2022-01-12
Publication date: 2023-07-21

Abstract

The application provides a caffeic acid-O-methyltransferase mutant, which is obtained by carrying out one or more of the following mutations on the amino acid sequence of wild caffeic acid-O-methyltransferase from the N-terminal: valine at position 314 to arginine; alanine at position 160 to serine; histidine 164 is mutated to asparagine; phenylalanine at position 22 is mutated to tyrosine. One of the caffeic acid-O-methyltransferase mutants has mutation at the 4 sites, the amino acid sequence of the caffeic acid-O-methyltransferase mutant is shown as SEQ ID NO.2, and the nucleic acid sequence of the caffeic acid-O-methyltransferase mutant is shown as SEQ ID NO.3 or SEQ ID NO. 4. The application also provides a recombinant vector containing the mutant gene, recombinant bacteria, a preparation method of the mutant and application of the mutant in production of ferulic acid. The caffeic acid-O-methyltransferase mutant provided by the application can be used for producing ferulic acid, and the best enzyme activity of the mutant is 4.76 times that of wild caffeic acid-O-methyltransferase, so that the production efficiency of ferulic acid can be greatly improved, and the production cost is reduced.

Description

Caffeic acid-O-methyltransferase mutant, recombinant vector, recombinant bacterium, preparation method and application thereof

Technical Field

The application relates to a caffeic acid-O-methyltransferase mutant, a recombinant vector and recombinant bacterium containing coding genes thereof, a preparation method and application thereof.

Background

Ferulic Acid (Ferulic Acid), chemical name is 4-hydroxy-3-methoxy cinnamic Acid, relative molecular weight is 194.18, the Ferulic Acid is easily dissolved in methanol and ethanol, is easily decomposed by visible light, has better oxidation resistance, is widely used in plants such as ligusticum chuanxiong, asafetida, angelica and other traditional Chinese medicines, has higher content in food raw materials such as vanilla beans, wheat bran and coffee, and has wide application in the fields of foods, cosmetics, medicines and the like. Ferulic acid is also used as a precursor for biosynthesis of a variety of high-value compounds and as a substrate for biosynthesis of these compounds in microorganisms. A number of strains capable of producing vanillin using ferulic acid as a substrate, such as Pseudomonas putida (Pseudomonas putida), streptomyces (Streptomyces), aspergillus niger (Aspergillus nige r), etc., have been found, and it has been studied to construct a synthetic pathway for producing vanillin from ferulic acid in E.coli, and to successfully produce vanillin. In addition, metabolic pathways for synthesizing curcumin and tetrahydrocurcumin by using ferulic acid as a precursor in escherichia coli have been constructed, and the ferulic acid is successfully converted into curcumin and tetrahydrocurcumin in escherichia coli. In addition, the ferulic acid can be used as a synthesis precursor for producing lignin, sinapic acid, scopolamine, syringin and other compounds, and has high application value and research value.

In the traditional process, the ferulic acid is mainly extracted from plants or synthesized by chemical methods, and the methods have high cost and can generate certain environmental and energy problems. Compared with the traditional process, the method for producing the ferulic acid by using the enzyme method can fundamentally solve the problems of environment, energy and the like, and has the advantages which are incomparable with the traditional process in the aspects of quality and environmental protection.

Caffeic acid-O-methyltransferase (COMT for short) is one of the class of O-methyltransferases, and its natural substrate is Caffeic acid, SAM or betaine is used as methyl donor, and the hydroxy group on Caffeic acid is replaced by methoxy group, so generating ferulic acid. Based on this, caffeic acid-O-methyltransferase can be industrially used to produce ferulic acid. In order to increase the efficiency of the enzymatic production of ferulic acid, it is necessary to obtain a caffeic acid-O-methyltransferase having high catalytic activity.

Disclosure of Invention

In view of the above, the present application aims to provide a caffeic acid-O-methyltransferase mutant, a recombinant vector and recombinant strain containing the encoding genes thereof, a preparation method thereof and applications thereof.

The application provides a caffeic acid-O-methyltransferase mutant, which is obtained by carrying out one or more of the following mutations on an amino acid sequence shown in SEQ ID NO.1 from the N end:

valine at position 314 to arginine;

alanine at position 160 to serine;

histidine 164 is mutated to asparagine;

phenylalanine at position 22 is mutated to tyrosine.

The enzyme shown in SEQ ID NO.1 is derived from Arabidopsis thaliana, is caffeic acid-O-methyltransferase which exists naturally, and compared with the mutant, the mutant has higher capability of catalyzing and synthesizing ferulic acid.

Still further, the present application provides a caffeic acid-O-methyltransferase mutant having an amino acid sequence as shown in SEQ ID NO. 2.

The application also provides a gene for encoding the caffeic acid-O-methyltransferase mutant, and the nucleic acid sequence of the gene is shown as SEQ ID NO.3 or SEQ ID NO. 4. Wherein, SEQ ID NO.4 is based on SEQ ID NO.3, on the premise of not changing the amino acid sequence, the former 100bp is subjected to codon optimization, and the optimized sequence enables the mutant protein to be more suitable for expression in bacteria, and can improve the soluble expression quantity of the mutant protein in bacteria.

The present application also provides a recombinant vector comprising one or more of the following genes: a gene encoding any of the caffeic acid-O-methyltransferase mutants; a gene shown in SEQ ID NO. 3; the gene shown in SEQ ID NO. 4.

Further, the recombinant vector is formed by inserting a gene shown in SEQ ID NO.3 or SEQ ID NO.4 into a pET28a plasmid.

The present application also provides recombinant bacteria capable of synthesizing the mutants of caffeic acid-O-methyltransferase.

Alternatively, the recombinant bacterium is obtained by transferring the recombinant vector into bacteria or fungi.

Optionally, the recombinant bacterium is a recombinant escherichia coli obtained by transferring the recombinant vector into escherichia coli BL21 (DE 3).

The application also provides a preparation method of the caffeic acid-O-methyltransferase mutant, which comprises the following steps:

1) Constructing recombinant bacteria by using the recombinant vector;

2) Fermenting and culturing the recombinant bacteria, and inducing and expressing the mutant;

3) Purifying the mutant.

Further, the preparation method of the caffeic acid-O-methyltransferase mutant comprises the following steps:

1) Transferring pET28a recombinant plasmid containing the gene shown in SEQ ID NO.3 or SEQ ID NO.4 into escherichia coli BL21 (DE 3) to obtain recombinant escherichia coli;

2) Culturing the recombinant escherichia coli by fermentation, and inducing expression of the mutant;

3) Purifying the mutant: after centrifugally collecting thalli, breaking the walls by using ultrasonic waves, and collecting supernatant; the resulting supernatant was filtered and purified by a nickel column.

The application also provides application of the caffeic acid-O-methyltransferase mutant in production of ferulic acid.

According to some embodiments of the present application, the application comprises the steps of:

1) Fermenting and culturing recombinant bacteria containing recombinant vectors capable of encoding the mutants;

2) Adding caffeic acid and methionine into a fermentation culture system, and culturing for a period of time;

3) And collecting ferulic acid in the fermentation liquor.

Compared with the naturally occurring wild type caffeic acid-O-methyltransferase, the caffeic acid-O-methyltransferase mutant provided by the application has the highest activity, and the capability of producing ferulic acid is improved from the specific activity of the wild type enzyme of 222+/-1.4U/mg to 1098+/-23.2U/mg, which is 3.5 times that of the wild type enzyme. In one embodiment of the present application, the production yield of ferulic acid using the above mutant was 4.2mM, and the production yield of ferulic acid using the wild type was only 2mM. The caffeic acid-O-methyltransferase mutant is used for producing ferulic acid, so that the yield of the ferulic acid can be greatly improved, and the production cost is saved.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings that are needed in the description of the embodiments will be briefly described below, and it is apparent that the drawings in the following description are only some embodiments of the present application, and that other drawings can be obtained by those skilled in the art from these drawings without departing from the scope of protection of the present application.

FIG. 1 is a diagram of a structural model of an Arabidopsis-derived COMT after homology modeling and docking with a substrate caffeic acid molecule.

Detailed Description

The technical solutions in the embodiments of the present application will be clearly and completely described below by means of embodiments, and it is obvious that the described embodiments are some, but not all, embodiments of the present application. All other embodiments, which can be made by those skilled in the art based on the embodiments herein without making any inventive effort, are intended to be within the scope of the present application.

The experimental methods used in the following examples are conventional methods unless otherwise specified.

Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The "wild type" in the following examples means a gene, a protein, an organism, etc., which are present in nature without modification.

Example 1 obtaining of caffeic acid-O-methyltransferase mutants

(one) obtaining of the Gene encoding wild type caffeic acid-O-methyltransferase

The gene encoding caffeic acid-O-methyltransferase (COMT) was derived from Arabidopsis thaliana, and was synthesized by the company (general biological Co.) optimized in the present laboratory. PCR amplification was performed using the same as the template and 5'-atgggtagtacc gccgaaacccagc-3' (forward) and 5'-ttacagttttttcagcagttcaatc-3' (reverse) primers.

The PCR amplification conditions were as follows: pre-denaturation at 98 ℃ for 30s, then 10s at 98 ℃,30 s at 55 ℃ and 40s at 72 ℃ for 30 cycles; finally, the extension is carried out for 10min at 72 ℃. And (3) recovering PCR reaction products, and performing agarose gel electrophoresis detection to obtain 1092bp bands, namely the coding genes of the wild caffeic acid-O-methyltransferase, which can code the protein shown as SEQ ID NO. 2.

(II) obtaining recombinant bacteria containing caffeic acid-O-methyltransferase wild-type encoding genes

PCR amplification was performed using pRB1k vector as template and 5'-aactgctgaaaaaactgtaactcgagggtagatctggtac-3' (forward) and 5'-gtttcggcggtactacccatacccatggttaattcctcct-3' (reverse) primers.

The PCR amplification conditions were as follows: pre-denaturation at 98 ℃ for 30s, then 10s at 98 ℃,30 s at 65 ℃ and 40s at 72 ℃ for 30 cycles; finally, the extension is carried out at 72 ℃ for 2min. The PCR reaction product was recovered and detected by agarose gel electrophoresis to obtain a 3472bp band, which was a linear pRB1k vector sequence.

Complementary sequences are added to the two ends of the caffeic acid-O-methyltransferase wild-type coding gene and pRB1k vector through PCR, and the two PCR products are assembled by mixing 1092bp fragments and 3472bp fragments according to a molar ratio of 1:3 by using a Gibson kit (purchased from the holy biologicals Co.). The ligation product converts competent cells of the escherichia coli MC1061 to obtain recombinant bacteria containing the caffeic acid-O-methyltransferase wild-type encoding gene. Plasmid sequencing verification and sequencing analysis of recombinant bacteria were performed, and since the plasmid was obtained by inserting the comt gene into pRB1k vector, the plasmid was designated pRB1k-comt.

Construction and screening of caffeic acid-O-methyltransferase mutant library

The application adopts two different modes to construct an enzyme mutant library, wherein the first mode is a combination method of semi-rational design and directed evolution, and a site-specific saturation mutation library of the enzyme is constructed; the second is to construct a random mutation library. Screening of the library was performed for a total of 3 rounds: two rounds of site-directed saturation mutation library screening and one round of random mutation library screening.

Since the COMT from Arabidopsis is not reported to have a crystal structure at present, the SWI SS-MODEL is used for calculating the COMT protein from Arabidopsis, the COMT protein sequence is uploaded to the SWISS-MODEL, the comparison is carried out with homologous proteins with crystal structures in a database, the protein structure with higher homology (the COMT protein structure PDB from alfalfa: 1 kyz) is selected as a template, the homologous modeling is carried out, the docking is carried out with substrate caffeic acid molecules, the docking software is Auto Dock, the structural MODEL of the COMT and caffeic acid molecule complex is obtained, as shown in figure 1, the distance caffeic acid molecules are selectedSite-directed saturation mutant libraries are constructed at amino acid positions within.

First round screening:

i317 and V314 sites near the hydrophobic tail of the caffeic acid molecule are selected to construct a site-directed saturated mutant library, and the library construction method is as follows:

pRB1k-comt plasmid was used as a template, 5 '-ctacacaaagagttgttcanngattgcnnnatgctggccccataat-3' (forward) and 5'-ttacagttttttcagcagttcaatc-3' (reverse) as primers, and Hieff high-fidelity polymerase was used for amplification under the following PCR amplification conditions: pre-denaturation at 98 ℃ for 1min, then 10s at 98 ℃,30 s at 58 ℃ and 1min at 72 ℃ for 30 cycles; finally, the extension is carried out for 5min at 72 ℃. And (3) carrying out agarose gel electrophoresis on the amplified PCR product, and carrying out gel recovery to obtain the PCR product, namely the mixed DNA fragment of I317 and V314 saturated mutation.

Taking the recovered PCR product as a large primer, taking pRB1k-comt plasmid as a template, and carrying out MEGAWHOP PCR by using Pyrobest DNA polymerase, wherein the reaction procedure is that the reaction is carried out for 35 cycles of pre-denaturation at 95 ℃ for 8min, then for 45s at 95 ℃, for 45s at 58 ℃ and for 5min at 72 ℃; finally, the extension is carried out at 72 ℃ for 8min.

The MEGAWHOP PCR product was digested with DpnI overnight at 37℃to eliminate the template plasmid, the next day the digested product was transformed into E.coli MC1061 competent cells, resuscitated at 37℃and plated on Kan-containing cells ^R On the resistant plate, the monoclonal extracted plasmid on the plate is scraped the next day to obtain plasmid library of I317 and V314 saturated mutants.

The plasmid library was transformed into E.coli 4. DELTA. BW25113Z competent cells to obtain site-directed saturation mutant library 1 for subsequent screening work. The host bacterium E.coli 4 delta BW25113Z is developed in the laboratory and can be used for screening COMT mutants with high ferulic acid yield. When the ferulic acid yield is high, the plate colony presents blue, when the ferulic acid yield is low, the plate colony presents white, and the colony with the bluest color is selected for verifying the ferulic acid yield, and the specific method is as follows:

pRB1k-comt plasmid was transformed into E.coli 4. DELTA. BW25113Z competent cells, and resuscitated in a shaker at 37℃ ^R The resistant plates are streaked, and the strain obtained by culturing the plates in an incubator at 37 ℃ for 12 hours is a wild strain. Transforming the obtained plasmid mutation library into E.coli 4 delta BW25113Z competent cells, resuscitating at 37 ℃ with a shaking table at 220rpm, coating resuscitating solution on the screening plate (YM 9 solid medium, adding 2mM MgSO4, 0.1mM CaCl2, 25 mug/mL KanR, 1mM L-ara, 5mM Met, 5mM CA and 3 mug/mL X-Gal to the medium, uniformly mixing, pouring the mixture into a plate, namely the screening plate.) and culturing in a 37 ℃ incubatorAfter culturing for 12 hours, the color of the colonies on the plate was observed. And (3) selecting a blue monoclonal spot on a plate to a new screening plate, simultaneously selecting a wild strain spot on the same screening plate as a control, culturing in a 37 ℃ incubator for 12 hours, and observing the color of a colony on the plate. Then, screening the colonies on the plate, which are blue and darker than those of the wild strain, to Kan-containing colonies ^R The seed solution was obtained by culturing in a resistant LB medium at 37℃and 220rpm for 12 hours.

Seed solutions of the cultured wild-type strain and the mutant strain selected from pRB1k-comt plasmid were inoculated into a screening medium having a medium volume of 3mL and a shaking culture at 37℃for 12 hours at an inoculum size of 1%. Detecting OD of fermented bacterial liquid ₆₀₀ Taking 1mL of fermentation liquor, centrifuging 10000 Xg for 2 minutes, taking 180 mu L of supernatant to a 96-well detection plate, adding 50 mu L of 50mM sodium periodate, uniformly mixing, and rapidly detecting OD after uniformly mixing ₄₅₀ Select OD ₄₅₀ The low reading broth was subjected to HPLC detection. And (3) carrying out plasmid extraction sequencing on seed liquid corresponding to the strain with high ferulic acid yield after HPLC detection.

Through screening of 4000 mutants in the library, mutant A11 with increased ferulic acid yield was obtained. Sequencing shows that the amino acid sequence of the mutant A11 is shown as SEQ ID NO.5, and the mutation site is V314R.

Second round screening:

based on the first round of screening results, site-directed saturated mutant libraries were reconstructed. Constructing site-directed saturation mutant library by taking mutant A11 as a starting protein.

Selecting sites A160 and H164 near the benzene ring of the caffeic acid molecule to construct a site-directed saturated mutant library, wherein the library construction method comprises the following steps:

the pRB1k-A11 plasmid is used as a template, comt-160-164-fwd (tgtcaagctttgaatataacg gtaccgatccgcgttttaa) and comt-160-164-rev (ttacagttttttcagcagttcaatcagattaacgcc aaac) are used as primers, hieff high-fidelity polymerase is used for PCR amplification, and the subsequent library establishment and screening method are the same as the first round of screening. Through screening 4000 mutants in the library, mutant 2E1 with improved ferulic acid yield is obtained. Sequencing shows that the amino acid sequence of the mutant 2E1 is shown as SE Q ID NO.6, and the mutation sites are V314R, I317I, A160S and H164N.

Third round screening:

based on the second round of screening results, the error-prone mutant library of the whole gene is built again. A random mutant library was constructed using mutant 2E1 as the starting protein.

By utilizing error-prone PCR, the ratio of dNTPs and the concentration of manganese ions and magnesium ions in a PCR amplification system are changed to improve the mismatch rate of Taq DNA polymerase, so that mutation is introduced into a gene sequence.

Error-prone PCR (Error-protein PCR) was performed using the excellent mutant pRB1k-2E1 plasmid obtained in the previous round of screening as a template and 5'-ac aggaggaattaaccatgggtatg-3' (forward) and 5'-tagtaccagatctaccctcgagtta-3' (rev-erse) as primers, and the whole plasmid was amplified with Pyrobest DNA polymerase (available from Takara Corp.) under the following ionic conditions in the PCR system: 0.2mM dNTP,1.0mM dCTP and dTTP,5.5mM MgCl2,75. Mu.M MnCl2, PCR was performed as follows: pre-denaturation at 94 ℃ for 10min, then 30s at 94 ℃,30 s at 55 ℃ and 1.5min at 72 ℃ for 30 cycles; finally, the extension is carried out for 5min at 72 ℃.

And (3) carrying out agarose gel electrophoresis on the PCR product, carrying out gel recovery, taking the recovered PCR product as a large primer, taking pRB1k-2E1 plasmid as a template, and carrying out MEGAWHOP PCR by using Pyrobest DNA polymerase. The MEGAWHOP PCR product is the plasmid library of random mutant.

The template plasmid was eliminated by cleavage with DpnI overnight at 37℃and the cleavage product was transformed into E.coli MC1061 competent cells the next day, resuscitated at 37℃and plated onto KanR-resistant plates, and the monoclonal extracted plasmid on the plates was scraped the next day to obtain a random mutant plasmid library. The plasmid library was transformed into E.coli 4. DELTA. BW25113Z competent cells to obtain a random mutation library.

The subsequent library establishment and screening method is the same as that of the first round of screening, and a mutant with highest ferulic acid yield in the application is obtained through a third round of screening, the mutant protein is named COMT-21D6, the amino acid sequence of the protein is shown as SEQ ID NO.2, and the coding gene sequence of the protein is shown as SEQ ID NO. 3.

The amino acid sequence of mutant COMT-21D6 was mutated as compared to the wild-type caffeic acid-O-methyltransferase COMT as follows: V314R, A160S, H164N and F22Y, i.e. valine at position 314 from the N' -end is mutated to arginine, alanine at position 160 is mutated to serine, histidine at position 164 is mutated to asparagine, phenylalanine at position 22 is mutated to tyrosine.

Example 2 determination of caffeic acid-O-methyltransferase Activity

Optimization of mRNA containing caffeic acid-O-methyltransferase mutant 21D6

The structure and energy of mutant 21D6 mRNA are optimized by codon optimization of the front 100bp of mRNA, and the optimized front 100bp sequence of the gene is atgggtagcaccgccgaaactcaactcactccagtacaagttaccgatgatgaagcagctctttacgcaatgcagctggcaagcgcaagcgttctgccga. The optimized coding gene is shown as SEQ ID NO.4, and the soluble expression quantity of the mutant COMT-21D6 protein can be improved on the premise of not changing the protein sequence through codon optimization. The optimized mutant was named 21D6-Opt, the plasmid containing the comt-21D6-Opt was named pET28a-comt-21D6-Opt, the plasmid was a vector obtained by inserting the sequence of SEQ ID NO.4 between the NheI and EcoRI double cleavage sites of pET28a, and the recombinant strain containing the plasmid was named BL21 (DE 3)/pET 28a-comt-21D6-Opt. The recombinant strain transformed with the wild-type plasmid pET28a-comt was designated BL21 (DE 3)/pET 28a-comt.

(II) Induction of expression of caffeic acid-O-methyltransferase mutants

The single colony of BL21 (DE 3)/pET 28a-comt or pET28a-comt-21D6-Opt obtained above was inoculated into LB liquid medium containing kanamycin (final concentration: 50. Mu.g/ml), cultured at 37℃for 12 hours, seed liquid was collected, the seed liquid was transferred into 100ml fresh LB liquid medium according to an inoculum size of 1% (volume percentage), cultured at 37℃until OD600 reached 0.6, sterile IPTG was added to the medium so that the final concentration of IPTG in the medium was 1mM, and induction fermentation was performed at 30 ℃. After 12 hours, the fermentation was completed, and 3000g of the fermentation broth was centrifuged for 10 minutes to collect the cells.

The cells were resuspended in 10ml of 50mM binding buffer (Tris-HCl, pH8.0,300mM NaCl,10mM imidazole), broken by sonication (200W, 3s for 100 times), centrifuged (10,000 g,4 ℃,10 min) to remove cell debris, and the supernatant was collected.

(III) purification of caffeic acid-O-methyltransferase mutants

Filtering the supernatant with a 0.22 μm filter membrane, and purifying with a nickel column, wherein the buffer solution used in the purification is as follows:

rinse buffer: 50mM Tris-HCl,300mM NaCl,20mM imidazole, pH 8.0;

elution buffer: 50mM Tris-HCl,300mM NaCl,250mM imidazole pH 8.0.

The effluent was collected and subjected to dialysis treatment (100 mM of dialysate, pH7.8 of K2HPO4-KH2PO4 buffer, and 8000-14000 of molecular weight cut-off of dialysis bag) to obtain purified enzyme solution (including mutants of the present application).

Verifying by enzyme activity test and SDS-PAGE, and confirming purity of purified components; purified protein concentration was tested by Bradford protein concentration assay.

The recombinant BL21 (DE 3)/pET 28a-comt is induced and expressed and purified by the same method to obtain purified enzyme solution (wild type).

(IV) Activity detection of caffeic acid-O-methyltransferase mutant

Mu.l of the purified enzyme solution (mutant or wild type) obtained above was reacted with 100mM K2HPO4-KH2PO4 buffer (pH 7.8) at 37℃for 10 minutes, and the product was detected by HPLC, and the ferulic acid content obtained was calculated by referring to a standard curve drawn with ferulic acid as a standard. Purified enzyme solution (wild type) was used as a control. One enzyme activity unit is defined as the amount of enzyme protein required to produce 1. Mu. Mol ferulic acid in 1min under standard reaction conditions.

The activity of mutant 21D6-Opt was tested as follows:

the specific activity of the purified enzyme solution (wild) is 222+/-1.4U/mg;

the specific activity of the purified enzyme solution (mutant 21D 6-Opt) is 1098+/-23.2U/mg.

The above results indicate that the specific enzyme activity of the mutant 21D6-Opt is 4.9 times that of the wild type.

EXAMPLE 3 yield verification of ferulic acid production Using caffeic acid-O-methyltransferase mutant

Since mutant COMT-21D6 had a mutation at position F22Y compared to mutant 2E1, construction of a single point mutation at position F22Y compared to wild type was performed to investigate the effectiveness of the site mutation, and the mutant sequence of the single point mutation at position F22Y was shown in SEQ ID No. 7.

(one) constructing F22Y single-point mutant:

PCR amplification was performed using 5'-ccgatgatgaagcagcactgtacgcaatgcagctggcaagcgc-3' (forward) and 5'-ttacagttttttcagcagttcaatc-3' (reverse) as primers.

The PCR amplification conditions were as follows: pre-denaturation at 98 ℃ for 30s, then 10s at 98 ℃,30 s at 55 ℃ and 40s at 72 ℃ for 30 cycles; finally, the extension is carried out for 10min at 72 ℃. And (3) recovering PCR reaction products, and performing agarose gel electrophoresis detection to obtain 1049bp strips, namely the coding gene of the mutant F22Y.

PCR amplification was performed using pRB1k-comt wild type as template and 5'-aactgctgaaaaaactgtaa-3' (forward) and 5'-gcgcttgccagctgcattgcgtacagtgctgcttcatcatcgg-3' (reverse) primers.

The PCR amplification conditions were as follows: pre-denaturation at 98 ℃ for 30s, then 10s at 98 ℃,30 s at 65 ℃ and 40s at 72 ℃ for 30 cycles; finally, the extension is carried out at 72 ℃ for 2min. And (3) recovering PCR reaction products, and performing agarose gel electrophoresis detection to obtain a 3495bp band which is a linear pRB1k carrier sequence.

Complementary sequences are added to two ends of the mutant F22Y coding gene and pRB1k vector through PCR, and the two PCR products are assembled by mixing 1049bp fragments and 3495bp fragments according to a molar ratio of 1:3 by using a Gibson kit (purchased from the holy biologicals Co.). The ligation product converts competent cells of the escherichia coli MC1061 to obtain recombinant bacteria containing mutant F22Y coding genes. Plasmid sequencing verification and sequencing analysis of recombinant bacteria were performed, and since the plasmid was obtained by inserting the F22Y gene into pRB1k vector, the plasmid was designated pRB1k-F22Y. pRB1k-F22V plasmid was transformed into E.coli BW25113 competent cells, and resuscitated in a shaker at 37℃with Kan-containing resuscitator ^R Resistant plates were streaked and incubators at 37℃were usedCulturing for 12h, wherein the obtained strain is mutant F22Y strain.

(II) verification of yield of ferulic acid production by each mutant

Colonies on plates were picked to Kan-containing ^R The seed solution was obtained by culturing in a resistant LB medium at 37℃and 220rpm for 12 hours. The cultured mutant strain was inoculated into YM9 medium at an inoculum size of 1%, the medium volume was 3mL, and shaking culture was carried out at 37℃for 12 hours. Detecting OD of fermented bacterial liquid ₆₀₀ Taking 1mL of fermentation liquor, centrifuging 10000 Xg for 2 minutes, taking 180 mu L of supernatant to a 96-well detection plate, adding 50 mu L of 50mM sodium periodate, uniformly mixing, and rapidly detecting OD after uniformly mixing ₄₅₀ And carrying out HPLC detection on the fermentation liquor, wherein the ferulic acid yield of each mutant is detected as follows:

the yield of ferulic acid of the wild-type strain was 0.5mM;

the mutant A11 strain had a ferulic acid yield of 0.73mM, which was 1.46 times that of the wild type;

the mutant 2E1 strain had a ferulic acid yield of 1.08mM, which was 2.07 times that of the wild type;

the single point mutant strain at the F22Y position has the ferulic acid yield of 1.1mM which is 2.2 times that of the wild type;

the mutant 21D6 strain had a ferulic acid yield of 1.83mM, which was 3.5 times that of the wild type.

The mutant 21D6-Opt strain had a ferulic acid yield of 2.38mM, 4.76 times that of the wild type.

EXAMPLE 4 application of caffeic acid-O-methyltransferase COMT mutant 21D6-Opt in production of ferulic acid

Experimental method for producing ferulic acid by using caffeic acid

Inoculating caffeic acid-O-methyltransferase COMT recombinant BW25113 (wild type or mutant), shake culturing overnight at 37deg.C, adding 2mM MgSO into YM9 culture medium ₄ ，0.1mM CaCl ₂ 50 mug/ml kanamycin, 5mM methionine and 1mM L-arabinose, 5mM caffeic acid is added when the culture is carried out for 6 hours at 37 ℃, the culture is continued for 24 hours at 37 ℃,10000 g of fermentation liquor is centrifuged for 5 minutes, and the ferulic acid content in the supernatant of the fermentation liquor is detected by HPLC, namely, the ferulic acid yield which is biosynthesized by taking caffeic acid as a substrate.

After treatment with wild-type COMT and mutant 21D6-Opt, respectively, the yields of ferulic acid were 2mM and 4.2mM, respectively, by the methods described above.

The foregoing has outlined rather broadly the more detailed description of embodiments of the present application, wherein specific examples have been provided herein to illustrate the principles and embodiments of the present application, and wherein the above examples are provided to assist in the understanding of the methods and concepts of the present application. Meanwhile, based on the ideas of the present application, those skilled in the art can make changes or modifications on the specific embodiments and application scope of the present application, which belong to the scope of the protection of the present application. In view of the foregoing, this description should not be construed as limiting the application.

Claims

1. Caffeic acid-O-methyltransferase mutant, wherein the mutant is one or more of the following mutations from the N-terminus of the amino acid sequence shown in SEQ ID NO. 1:

valine at position 314 to arginine;

alanine at position 160 to serine;

histidine 164 is mutated to asparagine;

phenylalanine at position 22 is mutated to tyrosine.

2. The caffeic acid-O-methyltransferase mutant according to claim 1, wherein the amino acid sequence of the mutant is shown in SEQ ID No. 2.

3. The caffeic acid-O-methyltransferase mutant according to claim 2, wherein the nucleic acid sequence of the mutant is as shown in SEQ ID No.3 or SEQ ID No. 4.

4. A recombinant vector comprising one or more of the following genes:

a gene encoding the caffeic acid-O-methyltransferase mutant of claim 1;

a gene shown in SEQ ID NO. 3;

the gene shown in SEQ ID NO. 4.

5. The recombinant vector according to claim 4, wherein the recombinant vector is constructed by inserting the gene shown in SEQ ID NO.3 or SEQ ID NO.4 into pET28a plasmid.

6. A recombinant bacterium capable of synthesizing the mutant of claim 1, said recombinant bacterium being a bacterium or fungus.

7. A method for preparing the caffeic acid-O-methyltransferase mutant according to claim 1, comprising the steps of:

constructing a recombinant bacterium using the recombinant vector of claim 4;

fermenting and culturing the recombinant bacteria, and inducing and expressing the mutant;

purifying the mutant.

8. The method of claim 7, wherein the purifying step is:

centrifugally collecting thalli, breaking the wall by ultrasonic waves, and collecting supernatant;

the supernatant was filtered and purified by a nickel column.

9. Use of the caffeic acid-O-methyltransferase mutant according to claim 1 for the production of ferulic acid.

10. The use according to claim 9, comprising the steps of:

fermenting and culturing the recombinant bacterium according to claim 6;

adding caffeic acid and methyl donor methionine into the culture system, and adding at the beginning of fermentation;

and collecting ferulic acid in the fermentation liquor.