CN116445528A

CN116445528A - Construction method of recombinant porcine epidemic diarrhea virus infectious clone, and infectious clone and application thereof

Info

Publication number: CN116445528A
Application number: CN202310401917.1A
Authority: CN
Inventors: 陈振海; 潘朔楠; 牟春晓; 陈密; 包文斌
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2023-04-14
Filing date: 2023-04-14
Publication date: 2023-07-18
Also published as: CN117286162A

Abstract

The invention discloses a construction method of recombinant porcine epidemic diarrhea virus infectious clone and the infectious clone and application thereof, comprising the following steps: amplifying the target fragment by the first round of gene recombination; electrotransformation of the targeting fragment to obtain positive clones; and removing the enzyme cutting site and the resistance gene from the obtained positive clone through a second round of recombination to obtain the PEDV infectious clone for expressing the target gene. The invention establishes a bacterial artificial chromosome-based PEDV reverse genetics system, rapidly and efficiently edits a PEDV genome in vitro by a Red homologous recombination technology, provides a powerful technical platform for researching the molecular biological characteristics and pathogenic mechanisms of viruses and developing genetic engineering vaccines, and provides a novel method for editing the PEDV genome and other viral genomes in vitro, along with high efficiency, convenience and strong specificity.

Description

Construction method of recombinant porcine epidemic diarrhea virus infectious clone, and infectious clone and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant porcine epidemic diarrhea virus infectious clone, a construction method and application thereof.

Background

Porcine epidemic diarrhea (Porcine epidemic diarrhea, PED) is a highly infectious disease caused by porcine epidemic diarrhea virus (Porcine epidemic diarrhea virus, PEDV). PEDV can infect pigs of various ages and cause acute diarrhea, vomiting, dehydration and high mortality in newborn piglets. PEDV is a single-stranded enveloped RNA virus belonging to the genus alphacoronavirus. The PEDV genome is approximately 28kb and comprises two terminal untranslated regions (5 '-UTR and 3' -UTR) and at least 7 open reading frames (Open Reading Frame, ORF). ORF1a and ORF1b respectively encode two polyproteins pp1a (polyprotein 1 a) and pp1ab, which can be further processed into 16 mature nonstructural proteins, nsp 1-nsp 16 respectively, under the action of viral protease. ORF2 to ORF6 encode a Spike protein (Spike protein), an accessory protein ORF3, an Envelope protein (Envelope protein), a membrane protein (Matrix protein) and a nucleocapsid protein (Nucleocapsid protein), respectively.

Porcine delta coronavirus (porcine deltacoronavirus, PDCoV) is one of the most common enteropathogenic viruses in the pig industry, can infect sows and piglets, and has high mortality. PDCoV is one of the most common enteropathogenic viruses in the pig industry, and can infect sows and piglets, with major clinical symptoms manifested as watery diarrhea and vomiting. Studies have shown that PDCoV has the potential to be zoonotic. PDCoV is a single-stranded positive-stranded enveloped RNA virus belonging to the genus delta coronavirus, whose genome is approximately 25.4kb in length, and whose gene arrangement is as follows: 5'-UTR, ORFla, ORF1b (encoding two multimeric proteins of ppra (polyprotein 1 a) and pprab), spike protein (Spike protein), envelope protein (Envelope protein), membrane protein (Matrix protein), nonstructural protein 6 (Non-structural protein, NS6), nucleocapsid protein (Nucleocapsid protein), NS7a and 3' -UTR.

Bacterial Artificial Chromosome (BAC) is a single copy plasmid vector based on E.coli F factor, has the characteristic of large capacity, and can be stably replicated in E.coli after exogenous gene is inserted. Coronavirus genomes are large and cannot replicate stably in high copy plasmid vectors, and therefore Bacterial Artificial Chromosomes (BACs) are ideal vectors for constructing infectious clones of coronaviruses. Reverse genetics is one of the most important tools in virology research, and its application in coronavirus research has enhanced our knowledge of the molecular biological properties, replication mechanisms and pathogenesis of viruses. Thus, the establishment of a reverse genetic operating system for PEDV and PDCoV is particularly important for the study of PEDV and PDCoV.

For transformation of virus infectious clone, the traditional technology is to search a proper enzyme cutting site, utilize tools such as restriction enzymes, DNA ligase and the like, even introduce an intermediate vector to finish the transformation, and the process is complex and tedious. Coronavirus infectious clone plasmid with BAC as skeleton is unsuitable for the traditional method because of huge virus genome and low concentration of plasmid and great difficulty if editing it in vitro. And Red recombination technology can solve the problem. Red recombination technology originates from phage and inserts linear double stranded DNA molecules by means of homologous recombination. The homology arms required in Red recombination technology are only 50bp, so homology arms can be directly added on both sides of the targeting fragment by PCR. And (3) carrying out temperature rise to induce the expression of a Red/ET enzyme system controlled by a temperature sensitive promoter in the E.coli GS1783 strain, realizing the first round of Red recombination, and then carrying out the second recombination by utilizing L-arabinose to induce counter-screening to induce the expression of endonuclease I-SceI. The strategy is independent of the size of the viral genome and the type of the vector, and realizes traceless editing of the viral genome. At present, the efficiency of Red recombination is rarely reported, and the report shows that the recombination rate of Red recombination is lower, and the improvement of the efficiency of Red recombination is beneficial to the editing of coronavirus genome.

PEDV and PDCoV are a great threat to the global pig industry and agricultural economy, and vaccine immunization is an effective measure of PEDV and PDCoV control. Since the advent of variants of PEDV in 2010, cross protection between vaccines against G1 and G2 strains was weak; in addition, there is currently no commercial vaccine or specific drug to prevent and treat PDCoV. Thus, research into new PEDV and PDCoV genetically engineered vaccines is urgent, and reverse genetics systems are powerful tools.

Disclosure of Invention

The invention aims to: the invention aims to solve the technical problem of providing a high-efficiency construction method of recombinant porcine epidemic diarrhea virus infectious clone.

The invention also solves the technical problem of providing a plurality of infectious clones of PEDV.

The invention also solves the technical problem of providing the application of the infectious clone of PEDV in preparing the medicament for preventing or treating the porcine epidemic diarrhea and the application in preparing the PEDV vaccine.

The invention also solves the technical problem of providing a high-efficiency construction method of the recombinant porcine delta coronavirus infectious clone.

The invention also solves the technical problem of providing a plurality of infectious clones of the recombinant porcine delta coronavirus.

The invention also solves the technical problem of providing the application of the infectious clone of the recombinant porcine delta coronavirus in preparing the medicine for preventing or treating the porcine epidemic diarrhea and the application in preparing the vaccine of the recombinant porcine delta coronavirus.

The technical scheme is as follows: in order to solve the technical problems, in one aspect, the invention provides a construction method of a recombinant porcine epidemic diarrhea virus infectious clone, which comprises the following steps:

1) Amplifying the targeting fragment: the structure of the targeting segment sequentially comprises a homology arm at the downstream of the PEDV-S gene, a target gene 1, an enzyme cutting site, a resistance gene and a homology arm at the downstream of the PEDV-ORF3 gene;

or the structure of the targeting segment sequentially comprises a homology arm at the downstream of the PEDV-S gene, a target gene 2, an enzyme cutting site, a resistance gene and a homology arm at the upstream of the PEDV-ORF3 gene;

2) Performing first-round gene recombination on the electrotransformation targeting fragment to obtain positive clones;

3) And (3) removing the enzyme cutting sites and the resistance genes from the positive clone obtained in the step (2) through a second round of recombination to obtain the recombinant porcine epidemic diarrhea virus infectious clone.

Wherein the target gene 1 comprises an Nluc gene or an RFP gene; the target gene 2 comprises GFP-P2A gene. The target gene 1 or the target gene 2 may be amplified if other reporter genes are required for experimental purposes.

Wherein, the step 1) specifically comprises the following steps:

1.1 PCR amplification of gene fragment 1 containing the cleavage site and the resistance screening gene;

1.2 Using the plasmid containing the target gene 1 or the target gene 2 as a template, and carrying out PCR amplification to obtain the first half of the target gene 1 or the target gene 2; PCR amplification to obtain the second half of the target gene 1 or the target gene 2;

1.3 Using the first half section of the target gene 1 and the gene fragment 1 as templates, and amplifying by overlap PCR to obtain a gene fragment 2; then using the second half of the gene segment 2 and the target gene 1 as templates, amplifying targeting segments simultaneously comprising a homologous arm at the downstream of the PEDV-S gene and a homologous arm at the downstream of the PEDV-ORF3 gene by an overlap PCR method; or the first half section of the target gene 2 and the gene fragment 1 are used as templates, and the gene fragment 3 is obtained through overlap PCR amplification; and amplifying targeting fragments simultaneously comprising the homology arm at the downstream of the PEDV-S gene and the homology arm at the upstream of the PEDV-ORF3 gene by using the second half of the gene fragment 3 and the target gene 2 as templates through an overlap PCR method.

Wherein the sequences of the homologous arm at the downstream of the PEDV-S gene and the homologous arm at the downstream of the PEDV-ORF3 gene or the homologous arm at the upstream of the PEDV-ORF3 gene are shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO: 3.

Further, the homology arm is related to the position where the foreign gene is to be inserted into the viral genome, and the length of the homology arm needs to be 50bp.

I-Sec I is a homing endonuclease encoded by introns, whose expression is induced by L-arabinose in E.coli, which is a rare cleavage for endonucleases and has very low probability of occurring naturally (1/4≡18). Therefore, we select the cleavage site as I-SceI, and other endonucleases capable of this function can be used in the present invention.

Wherein the resistance gene includes Kan, but may be replaced with other resistance (e.g., ampicillin, etc.), but must be different from the resistance of the infectious clone plasmid to be edited.

Wherein, the step 3) specifically comprises the following steps:

3.1 Picking the single colony of the positive clone in the step 2), inoculating the single colony into LB liquid medium containing chloramphenicol, and culturing until the single colony is turbid;

3.2 LB liquid medium containing 2% concentration of L-arabinose and chloramphenicol was added thereto and cultured at 30℃to 32℃for 1 hour.

3.3 Placing the bacterial liquid in the step 3.2) into a shaking table at 42 ℃ for 30-60 min;

3.4 Placing the bacterial liquid in the step 3.3) in a shaking table at 30-32 ℃ for continuous culture for 3-4 hours, taking the bacterial liquid for dilution, taking the diluted bacterial liquid for coating on an LB plate containing 1% concentration of L-arabinose and chloramphenicol resistance, and after the bacterial liquid is fully absorbed, inversely culturing in a bacterial incubator at 30-32 ℃ for about 24 hours;

3.5 Picking the single colony obtained in the step 3.4), respectively spot-plating the single colony into LB plates containing chloramphenicol resistance and kanamycin resistance, wherein the single colony does not grow in the kanamycin resistance LB solid medium, and the colony growing in the chloramphenicol LB solid medium is a colony with successful recombination, thus obtaining the positive clone.

The invention also discloses a construction method of the recombinant porcine epidemic diarrhea virus infectious clone obtained by the construction method.

The invention also discloses application of the PEDV infectious clone expressing the target gene in preparation of medicines for preventing or treating porcine epidemic diarrhea.

The invention also discloses application of the PEDV infectious clone expressing the target gene in preparing a PEDV vaccine.

In another aspect, the invention provides a method of constructing a recombinant PDCoV infectious clone comprising the steps of:

1) Amplifying the targeting fragment: the structure of the targeting segment sequentially comprises a homologous arm at the downstream of the PDCoV-M gene, a target gene 3, an enzyme cutting site, a resistance gene and a homologous arm at the downstream of the PDCoV-NS6 gene;

or the structure of the targeting segment sequentially comprises a homology arm at the downstream of the PDCoV-NS6 gene, a target gene 4, an enzyme cutting site, a resistance gene and a homology arm at the upstream of the PDCoV-N gene;

3) And (3) removing the enzyme cutting site and the resistance gene from the positive clone obtained in the step (2) through a second round of recombination to obtain a recombinant PDCoV infectious clone.

Wherein the target gene 3 comprises an Nluc gene; the target gene 4 comprises a P2A-GFP gene. The target gene 3 or the target gene 4 may be amplified if other reporter genes are required for experimental purposes.

Wherein, the step 1) specifically comprises the following steps:

1.1 PCR amplification of the gene fragment 3 containing the cleavage site and the resistance screening gene,

1.2 Using plasmid containing target gene 3 or target gene 4 as template, PCR amplifying to obtain first half of target gene 3 or target gene 4; PCR amplification to obtain the second half of the target gene 3 or the target gene 4;

1.3 Using the first half section of the target gene 3 and the gene fragment 3 as templates, and amplifying by overlap PCR to obtain a gene fragment 4; then using the second half of the gene segment 4 and the target gene 3 as templates, amplifying targeting segments simultaneously comprising homologous arms at the downstream of the PDCoV-M gene and homologous arms at the downstream of the PDCoV-NS6 gene by an overlap PCR method; or the first half section of the target gene 4 and the gene fragment 3 are used as templates, and the gene fragment 5 is obtained through overlap PCR amplification; and amplifying targeting fragments simultaneously comprising a homologous arm at the downstream of the PDCoV-NS6 gene and a homologous arm at the upstream of the PDCoV-N gene by using the second half of the gene fragment 5 and the target gene 3 as templates through an overlap PCR method.

Wherein the sequences of the homologous arm at the downstream of the PDCoV-M gene and the homologous arm at the downstream of the PDCoV-NS6 gene or the homologous arm at the downstream of the PDCoV-NS6 gene and the homologous arm at the upstream of the PDCoV-N gene are shown as SEQ ID NO:4 or SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO: shown at 7.

Wherein, the step 3) specifically comprises the following steps:

The invention also discloses application of the PDCoV infectious clone for expressing the target gene in preparation of medicines for preventing or treating porcine epidemic diarrhea.

The invention also discloses application of the PDCoV infectious clone for expressing the target gene in preparation of PDCoV vaccine.

The mechanism of the invention: in one aspect, in order to construct infectious clones of PEDV GX4/2021 strain, the invention amplified PEDV whole genome sequence by PCR, and fragments were sequentially inserted into pBAC-PEDV-smf by means of cleavage ligation to obtain PEDV infectious clone plasmid pBAC-PEDV. Further, 3 PEDV reporter plasmids were constructed using Red recombination techniques, respectively: the ORF3 gene is replaced by the PEDV reporter plasmid pBAC-PEDV-Nluc/ORF3, pBAC-PEDV-RFP/ORF3 of the Nluc or RFP gene; and a PEDV reporter plasmid pBAC-PEDV-GFP-ORF3, in which a foreign gene GFP is inserted upstream of the ORF3 gene by the self-cleaving function of the PTV-1 2a gene, while maintaining the complete genome of PEDV. Finally, 3 PEDV reporter viruses were successfully rescued. On the other hand, in order to construct PDCoV GX2021-1 infectious clone, the invention amplifies the PDCoV whole genome sequence by PCR, and inserts fragments into pBeloBAC11 sequentially by an enzyme digestion connection method to obtain PDCoV infectious clone plasmid pBAC-PDCoV. Further, 2 PDCoV recombinant viral plasmids were constructed using Red recombination technology, respectively: the PDCoV reporter plasmid pBAC-PDCoV-Nluc/NS6 with the NS6 gene replaced by the Nluc gene; based on the maintenance of the complete genome of PDCoV, the PDCoV reporter plasmid pBAC-PDCoV-NS6-GFP of foreign gene GFP is inserted downstream of NS6 gene by the self-cleavage function of PTV-1 2A gene, and the virus is successfully rescued.

The beneficial effects are that: compared with the prior art, the invention has the following remarkable advantages: the invention establishes a bacterial artificial chromosome-based PEDV and PDCoV reverse genetics system, rapidly and efficiently edits the PEDV genome and the PDCoV genome in vitro by a Red homologous recombination technology, provides a powerful technical platform for researching the molecular biological characteristics and pathogenic mechanisms of viruses and developing genetic engineering vaccines, and provides a novel method for editing the PEDV genome, the PDCoV genome and other coronavirus genomes in vitro, and the method is efficient, convenient and high in specificity.

Drawings

FIG. 1, construction of infectious clones of PEDV;

FIG. 2, identification of PEDV rescue viruses;

FIG. 3, construction of PEDV reporter viruses;

FIG. 4, identification of PEDV reporter viruses;

FIG. 5, construction of PDCoV infectious clones;

FIG. 6, identification of PDCoV rescue viruses;

FIG. 7, construction of PDCoV reporter virus;

FIG. 8, identification of PDCoV reporter virus.

Detailed Description

Before further describing the embodiments of the present invention, it should be understood that: the scope of the invention is not limited to the specific embodiments described below; it should also be appreciated that: the terminology used in the examples of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, materials used in the embodiments, any methods, devices, and materials of the prior art similar or equivalent to those described in the embodiments of the present invention may be used to practice the present invention according to the knowledge of one skilled in the art and the description of the present invention.

EXAMPLE 1 construction of recombinant PEDV infectious clone and use thereof

1. Cells, strains and strains

PEDV-GX4/2021 strain (GenBank accession number: OP382083, vero cells, pBeloBAC11, pEGFP C3, pET30a, lentiCRISPRv2, pCAGGS, pUC 57-Nluc) ¹ 、pUC57-RFP ¹ 、pCAGGS-T7-opt ² 、pMD19-T-GFP-P2A、E.coli GS1783 ³ The strains were all kept in the laboratory. JM109 competent cells were purchased from Shanghai Biotechnology Inc. and stored by the present laboratory.

Reference is made to:

[1] wang Minmin isolation and identification of type A Seika virus and construction of infectious clone [ D ]. University of Yangzhou 2020.DOI: 10.27441/d.cnki.gyrzdu.2020.000376.

[2] Identification of swine PiV strain, monoclonal antibody preparation and construction of virus infectious clone [ D ]. University of dulcimer, 2021.doi: 10.27441/d.cnki.gyrzdu.2021.002318.

[3]Tischer BK，Smith GA，Osterrieder N.En passant mutagenesis：a two step markerless red recombination system.Methods Mol Biol.2010；634：421-430.doi：10.1007/978-1-60761-652-8_30.

2. Primer design

According to the genomic sequence of the PEDv GX4/2021 strain, the PEDv full-length gene sequence was divided into 7 fragments (A1 (GenBank accession number: OP382083, position: 1-3514), A2 (GenBank accession number: OP382083, position: 3486-7521), B (GenBank accession number: OP382083, position: 7506-13028), C1 (GenBank accession number: OP382083, position: 12999-16903), C2 (GenBank accession number: OP382083, position: 16875-20723), C3 (GenBank accession number: OP382083, position: 20697-24387), C4 (GenBank accession number: OP382083, position: 24359-28036)), and the upstream and downstream primers were designed respectively (table 1) and synthesized by su Jin Weizhi biotechnology limited company.

TABLE 1 full genome amplification primers for PEDV

Primer name	Primer sequence (5 '-3')
		PEDV-A1 F	CGAAACGGAGTCTAGACTCCGTCACTTAAAGAGATTTTCTATCTATGG
PEDV-A1 R	GTCAAAAGCAAAAGGATCCTTAGTAACTGTGGA
		PEDV-A2 F	CAGTAGTGCGGCCGCCAGTTACTAAGGATCCTTTTGCTTTTGACTTTGC
PEDV-A2 R	AACGTACGCCTCAGCAACAGCAGCATTAAAGG
		PEDV-B F	CTGCTGTTGCTGAGGCTCATCGTTACG
PEDV-B R	CAAGCGCCTACCTTAATTAAAATGCTC
		PEDV-C1 F	TAAGAGCATTTTAATTAAGGTAGGCGCTTG
PEDV-C1 R	CAGCCTTTGACCACCTAGGATTTTTAGCC
		PEDV-C2 F	GGCTAAAAATCCTAGGTGGTCAAAGGCTG
PEDV-C2 R	AGTGTTAGCTGAGCACCTGGTGACATC
		PEDV-C3 F	GATGTCACCAGGTGCTCAGCTAACACT
PEDV-C3 R	GTGTTTTGTTAACATCGATGTAATCCGGG
		PEDV-C4 F	CCCGGATTACATCGATGTTAACAAAACAC
PEDV-C4 R	AGGTCGGACCGCGAGGAGGTGGAG

3. Construction of pBAC-stuf

To introduce the appropriate cleavage sites, a stuffer fragment (SEQ ID NO: 15) was amplified by template-free PCR using primer pairs PE-Stuf-F and PE-Stuf-R, and inserted into linearized pBeloBAC11 using restriction sites Not I and Rsr II to give pBAC-PEDV-Stuf, and finally restriction enzyme sites BamHI, bbvcI, pacI, avrII, blpI, and ClaI were introduced for construction of infectious clones of PEDV. Wherein the primer sequence is as follows:

PE-Stuf-F：

GCTCATCGCGGCCGCTGCTGTTGCTGAGGCGTACGTTAATTAAACCAGTCCCTAGGACCAGGTGCTCAGCGGAT

PE-Stuf-R：

ACAGCTTACGGACCGCGAGGAGGCCGCGGTTCTAGAATCGATGTAATCCGCTGAGCACCTGGTCCTAGGGACTG

4. amplification of the full genomic sequence of PEDV

Extracting the virus RNA of PEDV-GX4/2021, and preparing the virus RNA according to the following stepsThe cDNA was obtained by reverse transcription using the III 1st Strand cDNA Synthesis SuperMix kit (Shanghai, st. Job Co., ltd.). The full-length PEDv gene was divided into 7 fragments for PCR amplification using the primers shown in table 1 using cDNA as a template. After the PCR reaction was completed, 2. Mu.L of the product was analyzed by 1% agarose gel electrophoresis and observed by a gel imaging system. The remaining product was stored at-20 ℃.

5. Construction of full Length infectious clones

The PCR amplified full-length segment of PEDV-GX4/2021 strain genome is cut by enzyme, then is sequentially connected into linearized pBAC-PEDV-stuf, and is added with T7 and CMV promoters at 5 'end and p containing 35A bases at 3' end _o ly (A) tail to obtain full-length infectious clone plasmid of PEDV, and performing DNA sequencing, enzyme digestion andPCR identification, results showed successful construction of full-length infectious clone plasmid for PEDV, and was designated pBAC-PEDV (FIGS. 1B, C). The specific construction process is shown in FIG. 1A, firstly, a fragment A1 and a fragment CMV+T7promter are amplified into a fragment A1-promter through overlap PCR, and inserted into pBAC-PEDV-stuf through Not I and BamHI to obtain pBAC-PEDV-A1; next, fragment A2 was inserted into pBAC-PEDV-A1 using BamHI and BbvC I to obtain pBAC-PEDV-A; furthermore, fragment B was inserted into pBAC-PEDV-A using BbvC I and Pac I to give pBAC-PEDV-AB. Inserting fragment C1 into pBAC-PEDV-stuf using Pac I and AvrII to give pBAC-PEDV-C1; inserting fragment C2 into pBAC-PEDV-C1 using AvrII and BlpI to give pBAC-PEDV-C12; inserting fragment C3 into pBAC-PEDV-C12 using BlpI and Cla I to give pBAC-PEDV-C123; fragment C4 was inserted into pBAC-PEDV-C123 using Cla I and RsrII to give pBAC-PEDV-C. Finally, large fragment C was enzymatically excised from pBAC-PEDV-C using Pac I and RsrII, and then inserted into pBAC-PEDV-AB, which was tangentially digested with both Pac I and RsrII, to give the infectious clone plasmid pBAC-PEDV.

6. Construction of helper plasmids

The cDNA of the PEDV obtained in the step 4 is used as a template, a primer is designed by using the PEDV genome sequence as the template, and the primer PEDV-N F and the primer PEDV-N R are used for amplifying the PEDV-N gene fragment, and the fragment is connected into pCAGGS through KpnI and XhoI to obtain the recombinant plasmid pCAGGS-PEDV-N. Wherein the primer sequence is as follows:

PEDV-N F：CAAGGGTACCATGGCTTCTGTCAGTTTTCAGG

PEDV-N R：CAACGAGATCTTCGACACAGGAAATTAATAACTCGAGGAAC

7. construction of PEDV reporter virus

According to the construction strategy of PEDV virus (fig. 3A), the ORF3 gene is replaced by exogenous genes Nluc and RFP, respectively; in addition, we used the self-cleavage of the PTV-1 2A short peptide (FIG. 3A) to insert GFP into the 5' end of the ORF3 gene, while preserving the complete genome of PEDV. PEDV reporter plasmids were constructed using Red homologous recombination system (fig. 3B). In this example, colonies obtained by the first round of Red recombination were streaked on LB plates containing kanamycin resistance, yielding pure intermediate plasmids. And then the second round of recombination is induced by L-arabinose, and the plasmid after the second round of recombination is verified by Sanger sequencing.

The method comprises the following specific steps:

7.1 preparation of E.coli GS1783 electrotransformed competent cells, electrotransformed pBAC-PEDV

(1) A small amount of E.coli GS1783 glycerol bacteria was dipped in a sterile inoculating loop, streaking on LB plates without antibiotics, and incubating at 32℃overnight in an inverted manner.

(2) E.coli GS1783 single colony is picked up and inoculated in 5mL LB liquid culture medium, and cultured overnight at 32 ℃ to obtain resuscitated bacterial liquid.

(3) 5mL of the resuscitated bacterial liquid is added into 50mL of LB liquid medium, and shake cultivation is carried out at 32 ℃ until the OD600 value is 0.5.

(4) And (3) placing the bacterial liquid obtained in the step (3) into an ice-water mixture and cooling for 20 minutes.

(5) The whole bacterial liquid in step (4) was centrifuged at 3000rpm at 4℃for 15 minutes, and the supernatant was discarded.

(6) 10% glycerol precooled on ice was added, the cells were washed, centrifuged at 3000rpm at 4℃for 15 minutes, and the supernatant was discarded. This step was repeated 3 times.

(7) And (3) adding pre-cooled 10% glycerol to the thalli obtained in the step (6) to a volume of 500 mu L, and sub-packaging 50 mu L of each tube into a pre-cooled EP tube to obtain E.coli GS1783 electrotransformation competent cells.

(8) One E.coli GS1783 electrotransformation competent cell is placed on ice, 100ng of infectious clone plasmid pBAC-PEDV is added, the mixture is added into an electrorotating cup (1 mm multiplied by 1 mm) precooled on ice after uniform mixing, the electrorotating cup is tapped, so that thalli fully sink into the bottom of the electrorotating cup, and electric shock is carried out under the condition of 15 kV/cm.

(9) To the electric rotating cup, 900. Mu.L of the non-resistant LB liquid medium was added, sucked and blown several times, and transferred to a sterile 1.5mL centrifuge tube, and shake-cultured at a constant temperature of 32℃and 160rpm for 2 hours.

(10) The reaction tube was removed and centrifuged at 5000rpm for 3min. In an ultra clean bench, 800. Mu.L of the supernatant was aspirated, the cells were resuspended in the remaining medium, plated on solid LB plates containing chloramphenicol resistance, and incubated in a biochemical incubator at 32℃overnight upside down.

7.2 preparation of GS1783-pBAC-PEDV electrotransformation competent cells

(1) The single colony of GS1783-pBAC-PEDV is picked up and inoculated into 5mL of LB liquid medium containing chloramphenicol, and cultured overnight at 32 ℃ to obtain seed bacterial liquid.

(2) 5mL of the resuscitated bacterial solution was added to 50mL of LB liquid medium containing chloramphenicol, and shake-cultured at 32℃until the OD600 was 0.5.

(3) Shaking the bacterial liquid obtained in the step (2) at 42 ℃ for 15min, and immediately placing the bacterial liquid in an ice-water mixture for cooling for 20 min.

(4) The whole bacterial solution in the step (3) is centrifuged at 3000rpm at 4 ℃ for 15 minutes, and the supernatant is discarded.

(5) 10% glycerol precooled on ice was added, the cells were repeatedly washed, centrifuged at 3000rpm at 4℃for 15 minutes, and the supernatant was discarded. This step was repeated 3 times.

(6) Adding pre-chilled 10% glycerol into the thallus obtained in the step (5), fixing the volume to 500 mu L, subpackaging 50 mu L of each tube into a pre-chilled EP tube to obtain GS11783-pBAC-PEDV electrotransformation competent cells, and storing at-80 ℃.

7.3 construction of full-Length infectious clone of PEDV expressing the Nluc Gene

7.3.1 amplification of b-Nluc-I-SceI-Kan-c targeting fragment

(1) Construction of pMD19-T-I-SceI-Kan. The I-SceI-CATpro fragment was amplified using pBeloBAC11 as template and the primer pairs I-SceI-CATpro F and I-SceI-CATpro R; amplifying a Kana fragment by using pET30a as a template and using a primer pair Kan F and Kan R; the I-SceI-CATpro fragment and the Kana fragment are used as templates, a primer pair I-SceI-CATpro F and Kan R are used, fragment I-SceI-Kan is obtained through overlap PCR amplification, and then the fragment is connected into a T vector, and finally pMD19-T-I-SceI-Kan is obtained.

(2) The I-SceI-Kan fragment containing the I-SceI cleavage site and the resistance selection gene was amplified using the primers I-SceI-CATpro F and Kan R using pMD19-T-I-SceI-Kan as a template, and cut to gel for purification.

The PCR amplification system is as follows: ddH ₂ O22. Mu.L, primeSTAR Max Premix (2X) 25. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, template 1. Mu.L; the PCR amplification conditions were: pre-denaturation at 98℃for 3min, denaturation at 98℃for 10s and 55℃Annealing for 10s and extending for 10s at 72 ℃ for 30 cycles, and finally extending for 5min at 72 ℃.

(3) The pUC57-Nluc is used as a template, and primers PEDV-S-Nluc F and PE-Nluc-a-ISceI R are used for amplification to obtain the first half section Nluc-1 of the Nluc gene; the second half of the Nluc-2 gene was amplified using primers PE-Nluc-a F and Nluc R.

(4) The Nluc-1-I-SceI-Kan fragment is obtained by overlapping LapPCR amplification by taking the Nluc-1 fragment and the I_SceI-Kan fragment as templates and pedV-S-GFP F2 and Kan R as primers; then, the Nluc-1-I-SceI-Kan fragment and the Nluc-2 fragment are used as templates, the PEDV-S-GFP F2 and the PEDV-Nluc-ORF 3R 2 are used as primers, and a targeting fragment b-Nluc-I-SceI-Kan-c which simultaneously contains a 50bp homology arm downstream of the PEDV-S gene and a 50bp homology arm downstream of the PEDV-ORF3 gene is amplified by an overlap PCR method and subjected to gel cutting purification.

7.3.2 electrotransformation targeting fragment b-Nluc-I-SceI-Kan-c for targeting

(1) Taking out a GS1783-pBAC-PEDV electrotransformation competent cell from a refrigerator at the temperature of minus 80 ℃, putting the cell on ice to melt, adding 100ng of targeting fragment b-Nluc-I-SceI-Kan-c into 50gL electrotransformation competent cell, uniformly mixing, adding into an electrorotating cup (1 mm multiplied by 1 mm) precooled on ice, tapping the electrorotating cup, fully immersing thalli into the bottom of the electrorotating cup, and performing electric shock under the condition of 15 kV/cm.

(2) To the electric rotating cup, 900. Mu.L of the non-resistant LB liquid medium was added, sucked and blown several times, and transferred to a sterile 1.5mL centrifuge tube, and shake-cultured at a constant temperature of 32℃and 160rpm for 2 hours.

(3) The tube was removed, centrifuged at 5000rpm for 3min, and 800. Mu.L of the supernatant was pipetted off in an ultra clean bench, the cells were resuspended in the remaining liquid, spread on a solid LB plate containing both kanamycin and chloramphenicol antibiotic resistance, and incubated upside down in a biochemical incubator at 32℃for 24h.

(4) And (3) using the single colony obtained in the step (3) as a template, using PEDV-S-GFP F2 and PEDV-Nluc-ORF 3R 2 as primers, amplifying target fragments including a targeting fragment b-Nluc-I-SceI-Kan-c by colony PCR, identifying a first round of recombination rate and determining positive colonies. Further, positive colonies were streaked and purified on LB plates containing kanamycin to obtain positive clones pBAC-PEDV-Nluc/ORF3-Kan.

7.3.3 second round of recombination to remove the I-SceI-Kan Gene

(1) Single colonies of pBAC-PEDV-Nluc/ORF3-Kan were picked up and inoculated into 2mL of LB liquid medium containing chloramphenicol, and subjected to shaking culture at 32℃until turbidity.

(2) To this was added 2mL of LB liquid medium containing 2% L-arabinose and chloramphenicol, and the mixture was cultured at 32℃for 1 hour.

(3) And (3) placing the bacterial liquid in the step (2) in a shaking table at 42 ℃ for 30min.

(4) Placing the bacterial liquid in the step (3) in a shaking table at 32 ℃ for continuous culture for 3 hours, taking 100 mu L of bacterial liquid as 10 ⁴ And diluting by times, coating 200 mu L of diluted bacterial liquid on an LB plate containing 1% of L-arabinose and chloramphenicol resistance, and after the bacterial liquid is fully absorbed, culturing in a bacterial incubator at 32 ℃ for about 24 hours in an inverted mode.

(5) Single colonies obtained in step (4) were picked and plated on LB plates containing chloramphenicol resistance and kanamycin resistance, respectively. Colonies grown in the kanamycin-resistant LB solid medium were not grown, and colonies grown in the chloramphenicol LB solid medium were colonies that were successfully recombined, and the obtained positive clone was designated pBAC-PEDV-Nluc/ORF3, and whether the recombinant plasmid was successfully constructed was verified by DNA sequencing.

7.4 construction of full-Length infectious cloning plasmid of PEDV expressing RFP Gene

7.4.1 amplification of b-RFP-I-SceI-Kan-c targeting fragment

(1) Amplification of the I-SceI-Kan fragment was identical to 7.3.1 (2).

(2) The pUC57-RFP is used as a template, and primers PEDV-S-RFP F and PE-RFP-a-ISceI R are used for amplification to obtain the front half RFP-1 of the RFP gene; the second half of RFP-2 was amplified using primers PE-RFP-a F and RFP R.

(3) RFP-1-I-SceI-Kan fragment is obtained by overlapping PCR amplification by taking RFP-1 fragment and I-SceI-Kan fragment as templates and PEDV-S-GFPF2 and KanR as primers; and then, using RFP-1-I-SceI-Kan fragment and RFP-2 fragment as templates, using PEDV-S-GFP F2 and PEDV-Nluc-ORF 3R 2 as primers, amplifying a targeting fragment b-RFP-I-SceI-Kan-c simultaneously comprising a 50bp homology arm downstream of the PEDV-S gene and a 50bp homology arm downstream of the PEDV-ORF3 gene by an overlap PCR method, and performing gel cutting purification.

7.4.2 electrotransformation targeting fragment b-RFP-I-SceI-Kan-c for targeting

The method is the same as 7.3.2. In this step, the targeting fragment was b-RFP-I-SceI-Kan-c, and the obtained positive clone was designated pBAC-PEDV-RFP/ORF3-Kan.

7.4.3 second round of recombination to remove the I-SceI-Kan Gene

And 7.3.3. Positive clones were identified by sequencing as correct and designated pBAC-PEDV-RFP/ORF3.

7.5 construction of full-Length infectious clone of PEDV expressing GFP Gene

7.5.1 amplification of b-GFP-I-SceI-Kan-c targeting fragment

(1) Amplification of the I-SceI-Kan fragment was identical to 7.3.1 (2).

(2) Construction of pMD19-T-GFP-P2A. Using pEGFP C3 plasmid as template, using primer pair GFP F and GFP R to amplify fragment GFP, using lentiCRISPR v2 plasmid as template, using primer pair P2AF and P2AR to amplify fragment P2A; and (3) amplifying the fragment GFP and the fragment P2A serving as templates through overlap PCR to obtain the fragment GFP-P2A, and connecting the fragment GFP-P2A to a T vector to obtain the pMD19-T-GFP-P2A.

(2) The first half GFP-1 of GFP gene was obtained by amplification using pMD19-T-GFP-P2A as a template and the primers PEDV-S-GFP F and PE-GFP-a-ISceI R; the second half of GFP-2 was amplified using primers PE-GFP-a F and P2A-PE-ORF 3R.

(3) GFP-1-I-SceI-Kan fragment is obtained by performing overlap PCR amplification by using GFP-1 fragment and I-SceI-Kan fragment as templates and PEDV-S-GFPF2 and KanR as primers; and then, using GFP-1-I-SceI-Kan fragment and GFP-2 fragment as templates, using PEDV-S-GFP F2 and P2A-PE-ORF 3R 2 as primers, amplifying a targeting fragment b-GFP-I-SceI-Kan-c containing a 50bp homology arm downstream of the PEDV-S gene and a 50bp homology arm upstream of the PEDV-ORF3 gene by an overlap PCR method, and performing gel cutting purification.

7.5.2 electrotransformation of targeting fragments for targeting

The method is the same as 7.3.2. In this step, the targeting fragment was b-GFP-I-SceI-Kan-c, and the primer used for colony PCR identification was E R and the positive clone obtained was designated pBAC-PEDV-GFP-ORF3-Kan.

7.5.3 second round of recombination to remove the I-SceI-Kan Gene

And 7.3.3. The positive clone obtained was identified by sequencing as correct and was designated pBAC-PEDV-GFP-ORF3.

TABLE 2 amplification of targeting fragment primers

Wherein the recombination rate of the first round of Red recombination can reach more than 80% (91.7% (Nluc), 80.0% (RFP), 81.25% (GFP)) (Table 3). Recombination rate= (number of positive colonies/total number of detected colonies) ×100%.

TABLE 3 first round Red recombination Rate

Name of the name	First round Red recombination Rate
		pBAC-PEDV-Nluc/ORF3	91.7％(11/12)
pBAC-PEDV-RFP/ORF3	80.0％(12/15)
		pBAC-PEDV-GFP-ORF3	81.25％(13/16)

The construction of the PEDV reporter plasmids pBAC-PEDV-Nluc/ORF3, pBAC-PEDV-RFP/ORF3 and pBAC-PEDV-GFP-ORF3 was verified by Sanger sequencing to be successful (FIG. 3C).

8. Rescue of recombinant viruses

(1) Positive colonies containing recombinant viral plasmids pBAC-PEDV-Nluc/ORF3, pBAC-PEDV-RFP/ORF3 or pBAC-PEDV-GFP-ORF3 were grown up and plasmids were extracted using a plasmid extraction kit.

(2) Spreading Vero cells with good growth state into 6-well plate, and when cell density reaches 70%, mixing according to the following steps Transfection was performed using the 3000 reagent instructions.

(3) The plasmid usage per well is: pCAGGS-T7-opt 0.3. Mu.g, helper plasmid pCAGGS-PEDV-N0.2. Mu.g, infectious cDNA clone plasmid (pBAC-PEDV, pBAC-PEDV-Nluc/ORF3, pBAC-PEDV-RFP/ORF3 or pBAC-PEDV-GFP-ORF 3) 1.5. Mu.g. After 6h of transfection, the cell culture medium was replaced with fresh DMEM medium containing 10% fbs, and after 24h of transfection, the cell culture supernatant was discarded, the cell monolayer was washed 2 times with sterilized PBS buffer (0.01 m, ph=7.2), and DMEM medium containing 2 μg/mL pancreatin was added. After transfection of the recombinant plasmid pCAGGS-T7-opt, pCAGGS-PEDV-N and the infectious cDNA clone plasmid into Vero cells for 2 days, the cell supernatant was harvested and re-infected with fresh Vero cells (FIG. 2A).

(4) After the cells have developed typical lesions or specific fluorescence, the cell culture supernatants are harvested to obtain rescued viruses designated rPEDV, rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3, rPEDV-GFP-ORF3, labeled as P0 generation, respectively. The rescued viruses were serially passaged in Vero cells and each generation of virus solution was labeled and stored at-80 ℃.

9. Identification of recombinant viruses

9.1 Indirect immunofluorescence assay

Wild-type PEDV, rescued virus rPEDV, rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rPEDV-GFP-ORF3 were each infected with Vero cells, fixed cells for 24h, and detected using monoclonal antibodies against the PEDV-N protein. The method comprises the following specific steps:

(1) Vero fine powder with good growth stateCells were spread evenly in 6-well plates, after cell density reached 90%, the cell monolayer was washed 2 times with sterilized PBS buffer (0.01 m, ph=7.2), 100 μl of P0 generation rescue virus solution was inoculated into the cell monolayer, and wells were set without virus solution, at 37 ℃,5% CO ₂ After incubation in a constant temperature incubator for 2h, the supernatant was aspirated, DMEM medium containing 2. Mu.g/mL pancreatin was added and the culture was continued for 36h, and the cell culture supernatant was collected and labeled as P1 generation.

(2) The cell monolayer from which the supernatant was collected was washed 1 time with PBS, and pre-chilled 4% paraformaldehyde was fixed for 10min at room temperature, and washed 2 times with PBS.

(3) A pre-chilled PBS solution containing 0.1% Triton X-100 and 2% BSA was added, membrane-broken at room temperature, blocked for 30min, and washed 2 times with PBS.

(4) Adding 1: anti-PEDV-N mAb diluted 2000-fold was incubated for 1h at 37℃and washed 3 times with PBS.

(5) Adding 1: 2000-fold dilution of Dylight 488 or 549 labeled goat anti-mouse IgG secondary antibody, incubated at 37℃for 1h in the absence of light, and washed 3 times with PBS.

(6) DAPI staining solution diluted 1:10 was added, incubated at room temperature for 5min, washed 3 times with PBS, added with an appropriate amount of PBS, observed under an inverted fluorescence microscope, and photographed.

The results showed that specific fluorescence was observed under a fluorescence microscope, whereas control cells did not (fig. 2B), indicating expression of N protein in virus-infected cells, demonstrating that we successfully rescued PEDV virus.

Specific green fluorescence can be seen under an inverted fluorescence microscope in rPEDV-Nluc/ORF3 group; not only specific red fluorescence (RFP gene expression) but also specific green fluorescence (N gene expression) can be seen under the rPEDV-RFP/ORF3 group inverted fluorescence microscope; not only specific green fluorescence (GFP gene expression) but also specific red fluorescence (N gene expression) was observed under an inverted fluorescence microscope for the rpdv-GFP-ORF 3 group, whereas no specific fluorescence was observed for the control cells (fig. 4A). In conclusion, we successfully rescued PEDV reporter virus expressing exogenous genes.

9.2Western Blot identification

PEDV, rPEDV, rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rBAC-PEDV-GFP-ORF3 (generation P1) virus solutions are taken, vero cells are respectively infected with MOI=0.01, protein samples are collected after 24 hours, and Western Blot identification is carried out. Wherein, the primary antibody uses anti-PEDV-N monoclonal antibody, and the secondary antibody uses goat anti-mouse monoclonal antibody marked by HRP. The results showed that the expression of N protein could be detected in both virus infected groups, whereas the expression of N protein could not be detected in the blank cells (fig. 2C, fig. 4B).

10. Identification of biological properties of viruses

To understand the growth characteristics of the rescued viruses, wild-type PEDV and rpdv; the phenotype, rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rPEDV-GFP-ORF3 were analyzed for growth kinetics, respectively.

10.1 multistep growth curves

(1) Vero cells were spread evenly in 6-well plates and infected with virus until cell density reached 90%.

(2) PEDV, rPEDV, pPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rPEDV-GFP-ORF3 were each infected with Vero cells at MOI=0.001, incubated in an incubator at 37℃for 2 hours, the supernatant was discarded, washed 2 times with PBS, and 2mL of DMEM medium containing 2. Mu.g/mL pancreatin was added to continue culturing. 2 duplicate wells were set per virus.

(3) The virus supernatants were collected 6h, 12h, 24h and 36h after virus infection, respectively, and stored at-80℃for further use.

(4) The collected virus solution was subjected to 10-fold gradient dilution with DMEM medium containing 2 μg/mL pancreatin, vero cells spread in 96-well plates were washed 2 times with PBS, diluted virus solution was added to 96-well plates, 100 μl was added per well, and 4 duplicate wells were set per dilution. Lesions were observed daily, and indirect immunofluorescence detection was performed 48h post infection, and TCID was calculated using the Reed-Muench method ₅₀ And a growth curve of the virus is drawn.

The results of the growth kinetics curves showed that the titres of rpdv and PEDV were both highest at 24h, with similar replication capacity and growth characteristics (fig. 2D). rPEDV-GFP-ORF3 has similar growth characteristics to rPEDV, and its virulence reaches the highest at 24h (3X 10) ⁵ TCID ₅₀ Per mL), rpdv-Nluc/ORF 3, rpdv-RFP/ORF 3 decreased by 0.51g of the highest titer compared to rpdv (fig. 4C).

10.2 Virus plaque assay

(1) Vero was plated uniformly into 12-well plates, and when the cell density was greater than 90%, the supernatant was discarded and the cell monolayer was washed 2 times with sterilized PBS.

(2) The virus solutions of PEDV, rpdv and PEDV reporter viruses (rpdv-Nluc/ORF 3, rpdv-RFP/ORF 3 and rpdv-GFP-ORF 3) were each infected with cells at moi=0.0001, while normal cells were set as negative controls. After incubation in an incubator at 37℃for 2h, the supernatant was discarded and washed 2 times with PBS.

(3) The preheated 2% low melting point agar was 1:1 mixed with 2 XDMEM (containing 20% TPB, 4. Mu.g/mL pancreatin) and added to the cell monolayer at 2mL per well, left to stand at room temperature for 1 h, and the cell plates were placed upside down in a 37℃incubator for further incubation for 36h.

(4) The mixture was fixed and stained overnight at room temperature with an alcohol solution containing 0.5% crystal violet. After discarding the staining solution and agar, the cell plate was washed with clear water, the morphology and size of the plaques were observed, and the record was photographed.

Plaque experiments showed that both rpdv and PEDV can form plaques on vero cells, and that the morphological size of plaques is similar (fig. 2E). Both rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rPEDV-GFP-ORF3 can form plaques on vero cells, and the morphological size of the plaques is similar to rPEDV (FIG. 4D).

10.3RT-PCR analysis of stability of exogenous genes

To examine the genetic stability of the exogenous genes (Nluc, RFP and GFP), the reporter viruses rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rPEDV-GFP-ORF3 were serially passaged 11 times on Vero cells to obtain virus solutions of different generations. The stability of the red or green fluorescence was observed during passage and the fluorescence was found to be relatively stable. The stability of the exogenous gene was identified by RT-PCR and Sanger sequencing. The method comprises the following specific steps:

the collected P0 generation rPEDV-Nluc/ORF3, rPEDV-RFP/ORF3 and rPEDV-GFP-ORF3 virus solutions were serially passaged on Vero cells to P9 generation. And respectively taking P3 and P9 generation virus solutions, extracting viral RNA, and reversely transcribing into cDNA. RT-PCR was performed with primers Nluc F and Nluc R using pBAC-PEDV-Nluc/ORF3 as positive control, amplifying the Nluc gene (516 bp); using pBAC-PEDV-RFP/ORF3 as positive control, using primers RFPF and RFPR to make RT-PCR, amplifying RFP gene (711 bp); the GFP gene (720 bp) was amplified by RT-PCR with the primers GFP F and GFP R using pBAC-PEDV-GFP-ORF3 as a positive control. Finally, genetic stability of the Nluc, RFP and GFP genes in PEDV reporter viruses was examined by Sanger sequencing. Primer sequence:

Nluc F：ATGGTCTTCACACTCGAAGATTTCGTTG

Nluc R：GTGCGAACGCATTCTGGCGTAA

RFP F：ATGGTGTCTAAGGGCGAAGAGC

RFP R：GCAAACTGGGGCACAAACTTAATTAA

The results showed that the PCR product sizes of the virus solutions of P3 and P9 generation PEDV reporter viruses obtained on Vero cells were consistent with the expectations (fig. 4E); sanger sequencing results showed that no deletion or mutation occurred in the foreign gene. The above results indicate that PEDV reporter viruses expressing exogenous genes Nluc, RFP or GFP can be stably transferred on Vero cells for at least 9 passages.

EXAMPLE 2 construction of recombinant PDCoV infectious clone and use thereof

1. Cells, strains and strains

The PDCoV-GX2021-1 strain (GenBank accession number: OQ 547740), LLC-PK1 cells, pEGFP C3, pET30a, lentiCRISPR V2, pBeloBAC11, pCAGGS-T7-opt, E.coli GS1783 strain were all stored in the laboratory. JM 109 competent cells were purchased from Shanghai Biotechnology Inc. and stored by the present laboratory.

2. Primer design

Based on the gene sequence of PDCoV GX2021-1 strain (GenBank accession number: OQ 547740), the PDCoV full-length gene was divided into 8 fragments (fragment 2A (GenBank accession number: OP382083, position: 4079-8324), 2B (GenBank accession number: OP382083, position: 8296-11658), fragment 3 (GenBank accession number: OP382083, position: 11628-15880), fragment 4 (GenBank accession number: OP382083, position: 15852-20628), fragment F (GenBank accession number: OP382083, position: 1-2028), G (GenBank accession number: OP382083, position: 2019-4106), M (GenBank accession number: OP382083, position: 2225422), N (GenBank accession number: OP382083, position: 20234-22948)), and the upstream primer was designed and synthesized by Souzhou Jin Weizhi biological limited, respectively.

TABLE 4PDCoV Whole genome amplification primers

3. Construction of pBAC-stuf

To introduce the appropriate cleavage sites, the primer pairs PD-Stuf-F and PD-Stuf-R were used to obtain a stuffer fragment (SEQ ID NO: 9) by PCR amplification and inserted into linearized pBeloBAC11 using restriction sites Not I and RsrII to obtain pBAC-PDCoV-Stuf, and finally restriction enzyme sites Sph I, bsiWI, sacI, bstBI, pmeI, bcvC I, swaI and AvrII were introduced for the construction of PDCov infectious clones. Wherein the primer sequence is as follows:

PD-Stuf-F：

CCCGGGCGGCCGCTCCACTCGCATGCGTGCTTGCGTACGACAGACTGAGCTCATAGCATTTCGAAGAGATGAGTTTAAACGATGTC

PD-Stuf-R：

CAAATGCCGGACCGTACCAACCCTAGGGATGACGATTTAAATCACGAGAGCTGAGGTGACATCGTTTAAACTCATCTCTTCGAAA

4. amplification of PDCov full genomic sequence

Extracting the viral RNA of PDCoV GX2021-1 and preparingIII lst Strand cDNA Synthesis SuperMix the cDNA was obtained by reverse transcription using the kit (Shanghai, santa Clara Co., ltd.). The full-length gene of PDCov was divided into 8 fragments for PCR amplification using the primers in table 1 with cDNA as a template. After the PCR reaction was completed, 2. Mu.L of the product was analyzed by 1% agarose gel electrophoresis and observed by a gel imaging system. The remaining product was stored at-20 ℃.

5. Construction of infectious clones

The purified fragments were ligated into linearized pBAC-PDCoV-stuf using restriction sites (FIG. 5A), and T7 and CMV promoters were added at the 5 'end, and poly (A) tails containing 35A bases were added at the 3' end, to give the full-length infectious clone plasmid of PDCoV, which was designated pBAC-PDCoV. The specific construction process is shown in FIG. 5A, wherein a fragment CMV+T7promter and a fragment F are used as templates, PD-1F and PD-2727R are used, fragment 1EF is obtained through overlap PCR, and NotI and SphI are used for inserting the fragment into pBAC-stuf to obtain pBAC-PD-1EF; fragment G was then inserted into pBAC-PD-1EF using SphI and BsiWI to give pBAC-PD-1. Template-free PCR is carried out on the PA-F1 and the PA-R1 by using a primer pair to obtain a fragment P containing poly A, overlap PCR is carried out on the fragment P and the fragment M serving as templates by using the primers PD-23607F and PD-26186R to obtain a fragment MP, and the fragment MP is inserted into pBAC-PDCoV-stuf by using AvrII and RsrII to obtain pBAC-PD-5MP; fragment N was then inserted into pBAC-PD-5MP using SwaI and AvrII to give pBAC-PD-5. Fragments 2A and 2B were inserted into pBAC-stuf using BsiWI and SacI and BstBI in sequence to give pBAC-PD-2. Finally, the restriction enzymes are utilized to sequentially connect the fragment 1, the fragment 3, the fragment 4 and the fragment 5 into the pBAC-PD-2, so as to obtain the PDCoV infectious clone plasmid, pBAC-PDCov. The results of DNA sequencing and PCR identification (FIG. 5B) showed successful construction of the full-length infectious cloning plasmid for PDCoV, and was designated pBAC-PDCoV.

6. Construction of helper plasmids

The PDCov-N gene fragment amplified by using the primers PDCoV-N F and PDCoV-N R and connected to pCAGGS by KpnI and XhoI by using the PDCov cDNA obtained in the step 4 as a template to obtain a recombinant plasmid pCAGGS-PDCoV-N. Wherein the primer sequence is as follows:

PDCoV-N F：CAAGGGTACCATGGCTGCACCAGTAGTCC

PDCoV-N R：GTTCCTCGAGCTACGCTGCTGATTCCTGCTTTATC

7. construction of PDCoV reporter virus

According to the construction strategy of the PDCoV virus (fig. 7A), the foreign gene Nluc replaces the NS6 gene; in addition, GFP was inserted into the 3' end of the NS6 gene by self-cleavage of the PTV-1 2A short peptide, while maintaining the complete genome of PDCoV. The PDCoV recombinant viral plasmid was constructed using Red homologous recombination system (fig. 7B). Colonies from which the first round of Red recombination occurred were streaked onto LB plates containing kanamycin resistance, yielding pure intermediate plasmids. And then the second round of recombination is induced by L-arabinose, and the plasmid after the second round of recombination is recombined. The specific experimental process is as follows:

7.1 preparation of Ecoli GS1783 electrotransformed competent cells, electrotransformed pBAC-PDCoV

(1) A small amount of GS1783 glycerol bacteria was dipped in a sterile inoculating loop, streaked on LB plates without antibiotics, and incubated upside down at 32℃overnight.

(2) GS1783 single colony is picked up and inoculated into 5mL LB liquid medium, and cultured overnight at 32 ℃ to obtain resuscitated bacterial liquid.

(3) 5mL of the resuscitated bacterial solution was added to 50mLLB liquid medium and shake cultured at 32℃until the OD600 was 0.5.

(6) 10% glycerol precooled on ice was added, the cells were repeatedly washed, centrifuged at 3000rpm at 4℃for 15 minutes, and the supernatant was discarded. This step was repeated 3 times.

(7) Adding pre-cooled 10% glycerol to the thallus obtained in the step (6) to a volume of 500 mu L, and sub-packaging 50 mu L of each tube into a pre-cooled EP tube to obtain GS1783 electrotransformation competent cells.

(8) A piece of GS1783 electrotransformation competent cells is placed on ice, 100ng of infectious clone plasmid pBAC-PDCoV is added, the mixture is added into an electric rotating cup (1 mm multiplied by 1 mm) precooled on the ice after uniform mixing, the electric rotating cup is tapped, so that thalli fully sink into the bottom of the electric rotating cup, and electric shock is carried out under the condition of 15 kV/cm.

7.2 preparation of GS1783-pBAC-PDCoV electrotransformation competent cells

(1) The single colony of GS1783-pBAC-PDCoV is picked and inoculated into 5mL LB liquid medium containing chloramphenicol, and cultured overnight at 32 ℃ to obtain seed bacterial liquid.

(6) Adding pre-cooled 10% glycerol into the thallus obtained in the step (5), fixing the volume to 500 mu L, subpackaging 50 mu L of each tube into a pre-cooled EP tube to obtain GS1783-pBAC-PDCoV electrotransformation competent cells, and storing at the temperature of-80 ℃.

7.3 construction of full-Length infectious cloning plasmid of PDCoV expressing the Nluc Gene

7.3.1 amplification of b-Nluc-I-SceI-Kan-c targeting fragment

PCR amplification systemThe method comprises the following steps: ddH ₂ O22. Mu.L, primeSTARMax Premix (2X) 25. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, template 1. Mu.L; the PCR amplification conditions were: pre-denaturation at 98℃for 3min, denaturation at 98℃for 10s, annealing at 55℃for 10s, extension at 72℃for 10s for 30 cycles, and total extension at 72℃for 5min.

(3) Using pUC57-Nluc as a template, and using primers PD-Nluc F and PD-Nluc-a-ISceI R to amplify to obtain a first half section Nluc-1 of an Nluc gene; the second half of the Nluc gene, nluc-2, was amplified using primers PD-Nluc-a F and PD-Nluc R1.

(4) The Nluc-1-I-SceI-Kan fragment is obtained by performing overlap PCR amplification by taking the Nluc-1 fragment and the I SceI-Kan fragment as templates and PD-Nluc F2 and Kan R as primers; and amplifying targeting fragments b-Nluc-I-SceI-Kan-c simultaneously comprising a 50bp homology arm downstream of the PDCoV-M gene and a 50bp homology arm downstream of the PDCoV-NS6 gene by an overlap PCR method by taking the Nluc-1-I-SceI-Kan fragment and the Nluc-2 fragment as templates and taking PD-Nluc F2 and PD-Nluc R2 as primers, and performing gel cutting purification.

(1) Taking out a GS1783-pBAC-PDCoV electrotransformation competent cell from a refrigerator at the temperature of minus 80 ℃, putting the cell on ice to melt, adding 100ng of targeting fragment b-Nluc-I-SceI-Kan-c into 50 mu L of the electrotransformation competent cell, uniformly mixing, adding the mixture into an electrorotating cup (1 mm multiplied by 1 mm) precooled on ice, tapping the electrorotating cup, fully immersing thalli into the bottom of the electrorotating cup, and performing electric shock under the condition of 15 kV/cm.

(4) And (3) using the single colony obtained in the step (3) as a template, using PD-Nluc F2 and PD-Nluc R2 as primers, amplifying target fragments including a targeting fragment b-Nluc-I-SceI-Kan-c by colony PCR, and identifying positive colonies successfully recombined in the first round. Further, positive colonies were streaked and purified on LB plates containing kanamycin to obtain positive clones pBAC-PDCoV-Nluc/NS6-Kan.

7.3.3 second round of recombination to remove the I-SceI-Kan Gene

(1) A single colony of pBAC-PDCoV-Nluc/NS6-Kan was picked up and inoculated into 2mL of LB liquid medium containing chloramphenicol, and the culture was shake-cultured at 32℃until it became turbid.

(4) Placing the bacterial liquid in the step (3) in a shaking table at 32 ℃ for continuous culture for about 3 hours, taking 100 mu L of bacterial liquid as 10 ⁴ And diluting by times, coating 200 mu L of diluted bacterial liquid on an LB plate containing 1% of L-arabinose and chloramphenicol resistance, and after the bacterial liquid is fully absorbed, culturing in a bacterial incubator at 32 ℃ for about 24 hours in an inverted mode.

(5) Single colonies obtained in step (4) were picked and plated on LB plates containing chloramphenicol resistance and kanamycin resistance, respectively. Colonies grown in the kanamycin-resistant LB solid medium were not grown, and colonies grown in the chloramphenicol LB solid medium were colonies that were successfully recombined, and the obtained positive clone was designated pBAC-PDCoV-Nluc/NS6, and whether the recombinant plasmid was successfully constructed was verified by DNA sequencing. 7.4 construction of full-Length infectious cloning plasmid of PDCoV expressing GFP Gene

7.4.1 construction of pMD 19-T-P2A-GFP

Amplifying fragment P2A by using lentiCRISPR v2 as a template, and amplifying fragment GFP by using pEGFP C3 as a template; and (3) amplifying the fragment P2A and the fragment GFP serving as templates through overlap PCR to obtain the fragment P2A-GFP, and connecting the fragment P2A-GFP to a T vector to obtain the pMD19-T-P2A-GFP.

7.4.2 amplification of b-GFP-I-SceI-Kan-c targeting fragment

(1) Amplification of the I-SceI-Kan fragment was identical to 7.3.2.

(2) pMD19-T-P2A-GFP was constructed. Using the lentiCRISPR v2 plasmid as a template, using a primer pair P2A F and P2A R to amplify fragment P2A, using the pEGFPC3 plasmid as a template, using a primer pair GFPF and GFPR to amplify fragment GFP; and (3) amplifying the fragment P2A and the fragment GFP serving as templates through overlap PCR to obtain the fragment P2A-GFP, and connecting the fragment P2A-GFP to a T vector to obtain the pMD19-T-P2A-GFP.

(3) The first half P2A-GFP-1 of GFP gene was amplified using the primers PD-NS6-P2A F1 and PD-NS6-GFP-a-ISceIR using pMD19-T-P2A-GFP as a template; the second half of GFP-2 was amplified using primers PD-NS6-GFP-a F and PD-NS6-P2A-GFP R1.

(4) The 3' -end of the NS6 gene, designated as the NS6-3 fragment, was amplified using the primers PD-NS 6-3F and PD-NS 6-3R using pBAC-PDCoV as template.

(5) The P2A-GFP-1 fragment and the I-SceI-Kan fragment are used as templates, PD-NS6-P2A F1 and KanR are used as primers, and the overlap PCR is carried out to obtain the GFP-1-I-SceI-Kan fragment; and then, using GFP-1-I-SceI-Kan fragment, GFP-2 fragment and NS6-3 fragment as templates, using PD-NS6-P2A F2 and PD-NS 6-3R as primers, amplifying a targeting fragment b-P2A-GFP-I-SceI-Kan-c comprising a 50bp homology arm downstream of the PDCoV-NS6 gene and a 50bp homology arm upstream of the PDCoV-N gene by an overlap PCR method, and performing gel cutting purification.

7.4.3 electrotransformation targeting fragment b-P2A-GFP-I-SceI-Kan-c targeting

The method is the same as 7.3.3. In the step, the targeting fragment is b-GFP-I-SceI-Kan-c, primers used in colony PCR are PD-NS6-P2AF2 and PD-NS 6-3R, and the obtained positive clone is named pBAC-PDCoV-NS6-P2A-GFP-Kan.

7.4.4 second round of recombination to remove the I-SceI-Kan Gene

And 7.3.4. Positive clones were identified by sequencing as correct and designated pBAC-PDCoV-NS6-P2A-GFP.

TABLE 5 amplification of target fragment primers

Wherein, the recombination rate of the first Red recombination can reach more than 86 percent (Nluc (13/15), GFP (14/15)), and the Sanger sequencing proves that the PDCoV recombinant virus plasmids pBAC-PDCoV-Nluc/NS6 and pBAC-PDCoV-NS6-GFP are successfully constructed (FIG. 7C).

8. Rescue of recombinant viruses

(1) Positive colonies containing the recombinant viral plasmid pBAC-PDCoV-Nluc/NS6 and pBAC-PDCoV-NS6-GFP were grown up and then plasmids were extracted using the plasmid extraction kit.

(2) LLC-PK1 cells with good growth state are evenly spread into a 6-hole plate, and when the cell density reaches 70% -80%, the method is as followsTransfection was performed using the 3000 reagent instructions.

(3) The plasmid usage per well is: pCAGGS-T7-opt 0.3. Mu.g, helper plasmid pCAGGS-PDCoV-N0.2. Mu.g, infectious cDNA clone plasmid (pBAC-PDCoV, pBAC-PDCoV-Nluc/NS6 or pBAC-PDCoV-NS 6-GFP) 1.5. Mu.g. After 4-6h of transfection, the cell culture medium was replaced with fresh DMEM medium containing 10% fbs, and after 24h of transfection, the cell culture supernatant was discarded, the cell monolayer was washed 2 times with sterilized PBS buffer (0.01 m, ph=7.2), DMEM medium containing 1 μg/mL pancreatin was added, and the culture was continued for 4 days (fig. 6A), after the cells developed typical lesions or specific fluorescence, the cell culture supernatant was harvested to obtain rescue viruses designated rPDCoV, rPDCoV-Nluc/NS6, rPDCoV-NS6-GFP, respectively, labeled P0 generation.

(4) The collected P0 generation virus liquid is continuously passaged in LLC-PK1 cells, and each generation of virus liquid is marked and then stored at the temperature of minus 80 ℃.

9. Identification of recombinant viruses

9.1 Indirect immunofluorescence assay

Parent viruses PDCoV, rescued viruses rPDCoV-Nluc/NS6 and rPDCoV-NS6-GFP were infected with LLC-PK1 cells, respectively, fixed cells after 24h, detected using monoclonal antibodies against the PDCoV-NS6 protein or monoclonal antibodies against the PDCoV-S protein, and secondary antibodies using Dylight 488-labeled goat anti-mouse monoclonal antibodies. The experimental procedure was as follows:

(1) LLC-PK1 cells with good growth state were spread uniformly in 6-well plates, and when the cell density reached 90%, sterilized PBS buffer (0.01M, pH=7.2 Cleaning cell monolayer for 2 times, inoculating 300 μl of P0 generation rescue virus solution into cell monolayer, simultaneously arranging holes without inoculating virus solution, and inoculating 5% CO at 37deg.C ₂ After incubation in a constant temperature incubator for 2 hours, the supernatant was aspirated, DMEM medium containing 1. Mu.g/mL pancreatin was added, and the culture was continued for 36 hours, and the cell culture supernatant was collected and labeled as P1 generation.

(3) A pre-chilled solution of 0.1% Triton X-100 and 2% BSA was added, membrane broken at room temperature, blocked for 30min, and washed 2 times with PBS.

(4) Adding 1: 2000-fold dilutions of either Anti-PDCoV-NS6 mAb, or Anti-PDCoV-S mAb were incubated for 1h at 37℃and washed 3 times with PBS.

(5) Adding 1: 2000-fold dilution of Dylight 488 or 549-labeled goat anti-mouse IgG secondary antibody, incubated at 37℃for 1h in the absence of light, and washed 3 times with PBS. An appropriate amount of PBS was added, and observed under an inverted fluorescence microscope and photographed.

The results showed that specific fluorescence was observed under fluorescence microscopy in the PDCoV, rpdccov-infected groups, whereas no specific fluorescence was observed in the control cells (fig. 6B), indicating expression of NS6 protein in virus-infected cells, demonstrating that we successfully rescued the PDCoV virus.

Meanwhile, the rPDCoV-Nluc/NS6 infection group can see specific green fluorescence under an inverted fluorescence microscope and can express S protein; the rPDCoV-NS6-GFP group was observed under an inverted fluorescence microscope for specific green fluorescence (GFP gene expression) as well as specific red fluorescence (S protein expression), whereas the control cells were not specific (FIG. 8A). In conclusion, we successfully rescued the PDCoV recombinant virus expressing the foreign gene.

9.2 Western Blot identification

PDCoV, rPDCoV, rPDCoV-Nluc/NS6, rPDCoV-NS6-GFP (P1 generation) virus liquid is taken, LLC-PK1 cells are infected, and protein samples are collected after 24 hours for WesternBlot identification. Wherein, the primary antibody uses an anti-PDCoV-M monoclonal antibody, and the secondary antibody uses an HRP-labeled goat anti-mouse monoclonal antibody.

The results showed that the expression of M protein could be detected in all virus infected groups, whereas the expression of M protein could not be detected in the blank cells (fig. 6C). LLC-PK1 cells were infected with rPDCoV-Nluc/NS6 and rPDCoV-NS6-GFP, respectively, and the cells were lysed for 24 hours, and protein immunoblotting was performed using a monoclonal antibody against the PDCoV-M protein. The results showed that the expression of M protein was detected in all virus infected groups. (FIG. 8B).

10. Identification of biological properties of viruses

10.1 multistep growth curves

(1) LLC-PK1 cells were spread evenly in 6-well plates and infected with virus until cell density reached 90%.

(2) PDCoV, rPDCoV, rPDCoV-Nluc/NS6 or rPDCoV-NS6-GFP was infected with LLC-PK1 cells at MOI=0.01, respectively, incubated in an incubator at 37℃for 2 hours, the supernatant was discarded, washed 2 times with PBS, and 2mL of DMEM medium containing 1. Mu.g/mL pancreatin was added thereto to continue culturing. 2 duplicate wells were set per virus.

(3) The virus supernatants were collected 6h, 12h, 24h, 36h, 48h and 60h after virus infection, respectively, and stored at-80℃for further use.

(4) The collected virus solution was subjected to 10-fold gradient dilution with DMEM medium containing 1. Mu.g/mL pancreatin, LLC-PK1 cells spread in 96-well plates were washed 2 times with PBS, diluted virus solution was added to 96-well plates, 100. Mu.L was added to each well, and 4 multiplex wells were set for each dilution. Lesions were observed daily, and indirect immunofluorescence detection was performed 72h post infection, and TCID was calculated using the Reed-Muench method ₅₀ And a growth curve of the virus is drawn. The results of the growth kinetics curves show that rPDCoV and PDCoV can both grow on LLC-PK1 cells, and the titer of the rPDCoV and the PDCoV reaches the highest value at 48h (10) ^7.5 TCID ₅₀ /ml) with similar replication capacity and growth characteristics (fig. 6D). rPDCoV-NS6-GFP has similar growth characteristics to rPDCoV, and the toxicity rates reach the highest value within 48 hours; the highest titer was reduced by about 21g for rPDCoV-Nluc/NS6 compared to rPDCoV (FIG. 8C).

Claims

1. A method for constructing a recombinant porcine epidemic diarrhea virus infectious clone, which is characterized by comprising the following steps:

2. The method according to claim 1, wherein the target gene 1 comprises an Nluc gene or an RFP gene; the target gene 2 comprises GFP-P2A gene.

3. The method for constructing recombinant porcine epidemic diarrhea virus infectious clone according to claim 1 or 2, wherein step 1) specifically comprises the steps of:

4. The method for constructing a recombinant porcine epidemic diarrhea virus infectious clone according to claim 1, wherein the sequence of the homology arm downstream of PEDV-S gene and the homology arm downstream of PEDV-ORF3 gene or the homology arm upstream of PEDV-ORF3 gene is as shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO: 3.

5. The method of constructing a recombinant porcine epidemic diarrhea virus infectious clone according to claim 1, wherein the cleavage site comprises I-SceI, the resistance gene comprises Kan, or other resistance genes different from the infectious clone plasmid resistance.

6. The method for constructing a recombinant porcine epidemic diarrhea virus infectious clone according to claim 1, wherein step 3) specifically comprises the steps of:

3.4 Placing the bacterial liquid in the step 3.3) in a shaking table at 30-32 ℃ for continuous culture for 3-4 hours, taking the bacterial liquid for dilution, taking the diluted bacterial liquid for coating on an LB plate containing 1% of L-arabinose and chloramphenicol resistance, and after the bacterial liquid is fully absorbed, inversely culturing in a bacterial incubator at 30-32 ℃ for about 24 hours;

3.5 Picking the single colony obtained in the step 3.4), respectively spot-plating the single colony on a LB plate containing chloramphenicol resistance and kanamycin resistance, wherein the single colony does not grow in the kanamycin resistance LB solid medium, the colony growing in the chloramphenicol LB solid medium is a colony with successful recombination, and the obtained positive clone is obtained.

7. PEDV infectious clone expressing a gene of interest obtained by the construction method of any one of claims 1 to 6.

8. Use of PEDV infectious clone expressing a gene of interest according to claim 7 in the preparation of a medicament for preventing or treating porcine epidemic diarrhea.

9. Use of PEDV infectious clone expressing a gene of interest according to claim 7 in the preparation of PEDV vaccine.