CN108486108B - Cell strain for knocking out human HMGB1 gene and application thereof - Google Patents

Abstract

The invention discloses a cell strain for knocking out human HMGB1 gene and application thereof, belonging to the field of molecular biology. The invention provides a gRNA sequence for targeted knockout of a human HMGB1 gene, which has a nucleotide sequence shown as SEQ ID NO: 1 is shown. The HMGB1 gene is knocked out on a human Huh7 cell genome for the first time by using a CRISPR-Cas9 technology, so that the expression of HMGB1 protein is completely lost, a Huh7 cell strain knocked out by HMGB1 is obtained, and the knocked-out cell strain has no obvious difference in the aspects of morphology, growth speed and the like from a control cell, and is an ideal HMGB1 knocked-out cell model; the method is simple and convenient to operate, short in period and low in cost, the modified cell strain is stable, and the method can be used for researching the specific action mechanism of the HMGB1 protein in the aspects of autophagy, apoptosis, cell inflammation, virus infection and the like. The cell strain obtained by the invention can obviously enhance the infection of Japanese encephalitis virus strains.

Description

Cell strain for knocking out human HMGB1 gene and application thereof

Technical Field

The invention belongs to the field of molecular biology, and relates to a cell strain for knocking out human HMGB1 gene and application thereof.

Background

CRISPR (clustered regular interspersed short palindromic repeats) is a unique immune system which is evolved by bacteria in order to eliminate foreign invasion genes of viruses, and by using the CRISPR system, the bacteria can cut off virus genes from own chromosomes. In recent years, scientists have analyzed the key protein of this system (Cas9) from bacteria and have mastered the technique for manipulating this key protein. The complex with the key protein as the core can be directed to search for a target DNA sequence under the guidance of a section of RNA, and then edit the DNA to disturb the gene or insert a desired sequence. The CRISPR method is faster than zinc finger nucleases and other editing tools, can quickly trim, cut, replace or add biological DNA sequences, and has the advantages of simple operation and low cost.

High-mobility group proteins (HMG proteins), which are widely present in eukaryotic cells, are known for their high mobility in polypropylene gel electrophoresis. HMG (human growth factor) proteins are the motivators for gene regulation of eukaryotic cells, are a group of chromatin proteins with the most abundant content after histone in the eukaryotic cells, and play an important role in the structure and function of chromatin and the regulation and control process of gene expression. The HMG protein family can be divided into three subfamilies, HMGA, HMGB and HMGN. High mobility group box1 (HMGB 1) belongs to the HMGB protein subfamily, is a DNA-binding protein, and is present in the nucleus and cytoplasm. In the nucleus, HMGB1 participates in various functions such as DNA replication, repair, recombination, transcription, and maintenance of genome stability. Extracellular HMGB1 plays an important role in inflammation, immunity, cell growth, proliferation, and death. Besides the nuclear and extracellular functions, HMGB1 in the cytoplasm can bind to a variety of proteins, be involved in autophagy, cancer progression, and possibly also in non-traditional secretory pathways. Macrophages and monocytes can actively release HMGB1 when infected by external bacteria (endotoxin or intrinsic inflammatory factors, etc.); whereas necrotic or injured cells passively release HMGB1 due to cell lysis or the like.

Disclosure of Invention

In order to overcome the defects of the prior art, the primary object of the invention is to provide a gRNA sequence for targeted knockout of the human HMGB1 gene.

Another objective of the invention is to provide a CRISPR/Cas9 lentivirus system for targeted knockout of human HMGB1 gene.

The invention also aims to provide application of the CRISPR/Cas9 lentivirus system for targeted knockout of the human HMGB1 gene.

The invention also aims to provide a cell line with a knocked-out human HMGB1 gene.

The invention further aims to provide application of the cell line with the human HMGB1 gene knocked-out.

The purpose of the invention is realized by the following technical scheme:

the invention provides a gRNA sequence for targeted knockout of a human HMGB1 gene, which has the nucleotide sequence as follows: 5'-GAGTATCGCCCAAAAATCAA-3', SEQ ID NO: 1; which is located in SEQ ID NO: bits 322-341 shown in FIG. 4.

A CRISPR/Cas9 lentivirus system for targeted knockout of a human HMGB1 gene contains a gRNA sequence for targeted knockout of the human HMGB1 gene.

The construction method of the CRISPR/Cas9 lentivirus system for targeted knockout of the human HMGB1 gene comprises the following steps:

(1) designing gHMGB1-F and gHMGB1-R according to the gRNA sequence of the targeted knockout human HMGB1 gene, and annealing and phosphorylating the gHMGB1-F and the gHMGB1-R to form a fragment gHMGB1 containing a sticky end;

(2) digesting a CRISPR/Cas9 lentiviral vector LentiCRISPRV2 by BsmBI enzyme to obtain a digested LentiCRISPRV2 vector;

(3) and (2) connecting the gHMGB1 obtained in the step (1) with a LentiCRISPRRv 2 vector subjected to enzyme digestion to obtain a CRISPR/Cas9 lentivirus system of a targeted knockout human HMGB1 gene, and naming the system as LentiCRISPRRv 2-HMGB 1.

gHMGB1-F：5′-caccgGAGTATCGCCCAAAAATCAA-3′，

gHMGB1-R：5′-aaacTTGATTTTTGGGCGATACTCc-3′；

The CRISPR/Cas9 lentivirus system for targeted knockout of the human HMGB1 gene is applied to preparation of cell strains for knockout of the human HMGB1 gene. Preferably, the application in preparing the human Huh7 cell line of which the human HMGB1 gene is knocked out.

A cell strain for knocking out a human HMGB1 gene is obtained by transfecting a target cell strain with the CRISPR/Cas9 lentivirus system for targeted knocking out the human HMGB1 gene. The cell strain is a cell strain with a silent HMGB1 gene, namely the cell strain does not express HMGB1 protein at all.

A cell strain with a human HMGB1 gene knocked out is constructed by the following steps:

(1) packaging the CRISPR/Cas9 lentivirus system with the human HMGB1 gene knocked out in a targeted manner through packaging cells to obtain lentivirus particles;

(2) infecting a target cell strain with the lentivirus particles to obtain a cell strain with a human HMGB1 gene knocked out.

Preferably, the target cell line is human Huh7 cell line.

The method specifically comprises the following steps:

1) packaging of Lentiviral particles on 293T cells

293T cells were transfected, and the lentiviral packaging plasmid LentiCRISPRV2-HMGB 1: psPAX 2: pmd2.g ═ 2: 2: 1, collecting 293T packaged lentivirus supernatant, and centrifuging to obtain suspension containing lentivirus particles;

2) infection of Huh7 cells with lentivirus

Infection of Huh7 cells, DMEM complete medium volume: and (3) the volume ratio of the suspension containing the slow virus particle is 1-3: 1; preferably, the ratio of 2: 1;

3) puromycin screening knockout cell line

Inoculating the collected lentivirus into Huh7 cells, culturing for 24h, adding puromycin with effective concentration, and continuously culturing until the cells are full and then subcultured; continuously screening passage cells by utilizing puromycin, replacing culture solution once for 2 days, and screening for 3-5 generations; after identification, a human Huh7 cell strain with a human HMGB1 gene knocked out is obtained.

In the step 3), the concentration of puromycin added according to the sensitivity of the Huh7 cells is 1-2 mug/mL; preferably 1.5. mu.g/mL.

The cell strain with the human HMGB1 gene knocked out is applied to virus proliferation.

The virus is Japanese encephalitis virus.

The cell strain with the human HMGB1 gene knocked out is applied to Japanese encephalitis research.

The SA14 strain of encephalitis B virus can be proliferated in large quantity on the cell strain, and after the cell strain is infected with the SA14 strain of encephalitis B virus, compared with a normal cell strain, the TC of the cell strainID₅₀Is remarkably increased.

The Japanese encephalitis is epidemic encephalitis B (Japanese encephalitis, abbreviated as Japanese encephalitis).

The mechanism of the invention is as follows:

huh7 is a subculture cell strain of human liver cancer, and the HMGB1 gene is knocked out in a Huh7 cell by using a CRISPR/Cas9 system to enable the HMGB1 gene to lose the expression of the protein, so that the Huh7 is used for researching the specific action mechanism of the HMGB1 protein in the aspects of autophagy, apoptosis, cell inflammation, virus infection and the like. The Huh7 cell strain knocked out by HMGB1 is not reported before, the cell knocked-out cell strain screened by the invention can be stably passaged, and the cell knocked-out cell strain has no obvious difference from a control cell in aspects of cell morphology, growth speed and the like, and can be used as an ideal cell model. The human Huh7 cell strain with the HMGB1 gene knocked out disclosed by the invention is proved to be capable of obviously enhancing the infection of a Japanese encephalitis virus SA14 strain.

Compared with the prior art, the invention has the following advantages and effects:

1) the HMGB1 gene is knocked out on a human Huh7 cell genome for the first time by using a CRISPR-Cas9 technology, so that the HMGB1 gene completely loses the expression of the protein, and a Huh7 cell strain knocked out by HMGB1 is obtained, and the cell strain is simple and convenient to operate, short in period, low in cost and stable after being modified and can be used for researching specific action mechanisms of the HMGB1 protein in the aspects of autophagy, apoptosis, cell inflammation, virus infection and the like;

2) detection on gene and protein levels shows that HMGB1 protein is knocked out, which indicates that the HMGB1 protein sequence is thoroughly changed, so that the function of HMGB1 is thoroughly lost, and the morphology, growth speed and other aspects of knocked-out cell strains have no obvious difference with those of control cells, so that the cell model is an ideal HMGB1 knocked-out cell model;

3) the encephalitis B virus can be proliferated on the cell strain in a large amount, and after the cell strain is infected with an encephalitis B virus strain, the TCID of the cell strain is compared with that of a normal cell strain₅₀The increase is remarkable; can obviously enhance the infection of encephalitis B virus strains.

Drawings

FIG. 1 is a map of the insertion of the desired fragment gHMGB1 into the LentiCRISPRV2 vector.

FIG. 2 is a diagram showing the sequencing result of the constructed LentiCRISPRV2-HMGB1 plasmid.

FIG. 3 is a graph of frame shift mutations caused by insertions and deletions in the sequencing of a knockout cell line.

Fig. 4 is a WB map of HMGB1 protein expression in knock-out and control cell lines.

FIG. 5 shows no significant difference in morphology between the knockout cell line and the control cell line.

FIG. 6 is the TCID measured by Japanese encephalitis SA14 strain infected knockout cell strain₅₀Significantly higher than the control cell line.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

Experimental procedures for the conditions not specified in the examples are generally performed according to conventional conditions, such as the Molecular Cloning Manual of experiments, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the manufacturer's instructions.

Example 1 construction of HMGB1 Gene knockout lentiviral particles

1) Construction of the LentiCRISPRV2-HMGB1 plasmid

Selecting a gRNA sequence of a target HMGB1 gene according to The genome-scale CRISPR knock-out (GeCKO) libraries: 5'-GAGTATCGCCCAAAAATCAA-3' are provided. The gRNA of the HMGB1 gene was cloned into LentiCRISPR rv2 (purchased from addge, cat #98290) according to LentiViral CRISPR Toolbox (FIG. 1), and the constructed plasmid was named LentiCRISPR rv2-HMGB 1. The coding sequence of the HMGB1 gene is shown as SEQ ID NO: 4, wherein the ratio of HMGB1 CDS: CCDS 9335.1.

Designing and synthesizing an upstream primer sequence and a downstream primer sequence according to the sequence characteristics of the connecting end of a LentiCRISPRV2 vector:

gHMGB1-F：5′-caccgGAGTATCGCCCAAAAATCAA-3′，

gHMGB1-R：5′-aaacTTGATTTTTGGGCGATACTCc-3′；

annealing and phosphorylation were performed according to a fixed procedure to form a sticky end-containing fragment gHMGB1(25 bp).

Annealing system (50 μ L):

components	Dosage of
		H2O	30μL
Annealing Buffer for DNA oligos(5×)	10μL
		gHMGB1-F	5μL
gHMGB1-R	5μL

And (3) annealing procedure: at 95 deg.C, 5min, one degree per minute to 25 deg.C.

The fragment gHMGB1 containing the sticky end is connected to a LentiCRISPRV2 vector cut by BsmBI enzyme, a connecting product is transformed into Stbl3 competent cells (the use of the Stbl3 competent cells is carried out according to a commercial instruction, Stbl3 is purchased from Beijing all-purpose gold biotechnology Co., Ltd., product number CD512-01) and cultured overnight at 37 ℃, bacterial liquid PCR electrophoresis is carried out to detect a plurality of positive clone bacteria, and a sequencing result shows that a target sequence is successfully connected into the vector (figure 2).

The correct positive clone was prepared as 1: inoculation with Amp at a ratio of 500⁺And (3) placing the resistant LB liquid culture medium in a shaker at 37 ℃, carrying out shaking culture for 14-16 h at 180r/min, and then carrying out endotoxin-removing Plasmid extraction according to the specification of E.Z.N.A.endo-free Plasmid Midi Kit II to obtain LentiCRISPRV2-HMGB1 Plasmid.

Enzyme digestion system (50 μ L):

components	Dosage of
		LentiCRISPRv2	2μg
BsmBI	2μL
		Buffer(10×)	5μL
H2O	to 50μL

The enzyme digestion reaction conditions are as follows: the enzyme was cleaved at 55 ℃ for 2 h.

Ligation system (20 μ L):

components	Dosage of
		Enzyme-digested vector	2μL
T4 ligase	2μL
		T4 Buffer	2μL
gHMGB1	14μL

The connection reaction conditions are as follows: ligation was performed overnight at 16 ℃.

2) Lentiviral particle packaging

293T cells (purchased from Shanghai Zhongji cell bank) were plated on 60mm cell culture dishes and 70-80% of the cells were grown for transfection. Cells were replaced with 1mL of pre-warmed serum-free medium (DMEM) prior to transfection. First, 6. mu.g of LentiCRISPRRv 2-HMGB1 expression vector plasmid was mixed with 6. mu.g of psPAX2 (purchased from adddge, cat #12260) and 3. mu.g of pMD2.G (purchased from adddge, cat #12259) helper plasmid in 1mL of DMEM. Then, 100. mu.M stock of PEI (polyethyleneimine) was diluted to 10. mu.M with HBS (prepared HBS Balanced Salt Solution) and mixed well. Then, 100 mu L of diluted 10 mu M PEI solution is added into the DMEM containing the plasmids, and the DMEM is fully mixed uniformly and then is kept stand for 5-10 min at room temperature. Finally, the mixture was added dropwise to 293T cells to be transfected, mixed by gently shaking the culture dish, and placed in a medium containing 5% CO₂And incubated in an incubator at 37 ℃. After 3h, it was replaced with 4mL of DMEM preheated at 37 ℃. Culturing for 48h, collecting cell culture solution containing lentivirus, centrifuging at 7000r/min and 4 deg.C for 15min, and collecting supernatant as suspension containing lentivirus particles.

Example 2 infection of lentiviral particles with Huh7 and selection of cell lines

1) Determination of the optimal effective concentration of Puromycin (Puromycin)

Huh7 cells (purchased from Shanghai Zhongkojie cell Bank) 2 × 10⁵Each/mL of the culture medium was inoculated into a 12-well plate, and after 24 hours of culture, puromycin was replaced with fresh serum-free medium solutions having concentrations of 0, 0.3, 0.6, 0.9, 1.2, 1.5, 1.8, and 2.1. mu.g/mL in each well. Observing cell viability every day, and replacing puromycin-containing fresh non-antibiotic bloodless medium every two days according to cell viabilityThe medium solution was cleared once. The concentration capable of killing all cells within 3-5 days is selected as the optimal effective concentration. The optimal effective concentration of this experiment on Huh7 cells was 1.5. mu.g/mL.

2) Lentiviral particle infection Huh7 selection cell line

The lentiviral particles collected in example 1 were inoculated into Huh7 cells, cultured for 24h, added with puromycin with the optimal effective concentration of 1.5. mu.g/mL, and cultured until the cells are full and then passaged. And continuously screening the subculture cells by using puromycin, replacing the culture solution once in 2 days, and screening for 3-5 generations.

Example 3 identification of HMGB1 Gene knock-out cell lines

1) And (3) genomic DNA sequencing identification:

genomic DNA of cell lines was extracted according to the instructions of the E.Z.N.A Tissue DNA Kit. Primers are designed at the upstream and downstream of each 200-300 bp of a gene sequence region targeted by the gRNA, the fragment is amplified by PCR, and the fragment is cloned to pMD^TM19-TVector (Takara), positive plasmid was selected for sequencing by Weijie Jie (Shanghai) trade Co.

The sequence alignment result shows that the target site has frame shift mutation due to base insertion or deletion (FIG. 3). Cell line 1, cell line 2, and cell line 3; wherein, the cell line 1 has 5 base deletions on the targeted knockout site of the wild HMGB1 gene; the cell line 2 is formed by inserting 1 base in a targeted knockout site of a wild HMGB1 gene; cell line 3 had 6 base deletions at the targeted knock-out site of the wild-type HMGB1 gene.

The specific knockout sites of the HMGB1 gene are as follows, and the following sequences correspond in sequence: wild type, cell line 1, cell line 2, cell line 3:

TGCTCTGAGTATCGCCCAAAAATCAAAGGAGA；

TGCTCTGAGTATCGCCCAAAAA-----GGAGA；

TGCTCTGAGTATCGCCCAAAAATTCAAAGGAGA；

TGCTCTGAGTATCGCCCAAAAA-------GAGA。

2) western Blot (WB) verifies the gene protein knockout effect:

firstly, protein glue preparation: and cleaning and airing the glass plate, clamping the glass plate in a clamp, and vertically clamping the glass plate on a frame for glue pouring. Preparing 10% or 15% of separation glue according to the proportion in the table 1, adding TEMED (tetramethylethylenediamine), immediately shaking and pouring the glue, and obtaining the glue surface reaching the middle line height of the green belt; and adding isopropanol to the gel and sealing. After the separation gel was sufficiently solidified, the isopropanol on the gel was poured off and blotted dry with filter paper. 5% of concentrated glue is prepared according to the table 2, and is immediately shaken and glue filled after TEMED is added; after the rest space is filled with the concentrated glue, the comb is inserted into the concentrated glue, and after the concentrated glue is solidified, the comb is slightly pulled out. Sealing and storing in a refrigerator at 4 deg.C.

TABLE 1 Release glue formulation

Components	10％(5mL)	15％(5mL)
			H2O	1.9mL	1.1mL
30% acrylamide	1.7mL	2.5mL
			1.5M Tris-HCl(pH8.8)	1.3mL	1.3mL
10％SDS	50μL	50μL
			10% ammonium persulfate	50μL	50μL
TMEMD	2μL	2μL

TABLE 2 concentrated gum formulation

Components	5％(3mL)
		H2O	2.1mL
30% acrylamide	0.5mL
		1.5M Tris-HCl(PH6.8)	380μL
10％SDS	30μL
		10% ammonium persulfate	30μL
TMEMD	3μL

Sample loading and electrophoresis: after the albumin glue is clamped and placed in the electrophoresis tank, 1 xSDS-PAGE electrophoresis buffer is added into the electrophoresis tank, and 5 μ L Protein Ladder and 20 μ L Protein sample are sequentially added into the loading hole of the albumin glue. The devices were correctly connected, and 80V electrophoresis was performed for 30min and 120V electrophoresis for 60 min. And stopping electrophoresis until the bromophenol blue just runs out of the protein gel, and performing membrane transfer.

③ transferring the film: cutting NC membrane and filter paper according to the size of the protein glue, and soaking in the membrane transferring solution for balancing for 10 min. The transfer clamp is tightly fastened and placed in a film transfer instrument in a correct direction according to the sequence of three layers of filter paper, protein glue, an NC film and three layers of filter paper, namely the protein glue is positioned at the negative electrode, and the NC film is positioned at the positive electrode. The film rotating instrument was placed on ice and rotated at 200mA constant current for 55 min.

④ immunoblotting, taking out NC membrane, washing NC membrane with TBST buffer solution, adding 5% skimmed milk powder in a closed solution, sealing at 4 deg.C for 2h overnight, discarding the closed solution, washing NC membrane with TBST buffer solution for three times (10 min each time), adding diluted primary antibody (HMGB1 rabbit polyclonal antibody from Abcam, cat # ab 18256; β -Actin rabbit polyclonal antibody from Hoffmann gold Co., cat # HC201-01), incubating at room temperature for 2h or 4 deg.C overnight, recovering primary antibody, washing NC membrane with TBST buffer solution for three times (10 min each time), adding 1: 10000 diluted fluorescent secondary antibody of goat anti-mouse (fluorescent secondary antibody) (1: (10000))

800CWGOAT Anti-RABBIT IgG (H + L) was purchased from LICOR Chemicals Inc.), and incubated at room temperature for 1H. Secondary antibody was recovered and NC membranes were washed three times with TBST buffer for 10min each time. NC film imaging was scanned using an Odyssey two-color infrared laser imaging system.

The cells were lysed with the lysate of Byunnan, the cell lysate of the cell line was collected, and the detection result showed that the expression of HMGB1 protein was completely knocked out (FIG. 4). In FIG. 4, KO-HMGB1 represents a HMGB1 knock-out cell line.

Example 4 cell morphology observation of HMGB1 Gene knock-out cell line

No significant morphological difference was observed between the HMGB1 knockout cell line (KO-HMGB1) and the Huh7 normal cell line during simultaneous serial passages (FIG. 5). After serial passage, the expression of HMGB1 protein of the cells is detected and the genome of the cell is sequenced, and the constructed cell strain is found to be very stable. As can be imagined, the knockout cell strain has a wide application prospect.

Example 5 functional verification of HMGB1 Gene knockout cell line on Japanese encephalitis

The HMGB1 gene knockout cell strain (KO-HMGB1) and the Huh7 normal cell strain are respectively inoculated in a 12-well plate, and after 24 hours, the Japanese encephalitis virus SA14 strain with the virus amount of 0.1MOI (the SA14 strain is disclosed in the literature "biology of a neurovirulence Japanese encephalitis virus strain and molecular characteristics thereof. Virol. 2010,4(26), 265-one 270") is inoculated. After the virus inoculation for 48h, cell supernatants were collected and stored in a refrigerator at-80 ℃.

Inoculating the virus supernatant into a 96-well plate of 70-80% BHK-21 (purchased from Shanghai department cell bank) single-layer cells, discarding DMEM after 48h, washing twice with PBS buffer solution, adding 50 mu L of precooled methanol into each well, and standing at-20 ℃ for 30 min; discarding methanol, washing with PBS buffer solution for three times, adding 50 μ L primary antibody (JEV NS1 protein monoclonal antibody, custom-made from Ebimatol biological medicine Co., Ltd.) into each well, and incubating at 37 deg.C for 1 h; discarding the primary antibody, washing with PBS buffer solution for three times, adding 50 μ L of HRP-coupled secondary antibody (Goat Anti-Mouse horseradish peroxidase Affinipure Goat Anti-Mouse IgG (H + L), cat # 115-035-003), and incubating at 37 deg.C for 30 min; discarding the secondary antibody, washing with PBS buffer solution for three times, adding 50 μ L of AEC color development working solution, and incubating at 37 deg.C in dark for 30 min; after the color development was completed, the developing solution was discarded, and the membrane was washed twice with PBS buffer. Observing the staining condition of the cells under a microscope (encephalitis B virus does not enter nucleus), counting and calculating TCID₅₀。

The results showed that virus titer was significantly increased in the knockout cell line (fig. 6), indicating that japanese encephalitis virus was able to proliferate in large amounts in this cell line.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> cell strain for knocking out human HMGB1 gene and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> gRNA sequence for targeted knockout of human HMGB1 gene

<400>1

gagtatcgcc caaaaatcaa 20

<210>2

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>gHMGB1-F

<400>2

caccggagta tcgcccaaaa atcaa 25

<210>3

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223>gHMGB1-R

<400>3

aaacttgatt tttgggcgatactcc 25

<210>4

<211>648

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> coding sequence of HMGB1 gene

<400>4

atgggcaaag gagatcctaa gaagccgaga ggcaaaatgt catcatatgc attttttgtg 60

caaacttgtc gggaggagca taagaagaag cacccagatg cttcagtcaa cttctcagag 120

ttttctaaga agtgctcaga gaggtggaag accatgtctg ctaaagagaa aggaaaattt 180

gaagatatgg caaaagcgga caaggcccgt tatgaaagag aaatgaaaac ctatatccct 240

cccaaagggg agacaaaaaa gaagttcaag gatcccaatg cacccaagag gcctccttcg 300

gccttcttcc tcttctgctc tgagtatcgc ccaaaaatca aaggagaaca tcctggcctg 360

tccattggtg atgttgcgaa gaaactggga gagatgtgga ataacactgc tgcagatgac 420

aagcagcctt atgaaaagaa ggctgcgaag ctgaaggaaa aatatgaaaa ggatattgct 480

gcatatcgag ctaaaggaaa gcctgatgca gcaaaaaagg gagttgtcaa ggctgaaaaa 540

agcaagaaaa agaaggaaga ggaggaagat gaggaagatg aagaggatga ggaggaggag 600

gaagatgaag aagatgaaga tgaagaagaa gatgatgatg atgaataa 648

Claims (4)

1. An application of a cell strain with a human HMGB1 gene knocked-out in the proliferation of encephalitis B virus is characterized in that: the cell strain is human Huh7 cell strain.

2. Use according to claim 1, characterized in that: the cell strain for knocking out the human HMGB1 gene is obtained by transfecting a CRISPR/Cas9 lentivirus system for targeted knocking out the human HMGB1 gene into a target cell strain;

the CRISPR/Cas9 lentivirus system for targeted knockout of the human HMGB1 gene contains a gRNA sequence for targeted knockout of the human HMGB1 gene;

the gRNA sequence of the targeted knockout human HMGB1 gene is as follows: 5'-GAGTATCGCCCAAAAATCAA-3' are provided.

3. Use according to claim 2, characterized in that:

the construction method of the cell strain for knocking out the human HMGB1 gene comprises the following steps:

(1) packaging the CRISPR/Cas9 lentivirus system of the targeted knockout human HMGB1 gene by packaging cells to obtain lentivirus particles;

(2) infecting a target cell strain with the lentivirus particles to obtain a cell strain with a human HMGB1 gene knocked out.

4. Use according to claim 2, characterized in that:

the construction method of the CRISPR/Cas9 lentivirus system for targeted knockout of the human HMGB1 gene comprises the following steps:

(1) designing gHMGB1-F and gHMGB1-R according to the gRNA sequence of the targeted knockout human HMGB1 gene, and annealing and phosphorylating the gHMGB1-F and the gHMGB1-R to form a fragment gHMGB1 containing a sticky end;

gHMGB1-F：5′-caccgGAGTATCGCCCAAAAATCAA-3′，

gHMGB1-R：5′-aaacTTGATTTTTGGGCGATACTCc-3′；

(2) digesting a CRISPR/Cas9 lentiviral vector LentiCRISPRV2 by BsmBI enzyme to obtain a digested LentiCRISPRV2 vector;

(3) and (2) connecting the gHMGB1 obtained in the step (1) with a LentiCRISPRRv 2 vector subjected to enzyme digestion to obtain a CRISPR/Cas9 lentivirus system of a targeted knockout human HMGB1 gene, and naming the system as LentiCRISPRRv 2-HMGB 1.

Images