CN116445463A

CN116445463A - Novel plant base editor pAYBEs

Info

Publication number: CN116445463A
Application number: CN202310577566.XA
Authority: CN
Inventors: 夏兰琴; 李玉才; 李少雅; 林勇; 张阳军
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2023-05-22
Filing date: 2023-05-22
Publication date: 2023-07-18

Abstract

The invention discloses a novel plant base editor pAYBEs. The invention establishes a first generation A-to-Y single base editing system pAYBEv1 in a plant by fusing an adenine base editor with hMPG, further establishes a second generation A-to-Y single base editing system pAYBEv2 by replacing hMPG with mhMPG, and establishes a third generation single base editing system pAYBEv3 and a fourth generation single base editing system pAYBEv4 by respectively fusing a transactivating factor Vp64 at the N end of TadA8e-nCas9 (D10A) in pAYBEv1 and pAYBEv 2. The plant AYBE single-base editing system constructed by the invention not only enriches a plant single-base editing tool box, but also provides important technical support for functional analysis and genetic improvement of important genes of rice and other crops.

Description

Novel plant base editor pAYBEs

Technical Field

The invention belongs to the field of molecular breeding, in particular to a novel plant base editor pAYBEs, and particularly relates to a plant A-to-Y single base editor pAYBEs capable of realizing the conversion of single base in a plant genome from adenine (A) to cytosine (C) or thymine (T) and application thereof.

Background

Many important agronomic traits in plants are caused by one or a few base changes in the genomic sequence. The Cytosine Base Editor (CBE) and the Adenine Base Editor (ABE) can each effect a single base transition from cytosine (C) to thymine (T), adenine (a) to guanine (G) within an edit window. At present, cytosine base editors and adenine base editors have been widely used for functional verification of important genes of crops and improvement of crops. In addition, the use of uracil DNA glycosylase to replace uracil glycosylase inhibitor genes has also developed CGBE technology that can effect the conversion of cytosine (C) to guanine (G) and has been used in plants.

Recently, on the basis of an adenine base editor, a human alkyl adenine DNA glycosylase (hMPG) was added, an ababe system suitable for animal cells was developed, and single base transversions of adenine (a) to Y (y=cytosine C or thymine T) in a target sequence could be achieved in animal cell lines. Specifically, a human alkyl adenine DNA glycosylase (hMPG) is fused with an adenine editor, adenine deamination is induced at a target site to form inosine, then under the action of the glycosylase, the inosine is removed to generate an AP site (Apurinic site), and after genome mismatch repair, a transversion of adenine (A) to cytosine (C) or thymine (T) is achieved (FIG. 1). Development of plant AYBE system (pAYBE) will greatly expand the application range and potential of base editing in functional analysis and genetic improvement of crop genes. However, there is currently no report or literature on the plant AYBE system in plants.

Disclosure of Invention

The technical problem to be solved by the present invention is how to achieve single base transversion of adenine (a) to Y (y=cytosine C or thymine T) in a target sequence in plants.

In order to solve the technical problems, the invention firstly provides a complete system.

The complete system is any one of the following M1) -M4):

m1) the kit comprises adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, human alkyl adenine DNA glycosylase hMPG and gRNA;

m2) the kit comprises adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and gRNA;

m3) the kit comprises transactivator Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase, human alkyl adenine DNA glycosylase hMPG and gRNA;

m4) the kit comprises transactivator Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase, a seven-mutation variant of human alkyl adenine DNA glycosylase mhMPG and gRNA;

the seven-mutation variant mhMPG of the human alkyl adenine DNA glycosylase is a protein obtained by mutating the 163 th position of the amino acid sequence of the human alkyl adenine DNA glycosylase hMPG from glycine to arginine, mutating the 169 th position from asparagine to serine, mutating the 198 th position from serine to alanine, mutating the 202 st position from lysine to alanine, mutating the 203 th position from glycine to alanine, mutating the 206 th position from serine to alanine, and mutating the 210 th position from lysine to alanine.

In the above-described kit, the adenine deaminase TadA8e is A1) or A2):

a1 Amino acid sequence is a protein shown in sequence 2;

a2 A protein having the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 2.

The coding gene of the adenine deaminase TadA8e is a 1) or a 2):

a1 A DNA molecule shown in positions 2062-2559 of SEQ ID NO. 1;

a2 A DNA molecule which has 75% or more identity to the nucleotide sequence defined in a 1) and which encodes said adenine deaminase TadA8 e.

The Cas9 (D10A) nickase is B1) or B2):

b1 Amino acid sequence is a protein shown in sequence 3;

b2 A protein having the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 3.

The coding gene of the Cas9 (D10A) nickase is b 1) or b 2):

b1 A DNA molecule shown in positions 2656-6756 of SEQ ID NO. 1;

b2 A DNA molecule having 75% or more identity to the nucleotide sequence defined in b 1) and encoding the Cas9 (D10A) nickase.

The human alkyl adenine DNA glycosylase hMPG is C1) or C2):

c1 Amino acid sequence is a protein shown in sequence 6;

C2 A protein having the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 6.

The coding gene of the human alkyl adenine DNA glycosylase hMPG is c 1) or c 2):

c1 A DNA molecule shown in SEQ ID No. 7;

c2 A DNA molecule which has 75% or more identity with the nucleotide sequence defined in c 1) and which encodes said human alkyl adenine DNA glycosylase hMPG.

The transactivator Vp64 is D1) or D2):

d1 Amino acid sequence is a protein shown in sequence 9;

d2 A protein having the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 9.

The coding gene of the transactivator Vp64 is d 1) or d 2):

d1 A DNA molecule shown in positions 1 to 150 of sequence 8;

d2 A DNA molecule having 75% or more identity to the nucleotide sequence defined in d 1) and encoding said transactivator Vp 64.

The gRNA targets the target sequence; the gRNA sequentially comprises RNA transcribed from the target sequence and a gRNA skeleton, wherein the gRNA skeleton is an RNA molecule obtained by replacing T in 7854-7929 th site of the sequence 1 with U.

Among the above-mentioned complete systems, the complete system of M1) comprises a fusion protein and gRNA which are formed by fusing adenine deaminase TadA8e, cas9 (D10A) nickase and human alkyl adenine DNA glycosylase hMPG in sequence;

the complete system in M2) comprises fusion protein and gRNA which are formed by fusing adenine deaminase TadA8e, cas9 (D10A) nicking enzyme and human alkyl adenine DNA glycosylase seven-mutation variant mhMPG in sequence;

the complete system in M3) comprises fusion protein and gRNA which are formed by fusing transactivating factor Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase and human alkyl adenine DNA glycosylase hMPG in sequence;

the complete system in M4) comprises fusion protein and gRNA which are formed by fusing transactivator Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase and human alkyl adenine DNA glycosylase seven-mutation variant mhMPG in sequence.

Further, the complete system of M1) comprises a fusion protein and gRNA which are formed by fusing a nuclear localization signal, adenine deaminase TadA8e, cas9 (D10A) nickase, human alkyl adenine DNA glycosylase hMPG and a nuclear localization signal in sequence;

the complete system in M2) comprises a fusion protein and gRNA which are formed by fusing a nuclear localization signal, adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and a nuclear localization signal in sequence;

The complete system in M3) comprises a fusion protein and gRNA which are formed by fusing a nuclear localization signal, a transactivation factor Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase, a human alkyl adenine DNA glycosylase hMPG and a nuclear localization signal in sequence;

the complete system in M4) comprises fusion protein and gRNA which are formed by fusing a nuclear localization signal, a transactivation factor Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and the nuclear localization signal in sequence.

Still further, the kit further comprises a screening agent resistance protein. The screening agent resistance protein may be various resistance proteins known in the art, such as kanamycin resistance protein, herbicide resistance protein, phosphomannose isomerase, etc.

The complete system of M1) comprises a fusion protein, gRNA and a screening agent resistance protein, wherein the fusion protein is formed by fusing a nuclear localization signal, adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, human alkyl adenine DNA glycosylase hMPG and the nuclear localization signal in sequence;

the complete system in M2) comprises a fusion protein, gRNA and a screening agent resistance protein, wherein the fusion protein is formed by fusing a nuclear localization signal, adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and the nuclear localization signal in sequence;

The complete system in M3) comprises a fusion protein, gRNA and a screening agent resistance protein which are formed by fusing a nuclear localization signal, a transactivating factor Vp64, adenine deaminase TadA8e, cas9 (D10A) notch enzyme, human alkyl adenine DNA glycosylase hMPG and a nuclear localization signal in sequence;

the complete system in M4) comprises a fusion protein, gRNA and a screening agent resistance protein, wherein the fusion protein is formed by fusing a nuclear localization signal, a transactivation factor Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and the nuclear localization signal in sequence.

In one embodiment of the invention, the screening agent resistance protein is hygromycin phosphotransferase; the hygromycin phosphotransferase is E1) or E2):

e1 Amino acid sequence is a protein shown in sequence 4;

e2 A protein having the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 4.

The coding gene of hygromycin phosphotransferase is e 1) or e 2):

e1 A DNA molecule shown in the 9018-10043 positions of the sequence 1;

e2 A DNA molecule which has 75% or more identity to the nucleotide sequence defined in e 1) and which encodes said hygromycin phosphotransferase.

The nuclear localization signal is a nuclear localization signal NLS. The nuclear localization signal NLS is F1) or F2):

f1 Amino acid sequence is a protein shown in sequence 10;

f2 A protein having the same function and obtained by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 10.

The coding genes of the nuclear localization signal NLS are f 1) or f 2):

f1 A DNA molecule shown in 2017-2037 of sequence 1;

f2 A DNA molecule having 75% or more identity to the nucleotide sequence defined in f 1) and encoding said nuclear localization signal NLS.

In any of the above proteins, the substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues or a substitution and/or deletion and/or addition of not more than 9 amino acid residues or a substitution and/or deletion and/or addition of not more than 8 amino acid residues or a substitution and/or deletion and/or addition of not more than 7 amino acid residues or a substitution and/or deletion and/or addition of not more than 6 amino acid residues or a substitution and/or deletion and/or addition of not more than 5 amino acid residues or a substitution and/or deletion and/or addition of not more than 4 amino acid residues or a substitution and/or deletion and/or addition of not more than 3 amino acid residues or a substitution and/or deletion and/or addition of not more than 2 amino acid residues or a substitution and/or deletion and/or addition of not more than 1 amino acid residue.

Any of the above proteins may be synthesized artificially or may be obtained by synthesizing the gene encoding the protein and then biologically expressing the protein.

The identity in any of the above coding genes refers to sequence similarity to the native nucleic acid sequence. The identity includes a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequences shown in the coding sequences 2, 3, 4, 6, 9 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to evaluate the identity between related sequences.

Among the above-mentioned complete systems, the complete system of M1) comprises a fusion protein expression cassette, a gRNA expression cassette and a screening agent resistance protein expression cassette which are formed by fusing a nuclear localization signal, adenine deaminase TadA8e, cas9 (D10A) notch enzyme, human alkyl adenine DNA glycosylase hMPG and a nuclear localization signal in sequence;

The complete system in M2) comprises a fusion protein expression cassette, a gRNA expression cassette and a screening agent resistance protein expression cassette, wherein the fusion protein expression cassette is formed by fusing a nuclear localization signal, adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and a nuclear localization signal in sequence;

the complete system in M3) comprises a fusion protein expression box, a gRNA expression box and a screening agent resistance protein expression box, wherein the fusion protein expression box is formed by fusing a nuclear localization signal, a transactivating factor Vp64, adenine deaminase TadA8e, cas9 (D10A) notch enzyme, human alkyl adenine DNA glycosylase hMPG and a nuclear localization signal in sequence;

the complete system in M4) comprises a fusion protein expression cassette, a gRNA expression cassette and a screening agent resistance protein expression cassette, wherein the fusion protein expression cassette is formed by fusion of a nuclear localization signal, a transactivating factor Vp64, adenine deaminase TadA8e, cas9 (D10A) nickase, a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG and the nuclear localization signal in sequence.

Further, in the fusion protein expression cassette of the set system, the fusion protein is expressed driven by the Ubi promoter. The nucleotide sequence of the Ubi promoter is shown in the 1 st-1992 th of the sequence 1.

In the gRNA expression cassette of the set of systems, the gRNA was driven by the OsU3 promoter. The nucleotide sequence of the OsU promoter is shown in 7453-7833 of sequence 1.

In the screening marker protein expression cassette of the kit, the screening marker protein is expressed driven by a 35S promoter. The nucleotide sequence of the 35S promoter is shown in 8296-8973 of the sequence 1.

Still further, the kit is expressed by a recombinant vector. The individual elements or individual expression cassettes included in the kit may be expressed by the same vector or may be expressed by multiple vectors.

In a specific embodiment of the invention, the system set of M1) is expressed by recombinant vector pAYBEv1-hMPG-OsDEP1, recombinant vector pAYBEv1-hMPG-OsEPSPS, recombinant vector pAYBEv1-hMPG-OsNRT1.1B, recombinant vector pAYBEv 1-hMPG-Oswall-T1, recombinant vector pAYBEv 1-hMPG-Oswall-T2 or recombinant vector pAYBEv 1-hMPG-Oswall-T3 hereinafter.

The complete set of M2) is expressed by the recombinant vector pAYBEv2-mhMPG-OsDEP1, the recombinant vector pAYBEv2-mhMPG-OsEPSPS, the recombinant vector pAYBEv2-mhMPG-OsNRT1.1B, the recombinant vector pAYBEv 2-mhMPG-Oswall-T1, the recombinant vector pAYBEv 2-mhMPG-Oswall-T2 or the recombinant vector pAYBEv 2-mhMPG-Oswall-T3 hereinafter.

The complete set of M3) is expressed by the recombinant vector pAYBEv3-hMPG-VP64-OsDEP1, the recombinant vector pAYBEv3-hMPG-VP64-OsEPSPS, the recombinant vector pAYBEv3-hMPG-VP64-OsNRT1.1B, the recombinant vector pAYBEv3-hMPG-VP 64-Oswall-T1, the recombinant vector pAYBEv3-hMPG-VP 64-Oswall-T2 or the recombinant vector pAYBEv3-hMPG-VP 64-Oswall-T3 hereinafter.

The complete set of M4) is expressed by the recombinant vector pAYBEv4-mhMPG-VP64-OsDEP1, the recombinant vector pAYBEv4-mhMPG-VP64-OsEPSPS, the recombinant vector pAYBEv4-mhMPG-VP64-OsNRT1.1B, the recombinant vector pAYBEv4-mhMPG-VP 64-Oswall-T1, the recombinant vector pAYBEv4-mhMPG-VP 64-Oswall-T2 or the recombinant vector pAYBEv4-mhMPG-VP 64-Oswall-T3 described below.

In order to solve the technical problems, the invention also provides a new application of the complete system.

The invention provides the use of the above described kit in any one of the following S1) to S9):

s1) editing plant genome sequences;

s2) preparing an edited product of plant genome sequences;

s3) improving the editing efficiency of the plant genome sequence;

s4) preparing a product for improving the editing efficiency of the plant genome sequence;

s5) expanding an editing window of a plant genome sequence;

S6) preparing a product of an editing window for expanding plant genome sequences;

s7) preparing a plant mutant;

s8) plant breeding;

s9) preparing a plant breeding product.

In order to solve the technical problems, the invention also provides a method as any one of the following T1) to T4):

t1) editing method of plant genome sequence, comprising the following steps: allowing plants to express the complete set of systems so as to realize editing of plant genome sequences;

t2) a method for increasing the editing efficiency of a plant genome sequence, comprising the steps of: the plant expresses the complete system so as to improve the editing efficiency of the plant genome sequence;

t3) expanding the editing window of plant genomic sequences, comprising the steps of: enabling plants to express the complete system so as to realize the expansion of an editing window of plant genome sequences;

t4) a method for preparing a plant mutant, comprising the steps of: plants were allowed to express the above-described set of systems to obtain plant mutants.

In any of the methods described above, the method of expressing the plant in the kit is by introducing into the plant the individual elements or individual expression cassettes comprised in the kit.

Further, the individual elements or individual expression cassettes included in the kit may be introduced into the plant by the same vector or may be introduced into the plant by multiple vectors.

Further, the set of systems is introduced into plants via the same recombinant vector.

In a specific embodiment of the present invention, the complete system is prepared by the following recombinant vector pAYBEv1-hMPG-OsDEP1, recombinant vector pAYBEv1-hMPG-OsNRT1.1B, recombinant vector pAYBEv 1-hMPG-Oswall-T1, recombinant vector pAYBEv 1-hMPG-Oswall-T2, recombinant vector pAYBEv 1-hMPG-Oswall-T3, recombinant vector pAYBEv 2-mMPG-OsDEP 1, recombinant vector pAYBEv 2-mMPG-OsEPSPS, recombinant vector pAYBEv 2-mMPG-OsNRT1.1B, recombinant vector pAYBEv 2-mEPMPG-Oswall-T1, recombinant vector pAYBYBG 2-Oswall-T2, recombinant vector pABYBEv 2-mMPG-Oswall-T3, recombinant vector pAMhMPG-Oswall-3, recombinant vector pAN-OsWAP 64-HWAP 1, recombinant vector the recombinant vector pAYBEv3-hMPG-VP64-OsEPSPS, the recombinant vector pAYBEv3-hMPG-VP64-OsNRT1.1B, the recombinant vector pAYBEv3-hMPG-VP64-OsWaxy-T1, the recombinant vector pAYBEv3-hMPG-VP64-OsWaxy-T2, the recombinant vector pAYBEv3-hMPG-VP64-OsWaxy-T3, the recombinant vector pAYBEv4-mhMPG-VP64-OsDEP1, the recombinant vector pAYBEv4-mhMPG-VP64-OsEPSPS, the recombinant vector pAYBEv 4-mMPG-VP 64-OsNRT1.1B, the recombinant vector pAYBYBEv 4-mMPG-VP 64-OsWaxy-T2 or the recombinant vector pAYBWAEv 4-hWaxy-VP 64-OsWaxy-T3 is introduced into the plant.

In any of the above systems or applications or methods, the editing of the plant genomic sequence includes base substitutions (e.g., single base substitutions and small fragment substitutions), base insertions (e.g., single base insertions and small fragment insertions), and base deletions (e.g., single base deletions and small fragment deletions) of the plant genomic sequence. The single base substitutions include single base transitions (e.g., base A to base G) and single base transversions (e.g., base A to base C or base T).

In any of the above kits or uses or methods, the plant is X1) or X2) or X3):

x1) monocotyledonous or dicotyledonous plants;

x2) a gramineous plant;

x3) rice (e.g., zhonghua 11).

The invention designs and develops a series of novel plant single base editors pAYBEs. First, by fusing an adenine base editor TadA8e-nCas9 (D10A) with rice codon optimized hMPG, a first generation A-to-Y single base editing system pAYBEv1 is established in plants, the system consists of adenine deaminase TadA8e, nCas9 (D10A), human-derived alkyl adenine DNA glycosylase (hMPG) and genome-targeted guide RNA (gRNA), the adenine deaminase catalyzes and deaminates adenine (A) to produce hypoxanthine (I), and MPG protein can remove hypoxanthine to form abasic site AP site (Apurinc site) and repair DNA double chains through DNA polymerase mismatch, so that base A-to-Y base inversion is realized. In addition, the invention also establishes a second generation A-to-Y single base editing system pAYBev2 by replacing hMPG with an mhMPG mutant, and tests the single base editing efficiency of the A-to-Y mediated by the mhMPG. On the basis, the invention also fuses the transactivator Vp64 at the N end of TadA8e-nCas9 (D10A) -hMPG of the first generation pAYBEv1 system, establishes a third generation A-to-Y single base editing system pAYBEv3, and improves the single base editing efficiency of A-to-Y. Furthermore, a fourth generation A-to-Y single base editing system pAYBEv4 is established through the Vp64 coupling mhMPG mutant, and the A-to-Y base editing efficiency is further improved.

The invention also utilizes 6 different endogenous targets of rice to test the A-to-Y editing efficiency of plant pAYBE editors of different 4 generations. Protoplast test results show that pAYBEv2, pAYBEv3 and pAYBEv4 realize A-to-Y base transversions at 6 targets except that pAYBEv1 only generates A-to-C at one target. Compared with pAYBEv1, pAYBEv2, pAYBEv3 and pAYBEv4 have obviously improved editing efficiency respectively, wherein pAYBEv4 vector-mediated plant A-to-Y base editing efficiency is highest. Compared with pAYBEv1, pAYBEv2 and pAYBEv3, pAYBEv4 mediated plant A-to-C base editing efficiency can be improved by 9.78 times, 3.06-5.15 times and 1.27-5.67 times respectively, and the highest A-to-C editing efficiency can reach 4.40%. Compared with pAYBEv2 and pAYBEv3, the A-to-T base editing efficiency is improved by 1.97-3.18 times and 1.57-6.57 times respectively, and the highest A-to-T editing efficiency can reach 2.79 percent (tables 3-5). In addition, pAYBEv1, pAYBEv2 editing windows mainly occur at A5-A6 sites (FIG. 5), pAYBEv3, pAYBEv4 editing windows mainly occur at A5-A6, and different degrees of A-to-Y editing occur at A4 and A8 sites (FIG. 5), indicating that after VP64 is coupled, the pAYBE editing window can be expanded. In addition, pAYBEv1, pAYBEv2, pAYBEv3, pAYBEv4 can all generate accurate indel events. Furthermore, four different versions of pAYBEs all significantly improved A-to-G editing efficiency compared to the control pABE8e (FIG. 4, table 3-Table 6). The results show that pAYBEs, especially pAYBev4-mhMPG-VP64, can be used for directed evolution of important gene coding region or promoter region of crops besides single base editing of A-to-Y.

Further stable genetic transformation results show that pAYBEv1 realizes the A-to-Y base transversion only at the Oswall-T2 target with an efficiency of 2.02% (Table 9, table 10). pAYBEv3 achieved an A-to-T base transversion at the OsWaxy-T2 target with an efficiency of 2.53% (Table 9, table 10). Meanwhile, A-to-T base editing is realized at targets such as OsNRT1.1B, oswall-T1, oswall-T3 and the like, and the base editing efficiency is sequentially 1.32%, 1.54% and 9.46%. Compared with pAYBEv1, the A-to-T efficiency of pAYBEv3 in an Oswall-T2 target spot is improved by 1.25 times (2.53%/2.02%), and A-to-T base editing is realized for the first time in other three target spots. Similar to protoplast test results, pAYBEv4 had a better A-to-T editing efficiency in stable transformation than the other three base encoders (FIG. 7, FIG. 8, FIG. 9, FIG. 10, table 9, table 10). Besides the OsEPSPS target points, pAYBEv4 realizes the editing of the base A-to-T at the target points of OsDEP1, osNRT1.1B, oswall-T1, oswall-T2, oswall-T3 and the like, and the base editing efficiency is 10.98% (9/82), 2.22% (2/90), 4.23% (3/71), 8.54% (7/82) and 17.24% (10/58) in sequence. Compared with pAYBEv3, pAYBEv4 realizes A-to-T base editing on an OsDEP1 target for the first time, the A-to-T efficiency on an OsNRT1.1B target is improved by 1.68 times (2.22%/1.32%), the A-to-T efficiency on an Oswall-T1 target is improved by 2.75 times (4.23%/1.54%), the A-to-T efficiency on an Oswall-T2 target is improved by 3.38 times (8.54%/2.53%), and the A-to-T efficiency on an Oswall-T3 target is improved by 1.82 times (17.24%/9.46%). Based on the results of seedling genotype A-to-T, it was confirmed that A-to-T base editing occurred mainly at positions A5 and A6.

As can be seen from the results, four pAYBEs editors for editing the A-to-Y bases of rice are successfully designed, and the editing activities of pAYBEs of different versions are tested in rice protoplasts and stable transformation, so that the result shows that pAYBEv1 with hMPG has extremely low A-to-Y base editing activity, and pAYBEv2 combined with mhMPG or pAYBEv3 coupled with VP64 can remarkably improve A-to-Y editing efficiency; pAYBEv3 containing transactivator VP64 induced A-to-Y editing more effectively than pAYBEv2 containing mhMPG. Furthermore, mhMPG and VP64 exhibit a synergistic effect in enhancing A-to-Y editing activity. pAYBEv4 containing mhMPG and VP64 is superior to pAYBEs of other versions in A-to-Y editing, and realizes A-to-Y base transversions of some uneditable target sites in a rice stable line, wherein the A-to-Y editing efficiency is up to 17.24%. Through the combination with ABEs, CBEs and CGBEs, pAYBEs with higher A-to-Y transversion efficiency can allow all types of base conversion, thereby greatly enriching a single-base editing tool box of plants and providing important technical support for functional analysis and genetic improvement of important genes of rice and other crops.

Drawings

FIG. 1 is a schematic diagram of the A-to-Y single base transversion principle of the AYBE system. The AYBE system consists of adenine deaminase TadA8e, CRISPR/nCas9 (D10A), alkyladenine DNA glycosylase (MPG) and genomic targeting guide RNA (gRNA). Adenine deaminase catalyzes adenine (A) to deaminate to produce hypoxanthine (I), and MPG protein can remove hypoxanthine to form abasic site AP site (Apurinic site) and repair DNA double chains through DNA polymerase mismatch, so that base inversion of bases A-to-Y is realized; because of the cleavage of the target strand by nCas9 (D10A) while there is an opportunity for double strand breaks (double strand break, DSB) to form with the AP site on the non-target strand, indel editing events are formed at the target site. TLS (translesion synthesis) it is shown that the cross-lesion repair and replication.

FIG. 2 is a sequence alignment of amino acid sequences of a seven-mutation variant mhMPG of a human alkyl adenine DNA glycosylase and a human alkyl adenine DNA glycosylase hMPG. Wherein, 7 amino acids marked as mhMPG mutations in the red box are G163R, N169S, S198A, K202A, G203A, S206A, K a, respectively.

FIG. 3 is a schematic diagram of the structure of plant pAYBEs vector. Wherein TadA8e is adenine deaminase; nCas9 (D10A) is a Cas9 (D10A) nickase; NLS is a nuclear localization signal; vp64 is a transactivator; hMPG is a human alkyl adenine DNA glycosylase; mhMPG is a seven-mutation variant of the human alkyl adenine DNA glycosylase.

FIG. 4 is a statistical plot of the efficiency of testing pAYBE single base editors in rice protoplasts. Panel A is a statistical plot of pABE8e tested A-to-G editing efficiency in rice protoplasts. Panel B is a statistical plot of pAYBEv1-hMPG tested A-to-C, A-to-T, A-to-G and index editing efficiency at the target in rice protoplasts. Panel C is a statistical plot of pAYBEv2-mhMPG tested A-to-C, A-to-T, A-to-G and target index editing efficiency in rice protoplasts. Panel D is a statistical plot of pAYBEv3-hMPG-VP64 tested A-to-C, A-to-T, A-to-G and target index editing efficiency in rice protoplasts. Panel E is a statistical plot of pAYBEv4-mhMPG-VP64 tested A-to-C, A-to-T, A-to-G and index editing efficiency at the target in rice protoplasts. All of the above vectors were tested in triplicate in protoplasts for each target.

FIG. 5 shows the preference of pAYBE for testing pAYBE target editing window in rice protoplasts. Wherein the target sequences are arranged at 1-20 positions, and 21-23 positions are PAM sequences; the box plot spans 25% -75% quartiles, with the horizontal line representing the median and the error line extending to a minimum and maximum. FIG. A is a statistical plot of pAYBEv1-hMPG target editing window preferences. Panel B is a statistical plot of pAYBEv2-mhMPG target editing window preferences. Panel C is a statistical plot of pAYBEv3-hMPG-VP64 target edit window preference. Panel D is a statistical plot of pAYBEv4-mhMPG-VP64 target edit window preference.

FIG. 6 shows the indel genotype produced by pAYBEv4-mhMPG-VP64 in rice protoplasts. Wherein green is labeled as PAM site, the ratio below PAM site indicates the ratio of indel genotype at all genotype events, black represents deleted nucleic acid fragments, and red indicates inserted base fragments. Panel A shows the indel genotype obtained by deep sequencing pAYBEv4-mhMPG-VP64 after editing on OsNRT1.1B target. Panel B shows the indel genotype obtained by deep sequencing pAYBEv4-mhMPG-VP64 after Oswall-T1 target editing. Panel C shows the indel genotype obtained by deep sequencing pAYBEv4-mhMPG-VP64 after Oswall-T2 target editing.

FIG. 7 shows the results of Sanger sequencing of pAYBEv1-hMPG mediated stable transformation seedlings compiled A-to-Y. Wherein the arrow indicates the base editing occurrence site.

FIG. 8 shows the results of Sanger sequencing of pAYBEv3-hMPG-VP 64-mediated stable transformation seedlings, A-to-Y editing. Wherein the arrow indicates the base editing occurrence site.

FIG. 9 shows the Sanger sequencing results of pAYBEv4-mhMPG-VP 64-mediated stable transformation seedlings A-to-Y editing. Wherein the arrow indicates the base editing occurrence site.

FIG. 10 is a genotype analysis of pAYBEv4-mhMPG-VP64 mediated indel editing rice plants. Wherein green is marked as PAM site, below PAM site the ratio of deletion and insertion genotypes to all transformation events, black part for deleted nucleic acid fragments, red for inserted base fragments, dark grey for a-to-G editing events. Panel A shows the indel genotype of pAYBEv4-mhMPG-VP64 after editing on the OsDEP1 target. Panel B shows the indel genotype of pAYBEv4-mhMPG-VP64 after editing on the OsEPSPS target. Panel C shows the indel genotype of pAYBEv4-mhMPG-VP64 after editing on OsNRT1.1B target. Panel D shows the indel genotype of pAYBEv4-mhMPG-VP64 after editing on Oswall-T1 target. Panel E shows the indel genotype of pAYBEv4-mhMPG-VP64 after editing on Oswall-T2 target. Panel F shows the indel genotype of pAYBEv4-mhMPG-VP64 after editing on Oswall-T3 target.

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

The 1/2MS medium (pH 5.8) in the following examples is a medium obtained by mixing MS & Vitamins salt, sucrose, plant gel and water, wherein the concentration of each solute in the 1/2MS medium is as follows: 2.15g/L MS & Vitamins salts, 15g/L sucrose, 2g/L plant gel.

The 0.6M Mannitol solution (pH 5.8) in the examples below is a solution obtained by mixing Mannitol with water, wherein the Mannitol concentration is: 2.186g/20ml.

The enzymatic hydrolysate (pH 5.8) in the following examples was prepared from Cellulase RS, macerozyme R-10, mannitol, MES, caCl at pH 5.7 ₂ Uniformly mixing the solution obtained by BSA and water, wherein the concentration of each solute in the enzymolysis solution is as follows: 1.5% Cellulase RS, 0.75% Macerozyme R-10, 0.6M Mannitol, MES pH 5.7, 10mM CaCl ₂ 、0.1％BSA。

The W5 solution (pH 5.8) in the following examples was prepared by mixing NaCl and CaCl ₂ Uniformly mixing KCl, MES with pH of 5.7 and water to obtain a solution, wherein the concentration of each solute in the W5 solution is as follows: 0.9% NaCl, 125mM CaCl ₂ 、5mM KCl、2mM MES。

The MMG solution (pH 5.8) in the following example was prepared by mixing Mannitol, mgCl ₂ The solution obtained by uniformly mixing MES and water, wherein the concentration of each solute in the MMG solution is respectively as follows: 0.6M Mannitol, 15mM MgCl ₂ 、4mM MES。

The PEG4000 solutions (pH 5.8) in the examples described below were prepared by combining PEG4000 and PEG Mannitol, caCl ₂ And water, wherein the concentration of each solute in the PEG-4000 solution is respectively as follows: 40% (W/V) PEG4000, 0.6 MManitol, 0.1M CaCl ₂ 。

The LB liquid medium in the following examples is a solution obtained by mixing yeast powder, tryptone, naCl and water, wherein the concentration of each solute in the LB liquid medium is as follows: 0.5% (W/V) yeast powder, 1% (W/V) tryptone, 1% (W/V) NaCl.

The AAM medium (pH 5.2) in the examples described below was obtained by mixing MS salts, sucrose, MES, glucose, casamino acid, acetosyringone and 100mL 10x AA amino acids uniformly, wherein the concentration of each solute in the AAM medium was 4.3g/L MS salts, 68.5g/L sucrose, 0.5g/L MES, 36g/L glucose, 500mg/L casamino acid, 40mg/L acetosyringone, respectively. The 10x AA amino acids solution is a solution obtained by uniformly mixing L-glutamine, L-aspartic acid, L-arginine, glycine and water, wherein the concentration of each solute in the 10x AA amino acids solution is as follows: 8.76g/L L-glutamine, 2.66g/L L-day (aspartic acid), 1.74g/L L-arginine and 75mg/L glycine.

The R1 medium (pH 5.8) in the following examples is a medium obtained by mixing MS & Vitamins salt, sucrose, MES, casein amino acid, L-proline, 2,4-D, plant gel and water, wherein the concentration of each solute in the R1 medium is as follows: 4.3g/L MS & Vitamins salt, 30g/L sucrose, 0.5g/L MES, 300mg/L Casein amino acid, 2.8g/L L-proline, 2 mg/L2, 4-D, 4g/L plant gel.

The R2 medium (pH 5.2) in the following examples is a medium obtained by uniformly mixing MS & Vitamins salt, sucrose, MES, casein amino acid, 2,4-D, plant gel, acetosyringone and water, wherein the concentration of each solute in the R2 medium is as follows: 4.3g/L MS & Vitamins salt, 30g/L sucrose, 0.5g/L MES, 300mg/L Casein amino acid, 2 mg/L2, 4-D, 4g/L plant gel, 20mg/mL acetosyringone.

The R1 screening medium (pH 5.8) in the following examples was a medium obtained by mixing MS & Vitamins salt, sucrose, MES, casein amino acid, L-proline, 2,4-D, plant gel and water, wherein the concentration of each solute in the R1 screening medium was: 4.3g/L MS & Vitamins salt, 30g/L sucrose, 0.5g/L MES, 300mg/L Casein amino acid, 2.8g/L L-proline, 2 mg/L2, 4-D, 4g/L plant gel.

The R4 differentiation medium (pH 5.8) in the following examples is a medium obtained by uniformly mixing MS & Vitamins salts, sucrose, MES, casein amino acids, sorbitol, kinetin, NAA, plant gel and water, wherein the concentration of each solute in the R4 differentiation medium is as follows: 4.3g/L MS & Vitamins salts, 30g/L sucrose, 0.5g/L MES, 2g/L Casein amino acid, 30g/L sorbitol, 2mg/L kinetin, 1mg/L NAA, 4g/L plant gel.

The R5 rooting medium (pH 5.8) in the following examples is a medium obtained by uniformly mixing MS & Vitamins salt, sucrose, MES, plant gel and water, wherein the concentration of each solute in the R5 medium is as follows: 2.15g/L MS & Vitamins salt, 15g/L sucrose, 0.5g/L MES, 2g/L plant gel.

Example 1 design of the Main element of different plant A-to-Y Single base editor pAYBEs and its expression vector design one, design of the Main element of different plant A-to-Y Single base editor pAYBEs

The plant A-to-Y single base editor pAYBEs in the invention has five kinds as follows: pABE8e, pAYBEv1-hMPG, pAYBEv2-mhMPG, pAYBEv3-hMPG-VP64 and pAYBEv4-mhMPG-VP64. The main elements of each plant A-to-Y single base editor are as follows:

the main elements of the single base editor pABE8e are as follows: adenine deaminase TadA8e, cas9 (D10A) nickase, gRNA and selectable marker protein (e.g., HPT).

The main elements of the single base editor pAYBEv1-hMPG are as follows: adenine deaminase TadA8e, cas9 (D10A) nickase, human alkyl adenine DNA glycosylase hMPG, gRNA and selectable marker protein (e.g., HPT).

The main elements of the single base editor pAYBEv2-mhMPG are as follows: adenine deaminase TadA8e, cas9 (D10A) nickase, human alkyl adenine DNA glycosylase heptad mutant mhMPG, gRNA and selectable marker protein (e.g., HPT).

The main elements of the single base editor pAYBEv3-hMPG-VP64 are as follows: transactivator Vp64, adenine deaminase TadA8e, cas9 (D10A) notch enzyme, human alkyl adenine DNA glycosylase hMPG, gRNA, and selectable marker protein (e.g., HPT).

The main elements of the single base editor pAYBEv4-mhMPG-VP64 are as follows: transactivator Vp64, adenine deaminase TadA8e, cas9 (D10A) nicking enzyme, human alkyl adenine DNA glycosylase heptamutant mhMPG, gRNA, and selectable marker protein (e.g., HPT).

The aforementioned seven-mutation variant mhMPG of human alkyladenine DNA glycosylase is a protein obtained by mutating glycine (G) at position 163, asparagine (N) at position 169, serine (S) at position 198, alanine (a) at position 202, lysine (K) at position 203, glycine (G) at position alanine (a), serine (S) at position 206, and alanine (a) at position 210.

The amino acid sequence alignment of the seven-mutation variant mhMPG of the human alkyl adenine DNA glycosylase and the human alkyl adenine DNA glycosylase hMPG is shown in fig. 2.

2. Expression vector design of pAYBEs of different plant A-to-Y single base editors

The schematic structure of the plant A-to-Y single base editor pAYGES expression vector is shown in FIG. 3.

Expression vectors of the single base editor pABE8e include the fusion protein TadA8e & Cas9 (D10A) expression cassette, the gRNA expression cassette and the selectable marker protein HPT expression cassette. The expression cassette of the fusion protein TadA8E & Cas9 (D10A) sequentially comprises a Ubi promoter, a nuclear localization signal NLS, a coding gene of adenine deaminase TadA8E, a coding gene of Cas9 (D10A) nicking enzyme, a nuclear localization signal NLS and an E9t terminator.

The expression vector of the single base editor pAYBEv1-hMPG comprises an expression cassette of fusion protein TadA8e & Cas9 (D10A) & hMPG, a gRNA expression cassette and a screening marker protein HPT expression cassette. The expression cassette of the fusion protein TadA8E & Cas9 (D10A) and hMPG sequentially comprises a Ubi promoter, a nuclear localization signal NLS, a coding gene of adenine deaminase TadA8E, a coding gene of Cas9 (D10A) notch enzyme, a coding gene of human alkyl adenine DNA glycosylase hMPG, a nuclear localization signal NLS and an E9t terminator.

The expression vector of the single base editor pAYBEv2-mhMPG comprises a fusion protein TadA8e & Cas9 (D10A) & mhMPG expression cassette, a gRNA expression cassette and a screening marker protein HPT expression cassette. The expression cassette of the fusion protein TadA8E & Cas9 (D10A) & mhMPG sequentially comprises a Ubi promoter, a nuclear localization signal NLS, a coding gene of adenine deaminase TadA8E, a coding gene of Cas9 (D10A) nicking enzyme, a coding gene of a seven-mutation type mhMPG of a human alkyl adenine DNA glycosylase, a nuclear localization signal NLS and an E9t terminator.

The expression vector of the single base editor pAYBEv3-hMPG-VP64 comprises a fusion protein Vp64& TadA8e & Cas9 (D10A) & hMPG expression cassette, a gRNA expression cassette and a screening marker protein HPT expression cassette. The expression cassette of the fusion protein Vp64& TadA8E & Cas9 (D10A) & hMPG sequentially comprises a Ubi promoter, a nuclear localization signal NLS, a coding gene of a transactivator Vp64, a coding gene of adenine deaminase TadA8E, a coding gene of Cas9 (D10A) notch enzyme, a coding gene of human alkyl adenine DNA glycosylase hMPG, a nuclear localization signal NLS and an E9t terminator.

The expression vector of the single base editor pAYBEv4-mhMPG-VP64 comprises a fusion protein Vp64& tadA8e & Cas9 (D10A) & mhMPG expression cassette, a gRNA expression cassette and a screening marker protein HPT expression cassette. The expression cassette of the fusion protein Vp64& TadA8E & Cas9 (D10A) & hMPG sequentially comprises a Ubi promoter, a nuclear localization signal NLS, a coding gene of a transactivator Vp64, a coding gene of adenine deaminase TadA8E, a coding gene of Cas9 (D10A) nicking enzyme, a coding gene of a human alkyl adenine DNA glycosylase seven-mutation variant mhMPG, a nuclear localization signal NLS and an E9t terminator.

The gRNA expression cassettes in each single-base editor comprise a OsU promoter, a gRNA coding gene and a SUP4 terminator in sequence.

The screening marker protein HPT expression cassettes in the single-base editors sequentially comprise a 35S promoter, a coding gene of the screening marker protein HPT and a Nos terminator.

Example 2 construction of pAYBES expression vectors of different plant A-to-Y Single base editors and application thereof in base editing of Rice genome

1. Construction of pAYBEs expression vectors of different plant A-to-Y single base editors

The following recombinant vectors were constructed artificially, each of which was a circular plasmid:

the total of 6 expression vectors of the single base editor pABE8e are pABE8e-OsDEP1, pABE8e-OsEPSPS, pABE8e-OsNRT1.1B, pABE8 e-Oswall-T1, pABE8 e-Oswall-T2 and pABE8 e-Oswall-T3 recombinant vectors respectively.

The total number of the expression vectors of the single base editor pAYBEv1-hMPG is 6, and the expression vectors are pAYBEv1-hMPG-OsDEP1, pAYBEv1-hMPG-OsEPSPS, pAYBEv1-hMPG-OsNRT1.1B, pAYBEv 1-hMPG-Oswall-T1, pAYBEv 1-hMPG-Oswall-T2 and pAYBEv 1-hMPG-Oswall-T3 recombinant vectors respectively.

The total number of the expression vectors of the single base editor pAYBEv2-mhMPG is 6, and the expression vectors are pAYBEv2-mhMPG-OsDEP1, pAYBEv2-mhMPG-OsEPSPS, pAYBEv2-mhMPG-OsNRT1.1B, pAYBEv 2-mhMPG-Oswall-T1, pAYBEv 2-mhMPG-Oswall-T2 and pAYBEv 2-mhMPG-Oswall-T3 recombinant vectors respectively.

The total number of the expression vectors of the single base editor pAYBEv3-hMPG-VP64 is 6, and the expression vectors are pAYBEv3-hMPG-VP64-OsDEP1, pAYBEv3-hMPG-VP64-OsEPSPS, pAYBEv3-hMPG-VP64-OsNRT1.1B, pAYBEv3-hMPG-VP 64-Oswall-T1, pAYBEv3-hMPG-VP 64-Oswall-T2 and pAYBEv3-hMPG-VP 64-Oswall-T3 recombinant vectors respectively.

The total number of the expression vectors of the single base editor pAYBEv4-mhMPG-VP64 is 6, and the expression vectors are pAYBEv4-mhMPG-VP64-OsDEP1, pAYBEv4-mhMPG-VP64-OsEPSPS, pAYBEv4-mhMPG-VP64-OsNRT1.1B, pAYBEv4-mhMPG-VP 64-Oswall-T1, pAYBEv4-mhMPG-VP 64-Oswall-T2 and pAYBEv4-mhMPG-VP64-OsWaxy-T3 recombinant vectors respectively.

The nucleotide sequence of the pABE8E-OsDEP1 recombinant vector is shown as a sequence 1 in a sequence table, wherein, positions 1-1992 are a Ubi promoter sequence, positions 2017-2037 are coding sequences of nuclear localization signals NLS, position 2062-2559 are coding gene sequences of adenine deaminase TadA8E, position 2656-6756 are coding gene sequences of Cas9 (D10A) nicking enzyme, position 6757-6804 are coding sequences of nuclear localization signals NLS, and position 6812-7446 is E9t terminator sequence; the 7453-7833 promoter sequence is OsU, the 7834-7853 gRNA target sequence is 7854-7929 gRNA skeleton coding sequence, and the 7930-7949 SUP4 terminator sequence; the 8296-8973 site is 35S promoter sequence, the 9018-10043 site is the coding gene sequence of screening marker protein HPT, the coding sequence 4 shows the screening marker protein HPT, and the 10090-10264 site is the Nos terminator sequence.

The nucleotide sequences of pABE8e-OsEPSPS, pABE8e-OsNRT1.1B, pABE8 e-Oswall-T1, pABE8 e-Oswall-T2 and pABE8 e-Oswall-T3 recombinant vectors are obtained by respectively replacing the gRNA target sequences in the pABE8e-OsDEP1 recombinant vector sequences with target sequences corresponding to OsEPSPS, osNRT1.1B, oswall-T1, oswall-T2 and Oswall-T3 in Table 1 and keeping other sequences unchanged.

The nucleotide sequences of pAYBEv1-hMPG-OsDEP1, pAYBEv1-hMPG-OsEPSPS, pAYBEv1-hMPG-OsNRT1.1B, pAYBEv1-hMPG-OsWaxy-T1, pAYBEv1-hMPG-OsWaxy-T2, pAYBEv1-hMPG-OsWaxy-T3 recombinant vectors were obtained by inserting DNA molecules shown in SEQ ID No. 5 between position 6756 and position 6757 in pABE8e-OsDEP1, pABE8e-OsEPSPS, pABE8e-OsNRT1.1B, pABE8e-OsWaxy-T1, pABE8e-OsWaxy-T2, pABE8e-OsWaxy-T3 recombinant vector sequences, respectively, and keeping the other sequences unchanged. Wherein, the 40 th to 930 th positions of the sequence 5 are the coding sequence of the human alkyl adenine DNA glycosylase hMPG, and the coding sequence 6 shows the human alkyl adenine DNA glycosylase hMPG.

The nucleotide sequences of pAYBEv2-mhMPG-OsDEP1, pAYBEv2-mhMPG-OsEPSPS, pAYBEv2-mhMPG-OsNRT1.1B, pAYBEv2-mhMPG-OsWaxy-T1, pAYBEv2-mhMPG-OsWaxy-T2, pAYBEv2-mhMPG-OsWaxy-T3 recombinant vectors were obtained by replacing the coding sequences of human alkyl adenine DNA glycosylase hMPG in the sequences of pAYBEv1-hMPG-OsDEP1, pAYBEv1-hMPG-OsEPSPS, pAYBEv1-hMPG-OsNRT1.1B, pAYBEv1-hMPG-OsWaxy-T1, pAYBEv1-hMPG-OsWaxy-T2, pAYBYB1-hMPG-OsWaxy-T3 recombinant vectors with the coding sequences of human alkyl adenine DNA glycosylase seven-mutant expressed in sequence 7, respectively, and leaving the other coding sequences unchanged.

The pAYBEv3-hMPG-VP64-OsDEP1, pAYBEv3-hMPG-VP64-OsEPSPS, pAYBEv3-hMPG-VP64-OsNRT1.1B, pAYBEv3-hMPG-VP64-OsWaxy-T1, pAYBEv3-hMPG-VP64-OsWaxy-T2, pAYBEv3-hMPG-VP64-OsWaxy-T3 recombinant vectors were DNA molecules in which the DNA molecules between 2038 and 2061 in the pAYBEv1-hMPG-OsDEP1, pAYBEv1-hMPG-OsEPSPS, pAYBEv-hMPG-OsNRT1.1B, pAYBEv1-hMPG-OsWaxy-T1, pAYBEv1-hMPG-OsWaxy-T2, pAYBEv1-hMPG-OsWaxy-T3 recombinant vector sequences were replaced with DNA molecules shown in sequence 8, respectively, and the other sequences were not changed. The 1 st to 150 th bits of the sequence 8 are the coding sequence of the transactivator Vp64, and the transactivator Vp64 shown in the coding sequence 9.

The nucleotide sequences of pAYBEv4-mhMPG-VP64-OsDEP1, pAYBEv4-mhMPG-VP64-OsEPSPS, pAYBEv4-mhMPG-VP64-OsNRT1.1B, pAYBEv4-mhMPG-VP 64-Oswall-T1, pAYBEv4-mhMPG-VP 64-Oswall-T2, pAYBEv4-mhMPG-VP 64-Oswall-T3 recombinant vectors were respectively replaced with the DNA sequences between position 8 and position 1 in pAYBEv2-mhMPG-OsDEP1, pAYBEv2-mhMPG-OsEPSPS, pAYBEv-mhMPG-OsNRT1.1B, pAYBEv 2-mhMPG-Oswall-T1, pAYBEv 2-mhMPG-Osxy-T2, pAEv 2-mMPG-Oswall-T3 recombinant vectors, and the other DNA sequences were not changed as shown. The 1 st to 150 th bits of the sequence 8 are the coding sequence of the transactivator Vp64, and the transactivator Vp64 shown in the coding sequence 9.

TABLE 1 target sequences

Gene	Target sequence (5 'to 3')
		OsWaxy-T1	CCTGACACTGGAGTTGATTACAA
OsWaxy-T2	CGCCAAGTACGACGCAACCACGG
		OsWaxy-T3	CCATACTTCAAAGGAACTTATGG
OsNRT1.1B	ACTAGATATCTAAACCATTAAGG
		OsDEP1	AGACAAGCTTGGCCCTCTTTGGG
OsEPSPS	ATGATATCCTCCTACATGTCAGG

2. Separation and transformation of rice protoplast and analysis of accurate editing efficiency and editing window

The recombinant expression vectors of the plant A-to-Y single base editor pAYBEs constructed in the step one (all the vectors are tested, and each target point is subjected to three independent repeated experiments in protoplasts) are respectively operated according to the following steps:

1. isolation of Rice protoplasts

The flower 11 seeds in the shelled rice variety are rinsed for 10 minutes by 75 percent of ethanol, then treated by 20 percent of sodium hypochlorite for 20 minutes, washed by sterile water for more than 5 times, and the sterilized seeds are obtained. Then the sterilized seeds are placed on a 1/2MS culture medium to be cultured for about 2 weeks, and the seeds are irradiated for 12 hours at 26 ℃ and 150 mu mol m ^-2 ·s ^-1 ) Culturing under the condition to obtain rice seedlings. 30 seeds can be placed in each tissue culture bottle, one experiment can be carried out on 60-90 seedlings, the quantity of the separated protoplasts can be converted into about 6 vectors, and 3 repeats are arranged for each plasmid conversion.

Selecting stems and leaf sheaths of rice seedlings to separate protoplasts, wherein the specific steps are as follows: cutting with sharp bladesFilaments about 0.5mm wide can be cut together in 20 to 30 pieces. The filaments were placed in a 0.6M Mannitol solution and tinfoil wrapped in light protection for 10 minutes. Filtering with 75 μm nylon cloth, placing the filaments into 50mL of enzymolysis liquid, avoiding light, vacuumizing for 30min by a vacuum pump at about 50kpa, taking out, and then placing on a room temperature shaking table for digestion for 5-6 hours at the rotating speed of 10-20 rpm. Diluting the enzymolysis product with an equal volume of W5 solution, filtering the enzymolysis solution with nylon cloth after the enzymolysis reaction is stopped, collecting protoplast in a 50mL centrifuge tube, horizontally centrifuging at 28 ℃ and 150g, lifting and lowering the speed to 3, centrifuging for 5min, and discarding the supernatant; gently suspending with 10mL of W5 solution, horizontally centrifuging at 28deg.C at 150g at a speed of 3, centrifuging for 5min, and discarding the supernatant; adding appropriate amount of MMG solution for resuspension, and adjusting protoplast concentration to 2×10 ⁶ and/mL, counting by a blood cell counter for later use.

2. Transformation of Rice protoplasts

Adding about 20 mug of endotoxin-free high-concentration AYBE test plasmid (recombinant expression vector of each plant A-to-Y single-base editor pAYBE constructed in the first step) into a 2mL centrifuge tube, cutting off the gun head of the gun tip by scissors, sucking 200 mug of protoplast obtained in the step 1, slowly adding the protoplast into the centrifuge tube along the tube wall, gently sucking and beating the protoplast to mix the protoplast uniformly, adding about 220 mug of PEG-4000 solution, gently inverting the mixture, and inducing the transformation in a dark place for 10-20 min; adding 800 mu L W solution (at room temperature), mixing, centrifuging at 28deg.C and 150g level for 3 min, and discarding supernatant; 1mL of the W5 solution was added, mixed upside down, and incubated in the dark at 28 ℃.

48h after transformation, protoplasts were collected and the supernatant discarded. Suspending the original biomass in a 2mL centrifuge tube by gun suction, centrifuging at 12000rpm for 1min, and discarding the supernatant; the protoplast genome is extracted by a specific method similar to the plant genome extraction method, and the target fragment of the selected target gene is amplified by PCR and subjected to Hi-tom high throughput sequencing using primers shown in Table 2.

PCR amplification system: 10. Mu.L of 2 XTaq enzyme, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, 1. Mu.L of genomic DNA template (60 ng/. Mu.L), 7. Mu.L of ddH ₂ O。

PCR amplification procedure: 98 ℃ for 3min;98 ℃ for 15s;60 ℃ for 15s;72 ℃,15s;35 cycles; 72 ℃ for 5min; maintained at 16 ℃.

TABLE 2 primer list for deep sequencing

3. Statistical analysis of the efficiency of editing pAYBEs in protoplasts

The invention selects 6 endogenous targets in rice genome to rapidly test the effectiveness of each single-base editor expression vector (hereinafter referred to as vector) in rice protoplast. The specific detection results are shown in FIG. 4, tables 3 to 7.

Deep sequencing of the pABE8e vector was consistent with the expected results, no A-to-Y base editing event was detected at all 6 targets, and only A-to-G base conversion was detected. Wherein, at the OsDEP1 target point, the highest A-to-G base editing efficiency is 6.06 percent and the lowest A-to-G base editing efficiency is 5.49 percent; at the OsEPSPS target point, the highest A-to-G base editing efficiency is 3.29% and the lowest A-to-G base editing efficiency is 1.46%; at the OsNRT1.1B target, the A-to-G base editing is most effective, the highest efficiency is 6.56%, and the lowest efficiency is 5.71%; at the Oswall-T1 target, the highest A-to-G base editing efficiency is 3.77 percent and the lowest A-to-G base editing efficiency is 2.58 percent; at the Oswall-T2 target, the highest A-to-G base editing efficiency is 1.34% and the lowest A-to-G base editing efficiency is 1.28%; at the Oswall-T3 target, the highest A-to-G base editing efficiency is 5.35% and the lowest A-to-G base editing efficiency is 3.57%.

The pAYBEv1-hMPG vector does not detect the occurrence of an A-to-Y base editing event at the OsDEP1 target, and the highest A-to-G base editing efficiency is 4.05% and the lowest A-to-G base editing efficiency is 3.64%; no A-to-Y base editing event is detected at the OsEPSPS target point, and the highest A-to-G base editing efficiency is 3.28% and the lowest A-to-G base editing efficiency is 1.92%; deep sequencing at osnrt1.1b target a-to-C editing event was first detected in protoplasts with an average efficiency of 0.44% with a maximum editing efficiency of 0.45% and a minimum of 0.43%. The highest editing efficiency of the A-to-G base is 6.65 percent, and the lowest editing efficiency of the A-to-G base is 5.80 percent; no A-to-Y base editing event is detected at the Oswall-T1 target point, and the highest A-to-G base editing efficiency is 2.98% and the lowest A-to-G base editing efficiency is 2.31%; no A-to-Y base editing event is detected at the Oswall-T2 target point, and the highest A-to-G base editing efficiency is 1.67% and the lowest A-to-G base editing efficiency is 1.09%; no A-to-Y base editing event was detected at the Oswall-T3 target, with an A-to-G base editing efficiency of up to 4.80% and a minimum of 2.38%. In summary, the results of deep sequencing of the plant A-to-Y single base editing vector pAYBEv1-hMPG at 6 targets show that the A-to-C editing event is detected at the OsNRT1.1B target, and the A-to-Y base editing event is not detected at other targets.

pAYBEv2-mhMPG vector detected different degrees of A-to-Y/A-to-G at 6 targets and indels near the targets. Wherein, the highest A-to-C base editing efficiency at the OsDEP1 target point is 0.72%, the lowest is 0.53%, the average efficiency is 0.63%, the highest A-to-T base editing efficiency at the target point is 0.90%, the lowest is 0.49%, the average efficiency is 0.63%, the highest A-to-Y base editing efficiency at the target point is 1.54%, the lowest is 1.02%, the average efficiency is 1.26%, the highest index event efficiency at the target point is 0.41%, the lowest is 0.34%, the highest A-to-G base editing efficiency at the target point is 25.50%, and the lowest is 14.31%; the highest efficiency of indel events at the target spot detected by OsEPSPS is 1.95%, the highest editing efficiency of A-to-G bases at the target spot is 3.71%, and the lowest editing efficiency is 3.29%; at the OsNRT1.1B target point, the highest A-to-C base editing efficiency is 1.44%, the lowest A-to-C base editing efficiency is 0.62%, the average efficiency is 0.94%, compared with the pAYBEv1-hMPG vector, the A-to-C base editing efficiency of the pAYBEv2-mhMPG vector is improved by about 3.20 times (1.44%/0.45%), the highest index event efficiency at the target point is 0.91%, the lowest A-to-G base editing efficiency at the target point is 0.78%, the highest A-to-G base editing efficiency at the target point is 9.34%, and the lowest A-to-G base editing efficiency at the target point is 9.08%; the highest A-to-T base editing efficiency at the Oswall-T1 target point is 0.62%, the lowest A-to-T base editing efficiency at the Oswall-T1 target point is 0.35%, the average efficiency is 0.48%, and the highest A-to-G base editing efficiency at the target point is 4.49%, and the lowest A-to-G base editing efficiency at the target point is 4.15%; only one repetition of Oswall-T2 detects that the editing efficiency of the A-to-T base at the target point is 0.61%, the highest efficiency of the indel event at the target point is 2.53% and the lowest efficiency of the indel event at the target point is 1.98%, the highest editing efficiency of the A-to-G base at the target point is 4.76% and the lowest efficiency of the A-to-G base at the target point is 3.79%; the highest A-to-T base editing efficiency at the Oswall-T3 target point is 1.31%, the lowest A-to-T base editing efficiency at the Oswall-T3 target point is 0.62%, the average efficiency is 0.89%, and the highest A-to-G base editing efficiency at the target point is 6.12% and the lowest A-to-G base editing efficiency at the target point is 4.18%. In conclusion, compared with pAYBEv1-hMPG, pAYBEv2-mhMPG realizes improvement of A-to-Y base conversion efficiency at 6 targets, especially at OsNRT1.1B target, improvement of A-to-C base editing efficiency by about 3.2 times, and realization of base insertion and deletion of small fragments at the target.

Compared with the pAYBEv1-hMPG vector, the pAYBEv3-hMPG-VP64 vector detects A-to-Y/A-to-G with different degrees at 6 target points, and compared with the pAYBEv2-mhMPG vector, the A-to-Y base editing efficiency is improved with different degrees. Wherein, the highest A-to-C base editing efficiency at the OsDEP1 target point is 2.92%, the lowest is 2.27%, the average efficiency is 2.49%, compared with the pAYBEv2-mhMPG vector, the A-to-C base editing efficiency is improved by about 4.06 times (2.92%/0.72%), the highest A-to-T base editing efficiency at the target point is 0.75%, the lowest is 0.60%, the average efficiency is 0.66%, compared with the pAYBEv2-mhMPG vector, the A-to-T base editing efficiency at the target point is slightly reduced (0.75%/0.9%), the highest A-to-Y base editing efficiency at the target point is 3.52%, the lowest is 2.89%, the average efficiency is 3.15%, compared with the pAYB2-mhMPG vector, the A-to-Y base editing efficiency is improved by about 2.29 times (3.52%/1.54%), and the highest A-to-G base editing efficiency at the target point is 10.59%, and the lowest is 6.40%; the highest A-to-C base editing efficiency at the OsEPSPS target point is 0.54%, the lowest A-to-C base editing efficiency is 0.37%, the average efficiency is 0.44%, the A-to-T base editing efficiency at the target point is 0.31% only by one repeated detection, the highest A-to-Y base editing efficiency at the target point is 0.71%, the lowest A-to-Y base editing efficiency is 0.37%, the average efficiency is 0.54%, and the highest A-to-G base editing efficiency at the target point is 1.01%, and the lowest A-to-G base editing efficiency at the target point is 0.67%; the highest A-to-C base editing efficiency at the OsNRT1.1B target point is 2.06%, the lowest A-to-C base editing efficiency is 1.93%, the average efficiency is 1.99%, compared with the pAYBEv1-hMPG vector, the A-to-C base editing efficiency is improved by about 4.58 times (2.06%/0.45%), compared with the pAYBEv2-mhMPG vector, the A-to-C base editing efficiency is improved by about 1.43 times (2.06%/1.44%), the highest A-to-T base editing efficiency at the target point is 0.48%, the lowest A-to-Y base editing efficiency at the target point is 0.45%, the average efficiency is 0.47%, the highest A-to-Y base editing efficiency at the target point is 2.51%, the lowest A-to-Y base editing efficiency at the target point is 2.40%, the average efficiency is 2.46%, compared with the pAYBEv1-hMPG vector, the A-to-Y base editing efficiency is improved by about 5.58 times (2.51%/0.45%), and the A-to-Y base editing efficiency at the target point is improved by about 1.4% to about 4.44%; the highest A-to-C base editing efficiency at the Oswall-T1 target point is 1.44%, the lowest A-to-T base editing efficiency is 0.34%, the average efficiency is 0.78%, the highest A-to-T base editing efficiency at the target point is 0.30%, the lowest A-to-T base editing efficiency is 0.24%, the average efficiency is 0.27%, compared with the pAYBEv2-mhMPG vector, the A-to-T base editing efficiency at the target point is slightly reduced (0.30%/0.62%), the highest A-to-Y base editing efficiency at the target point is 1.74%, the lowest A-to-Y base editing efficiency is 0.34%, the average efficiency is 0.96%, and compared with the pAYBEv2-mhMPG vector, the highest A-to-Y base editing efficiency at the target point is 3.18%, and the lowest A-to-G base editing efficiency at the target point is 1.81%; the highest A-to-C base editing efficiency at an Oswall-T2 target point is 1.53%, the lowest A-to-T base editing efficiency is 0.95%, the average efficiency is 1.30%, the highest A-to-T base editing efficiency at the target point is 1.40%, the lowest A-to-T base editing efficiency is 0.48%, the average efficiency is 0.82%, compared with a pAYBEv2-mhMPG vector, the A-to-T base editing efficiency at the target point is improved by about 2.30 times (1.40%/0.61%), the highest A-to-Y base editing efficiency at the target point is 2.83%, the lowest A-to-Y base editing efficiency at the target point is 1.43%, the average efficiency at the target point is 2.12%, compared with the pAYBEv2-mhMPG vector, the A-to-Y base editing efficiency at the target point is improved by about 4.64 times (2.83%/0.61%), and the lowest A-to-G base editing efficiency at the target point is 5.03%; the highest A-to-C base editing efficiency at the Oswall-T3 target point is 0.75%, the lowest A-to-C base editing efficiency is 0.65%, the average efficiency is 0.69%, the highest A-to-T base editing efficiency at the target point is 0.49%, the lowest A-to-T base editing efficiency is 0.38%, the average efficiency is 0.44%, compared with the pAYBev2-mhMPG vector, the A-to-T base editing efficiency at the target point is slightly reduced (0.49%/1.31%), the highest A-to-Y base editing efficiency at the target point is 1.21%, the lowest A-04%, the average efficiency is 1.13%, compared with the pAYBev2-mhMPG vector, the A-to-Y base editing efficiency at the target point is slightly reduced (1.24%/1.31%), the highest A-to-G base editing efficiency at the target point is 2.92%, and the lowest A-to-G base editing efficiency is 2.28%. In conclusion, compared with pAYBEv1-hMPG vector and pAYBEv2-mhMPG vector, pAYBEv3-hMPG-VP64 vector remarkably improves the efficiency of A-to-Y base transversion, and small fragment base insertion and deletion occur at the target point.

Compared with pAYBEv1-hMPG vector, pAYBEv2-mhMPG vector and pAYBEv3-hMPG-VP64 vector, pAYBEv4-mhMPG-VP64 vector has remarkably improved A-to-Y editing efficiency at 6 targets. Wherein, the highest A-to-C base editing efficiency at the OsDEP1 target point is 3.71%, the lowest A-to-C base editing efficiency is 2.73%, the average efficiency is 3.28%, the A-to-C base editing efficiency is improved by about 5.15 times (3.71%/0.72%) compared with the pAYBEv2-mhMPG carrier, the A-to-C base editing efficiency is improved by about 1.27 times (3.71%/2.92%), the A-to-T base editing efficiency is 1.77%, the lowest A-to-C base editing efficiency is 1.12%, the average efficiency is 1.44%, the A-to-T base editing efficiency is improved by about 1.97 times (1.77%/0.90%) compared with the pAYBEv2-mhMPG carrier, the A-to-T base editing efficiency is improved by about 2.36 times (1.77%/0.75%), the A-to-Y base editing efficiency is improved by about 1.77%/5%, the highest A-to-Y base editing efficiency is about 4.6% by about 5.35% compared with the pAYBEv2-mhMPG carrier, the average efficiency is improved by about 1.6%/0.35% compared with the pAYBEv3-hMPG carrier, the highest A-to-Y base editing efficiency is 1.77%, the lowest A-to be 1.12%, the average efficiency is 1.44%, the average efficiency is improved by about 1.7% compared with pAYB0.7% by about 1.97% compared with pAYB2-mhMPG carrier, the pAMG 2-mMG base editing efficiency is improved by about 1.0.0.0.0; the highest A-to-C base editing efficiency at an OsEPSPS target point is 3.06%, the lowest is 1.58%, the average efficiency is 2.26%, compared with a pAYBEv3-hMPG-VP64 vector, the A-to-C base editing efficiency is improved by about 5.67 times (3.06%/0.54%), the A-to-T base editing efficiency is 1.37%, the lowest is 0.64%, the average efficiency is 1.09%, compared with a pAYBEv3-hMPG-VP64 vector, the A-to-T base editing efficiency is improved by about 4.42 times (1.37%/0.31%), the A-to-Y base editing efficiency at the target point is 3.70%, the lowest is 2.84%, the average efficiency is 3.35%, compared with a pAYB3-hMPG-VP 64 vector, the A-to-Y base editing efficiency is improved by about 5.21 times (3.70%/0.71%), the A-to-G base editing efficiency is 7.00%, and the lowest is 5.01%; the highest A-to-C base editing efficiency at the OsNRT1.1B target point is 4.40 percent, the lowest A-to-C base editing efficiency is 3.09 percent, the average efficiency is 3.66 percent, the A-to-C base editing efficiency is improved by about 9.78 times (4.40 percent/0.45 percent) compared with the pAYBEv1-hMPG vector, the A-to-C base editing efficiency is improved by about 3.06 times (4.40 percent/1.44 percent) compared with the pAYBEv 2-mhMPG-VP 64 vector, the A-to-C base editing efficiency is improved by about 2.14 times (4.40 percent/2.06 percent), the A-to-T base editing efficiency is highest by 2.42 percent, the lowest A-to-T base editing efficiency is 0.82 percent, the average efficiency is 1.47 percent compared with the pAYBEv3-hMPG-VP64 vector, the A-to-T base editing efficiency is improved by about 5.04 times (2.42%/0.48%), the A-to-Y base editing efficiency at a target point is highest by 6.82%, the minimum is 4.25%, the average efficiency is 5.13%, the A-to-Y base editing efficiency is improved by about 15.16 times (6.82%/0.45%) compared with a pAYBEv1-mhMPG vector, the A-to-Y base editing efficiency is improved by about 4.74 times (6.82%/1.44%) compared with a pAYBEv2-mhMPG vector, the A-to-Y base editing efficiency is improved by about 2.72 times (6.82%/2.51%) compared with a pAYBEv3-hMPG-VP64 vector, the index event efficiency at the target point is highest by 1.09%, the minimum is 0.47%, the A-to-G base editing efficiency is 15.27%, and the maximum is 13.08%; the highest A-to-C base editing efficiency at an Oswall-T1 target point is 3.22%, the lowest is 2.43%, the average efficiency is 2.84%, compared with a pAYBEv3-hMPG-VP64 vector, the highest A-to-C base editing efficiency at the target point is about 2.24 times (3.22%/1.44%), the highest A-to-T base editing efficiency at the target point is 1.97%, the lowest is 1.29%, the average efficiency is 1.53%, compared with a pAYBEv2-mhMPG vector, the A-to-T base editing efficiency is about 3.18 times (1.97%/0.62%), compared with a pAYBEv3-hMPG-VP64 vector, the A-to-T base editing efficiency is about 6.57 times (1.97%/0.30%), the highest A-to-Y base editing efficiency at the target point is 4.55%, the lowest is 4.37%, the average efficiency is compared with a pAYBEv2-mhMPG vector, the highest A-to-base editing efficiency is about 3.18 times (1.97%/0.62%), the highest A-to-Y base editing efficiency at the target point is about 6.55%, and the highest A-to-Y base editing efficiency is about 6.55%, the highest A-to-6.7.17%, the highest base editing efficiency is about 0.55%, and the highest to the highest efficiency is 0.55% compared with a pAYBYBEv 2-3-hMPG-6-6.55%, the base editing efficiency is about 6.55%, the highest; the highest A-to-C base editing efficiency at the Oswall-T2 target point is 3.69%, the lowest is 2.30%, the average efficiency is 3.00%, compared with the pAYBEv3-hMPG-VP64 vector, the A-to-C base editing efficiency is improved by about 2.41 times (3.69%/1.53%), the highest A-to-T base editing efficiency at the target point is 2.20%, the lowest is 1.11%, the average efficiency is 1.58%, compared with the pAYBEv2-hMPG-VP64 vector, the A-to-T base editing efficiency is improved by about 3.61 times (2.20%/0.61%), compared with the pAYBEv3-hMPG-VP64 vector, the A-to-T base editing efficiency is improved by about 1.57 times (2.20%/1.40%), the highest A-to-Y base editing efficiency at the target point is 5.89%, the highest efficiency is 4.58%, and the A-to-T base editing efficiency is improved by about 3.61 times (2.20%/0.61%) compared with the pAYBEv2-hMPG-VP64 vector, and the A-to-Y base editing efficiency is improved by about 9.61%); compared with pAYBEv3-hMPG-VP64 vector, the A-to-Y base editing efficiency is improved by about 2.08 times (5.89%/2.83%), the highest index event efficiency at the target point is 1.31%, the lowest index event efficiency at the target point is 0.66%, the highest A-to-G base editing efficiency at the target point is 12.34%, and the lowest index event efficiency at the target point is 7.74%; the highest A-to-C base editing efficiency at OsWaxy-T3 target point is 1.41%, the lowest is 1.21%, the average efficiency is 1.34%, compared with pAYBEv3-hMPG-VP64 vector, the highest A-to-C base editing efficiency is about 1.88 times (1.41%/0.75%), the highest A-to-T base editing efficiency at target point is 2.79%, the lowest is 1.84%, the average efficiency is 2.25%, compared with pAYBEv 2-mMPG vector, the A-to-T base editing efficiency is about 2.13 times (2.79%/1.31%), compared with pAYBEv3-hMPG-VP64 vector, the A-to-T base editing efficiency is about 5.69 times (2.79%/0.49%), the highest A-to-Y base editing efficiency at target point is 4.20%, the lowest is 3.05%, the average efficiency is 3.59%, compared with YBpAEv 2-mMPG base, the A-to-T base editing efficiency is about 2.13 times (2.79%/1.31%), the highest A-to-T base editing efficiency is about 5.69 times (2.79%/0.49%), compared with pAYBEv3-hMPG-VP64 vector, the highest efficiency is about 4.20% to 3.20%, and the highest efficiency is about 3.20.20%. In summary, compared with the pAYBEv2-mhMPG vector, the A-to-C editing efficiency of the pAYBEv4-mhMPG-VP64 vector is improved by about 3.06-5.15 times, the A-to-T editing efficiency is improved by about 1.97-3.18 times, and the A-to-Y editing efficiency is improved by about 3.21-7.43 times; compared with pAYBEv3-hMPG-VP64 vector, the A-to-C editing efficiency of pAYBEv4-mhMPG-VP64 vector is improved by about 1.27-5.67 times, the A-to-T editing efficiency is improved by about 1.57-6.57 times, and the A-to-Y editing efficiency is improved by about 1.46-5.21 times.

TABLE 3 efficiency of editing pAYBEs in rice protoplasts at different target sites A-to-C bases

TABLE 4 efficiency of pAYBEs editing at different target sites A-to-T bases in rice protoplasts

TABLE 5 efficiency of editing pAYBEs at different target sites A-to-Y bases in rice protoplasts

/>

TABLE 6 efficiency of editing pAYBEs at different target sites A-to-G bases in rice protoplasts

TABLE 7 efficiency of editing pAYBEs in rice protoplasts at different target indel bases

/>

3. Statistical analysis results of pAYBEs editing window in protoplasts

In the protoplast test result, pAYBES vectors realize the transversion of the base A-to-Y at the targets of OsDEP1, osEPSPS, osNRT1.1B, oswall-T1, oswall-T2, oswall-T3 and the like. The pAYBEv2-mhMPG vector and pAYBEv3-hMPG-VP64 vector mediated base A-to-Y subversion mainly occurs at the A5 and A6 positions (figure 5), wherein the A-to-C editing efficiency of the pAYBEv3-hMPG-VP64 vector at the A5 and A6 positions is about 2 times that of the pAYBEv2-mhMPG vector, and the A-to-T editing efficiency is not obviously different. Compared with pAYBEv2-mhMPG vector and pAYBEv3-hMPG-VP64 vector, the pAYBEv4-mhMPG-VP64 vector has remarkably improved A-to-Y transversion editing efficiency at A5 and A6 positions, and meanwhile, an editing window is expanded, and the A-to-Y editing efficiency at A4 and A8 positions is remarkably improved (figure 5).

4. Statistical analysis of Indel event genotype in protoplasts of pAYBEs

CRISPR/nCas9 (D10A) cleaves only the target strand under the guide of gRNA, resulting in DNA nicking at the target strand. Adenine deaminase of plant pAYBE catalyzes and deaminates adenine (A) to produce hypoxanthine (I), and MPG protein can remove hypoxanthine to form abasic site AP site (Apurinic site) and repair DNA double chains through DNA polymerase mismatch, so that base inversion of base A-to-Y is realized; at the same time, since nCas9 (D10A) cleaves the target strand while there is an opportunity for the AP site on the non-target strand to form a staggered double strand break (double strand break, DSB), a precise Indel editing event is generated at the target site by cross-lesion repair and replication (fig. 1).

In the protoplast test result, pAYBES vectors detect small fragment precise deletion events at targets such as OsDEP1, osEPSPS, osNRT1.1B, oswall-T1, oswall-T2 and the like. Taking pAYBEv4-mhMPG-VP64 vector as an example (FIG. 6), in the OsDEP1 target, the deletion fragments are different from 7bp to 10bp, wherein the fragment deletion efficiency between the A8 site and the A14 site is 0.81%, and the occurrence efficiency of the deletion fragment event between the A8 site and the nCas9 (D10A) cleavage site is 0.47%. In the OsEPSPS target, the deletion fragments are unequal from 6bp to 13bp, wherein the occurrence efficiency of the deletion fragment event between the A5 site and the nCas9 (D10A) cutting site is 0.62%, the deletion efficiency of the fragment between the A6 site and the C14 site is 0.97%, and the deletion efficiency of the fragment between the A9 site and the C14 site is 1.10%. In the OsNRT1.1B target, the deletion fragment is from 4bp to 12bp, wherein the occurrence efficiency of the deletion fragment event between the G7 site and the nCas9 (D10A) cutting site is 0.87%, the deletion efficiency of the fragment between the A9 site and the A12 site is 0.92%, the deletion efficiency of the fragment between the G7 site and the C18 site is 0.66%, and meanwhile, A9 bp small fragment is inserted between the A16 site and the A17 site, and the efficiency is 0.44%.

3. Agrobacterium-mediated stable genetic transformation of rice and genotyping and phenotypic analysis

1. Agrobacterium-mediated stable genetic transformation of rice

Selecting flower 11 seeds in full rice varieties, peeling off seed coats, sterilizing, washing and soaking, uniformly spotting on a sterilized R1 solid culture medium, and culturing at the dark place of 28 ℃ for 4-6 weeks to induce callus formation; the callus particles with compact state are selected and placed on a new R1 subculture medium, and after about 1 week of culture, the callus particles are used for agrobacterium-mediated genetic transformation of rice callus.

The prepared agrobacterium (EHA 105 competent, purchased from Zhuang Mengguo company, cat# ZC 142) was inoculated in 10mL of LB liquid medium containing the corresponding antibiotic and cultured with shaking at 28 ℃ for 12 hours; when culturing to logarithmic phase, collecting agrobacterium thallus, re-suspending agrobacterium with AAM invasion solution, soaking the cultured rice callus into the re-suspension for 30 min; transferring the infected callus to an R2 culture medium for co-culture for 3 days; transferring to an R1 screening culture medium with 50mg/L hygromycin for screening culture after the co-culture is finished, and culturing at 28 ℃ for 4-6 weeks; selecting a callus which grows well and is yellowish, transferring the callus to an R4 differentiation medium by using sterile forceps, and continuously culturing at 28 ℃; seedlings to be differentiated grow to 2-5 cm, and are transferred into an R5 rooting medium to be cultured for 2-3 weeks, so that the resistance T is obtained ₀ The plants (regenerated plants) are transferred into soil and placed in a greenhouse for growth (the temperature is 28-30 ℃ and the light is 16 hours/the darkness is 8 hours).

2. Genotyping of regenerated plants

Genotype detection and analysis are carried out on the regenerated plants obtained by screening in the step 1, and a CTAB extraction method is used for extracting T ₀ Genomic DNA of the generation plant, T ₀ And taking the genome DNA of the generation plant as a template, carrying out PCR amplification to obtain a target gene fragment, and carrying out genotype detection and analysis on the regenerated plant obtained by screening. The primers used for genotyping are shown in Table 8.

TABLE 8 primer list for genotype detection

/>

PCR amplification system: 15. Mu.L of 2 XTaq enzyme, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, 1. Mu.L of genomic DNA template (100 ng/. Mu.L), 12. Mu.L of ddH ₂ O。

PCR amplification procedure: 98 ℃ for 3min;98 ℃ for 15s;60 ℃ for 15s;72 ℃,30s;35 cycles; 72 ℃ for 5min; maintained at 16 ℃.

The PCR amplified products were subjected to Sanger sequencing and aligned with the wild-type genomic sequence to identify the type of editing.

3. Paybes-mediated genotyping of rice plants

The invention tests the editing activity of different pAYBEs in rice plants. Specific detection cases are shown in fig. 7, 8, 9, 10, table 9, and table 10.

pAYBEv1-hMPG vector obtains 86 clusters of transgenic T in OsDEP1 target spot ₀ And replacing seedlings, wherein the occurrence of indel events is detected at target spots by 3 clusters of seedlings (# 12, #25, # 55), the occurrence efficiency of indel events is 3.49%, the occurrence of A-to-G editing events is detected by 81 clusters of seedlings, and the A-to-G editing efficiency is 94.19%. 52 clusters of transgenic T are obtained at OsEPSPS target spot ₀ Instead of seedlings, no A-to-Y editing or indel event was detected, and 19 seedlings detected the occurrence of the A-to-G editing event with an A-to-G editing efficiency of 36.54%. 88 clusters of transgenic T are obtained at OsNRT1.1B target spot ₀ And replacing seedlings, wherein the occurrence of indel events is detected at the target spots by 3 clusters of seedlings (# 12, #15, # 34), the occurrence efficiency of the indel events is 3.41%, the occurrence of A-to-G editing events is detected by the rest 79 clusters of seedlings, and the A-to-G editing efficiency is 89.77%. 53 clusters of transgenes T are obtained on Oswall-T1 target spot ₀ Seedlings were replaced, no A-to-Y editing or indel events were detected, 34 clustersSeedlings all detected the occurrence of an A-to-G editing event with an A-to-G editing efficiency of 64.15%. 99 clusters of transgenes T are obtained at Oswall-T2 target spot ₀ The seedlings were replaced, wherein 3 clusters of seedlings (# 31, #29, # 48) detected an A-to-T editing event with genotype of bi-allelic state at the target point, the A-to-T editing efficiency was 2.02%, wherein #31 had 4 individuals, #48 and #29 were identical in genotype and were the same callus source, and 3 individuals and 1 individual were contained respectively. In addition, 8 seedlings (# 23, #25, #27, #38, #48, #77, #78, # 92) were genotyped and detected the occurrence of indel event at the target site with 8.08% efficiency of indel event occurrence, 9bp insert was replicated at the target site, 93 seedlings detected A-to-G editing event, and 93.94% efficiency of A-to-G editing. 71 clusters of transgenic T are obtained on Oswall-T3 target spot ₀ Instead of seedlings, no A-to-Y editing or indel event was detected, 61 seedlings all detected an A-to-G editing event with an A-to-G editing efficiency of 85.92%. Meanwhile, according to analysis of deep sequencing results, the occurrence window of accurate deletion and insertion fragments is concentrated at the A4-A6 to nCas9 (D10A) cutting sites, and at most, 14bp deletion and 9bp insertion can be caused. These results indicate that pAYBEv1-hMPG vector can realize base editing of A-to-Y and can also cause precise insertion and deletion of small fragments.

pAYBEv3-hMPG-VP64 vector obtains 56 clusters of transgenic T in OsDEP1 target spot ₀ And replacing seedlings, wherein no A-to-Y editing event is detected at the target point, 14 clusters of seedlings (# 49, #3, #12, #25, #32, #33, #34, #36, #38, #39, #52, #31, #37, # 40) detect the occurrence of an indel event at the target point, the indel event occurrence efficiency is 25.00%, 51 clusters of seedlings detect the occurrence of an A-to-G editing event, and the A-to-G editing efficiency is 91.07%. pAYBEv3-hMPG-VP64 vector obtains 76 clusters of transgenic T in OsEPSPS target spot ₀ And replacing seedlings, wherein the occurrence of an A-to-Y editing event is not detected at a target point, 1 cluster of seedlings (# 23) genotype detects the occurrence of an indel event at the target point, the indel event occurrence efficiency is 1.32%, 44 clusters of seedlings detect the occurrence of an A-to-G editing event, and the A-to-G editing efficiency is 57.89%. pAYBEv3-hMPG-VP64 vector obtains 76 clusters of transgenes on OsNRT1.1B target spot T ₀ 1 cluster of seedlings (# 5) genotype detected A-to-T editing event at target point, A-to-T editing efficiency was 1.32%, 3 single plants were in #5 line, and double allele state A6>T6 editing event, 1 cluster of seedlings (# 3) detected the occurrence of indel event at the target point, the indel event occurrence efficiency was 1.32%, 64 clusters of seedlings detected the occurrence of A-to-G editing event, and the A-to-G editing efficiency was 84.21%. pAYBEv3-hMPG-VP64 vector obtains 65 clusters of transgenic T in Oswall-T1 target spot ₀ 1 cluster of seedlings (# 14) were used for seedling replacement, an editing event with genotype A-to-T was detected at the target site, the A-to-T editing efficiency was 1.54%, and strain #14 contained 2 single plants as strain A5>T5、A6>T6 heterozygous State editing event, in addition, 13 seedlings (# 2, #25, #28, #30, #32, #55, #58, #49, #13, #20, #3, #7, # 63) genotype detected the appearance of indel event at the target spot, the indel event occurrence efficiency was 20.00%, all 42 seedlings detected A-to-G editing event, and the A-to-G editing efficiency was 64.62%. pAYBEv3-hMPG-VP64 vector obtains 79 clusters of transgenic T in Oswall-T2 target spot ₀ For seedling replacement, 3 clusters of seedlings (# 12, #3, # 42) detect editing events with genotype A-to-T at target points, the A-to-T editing efficiency is 2.53%, and compared with pAYBEv1-hMPG vector, the A-to-T editing efficiency at Oswall-T2 target points is improved by 1.25 times (2.53%/2.02%). Wherein strain #12 is in the biallelic state A5 >T5 editing event, comprising single 3 strains, the same genotype of #3 and #42 strains is regarded as the same transformation event, A5>T5 heterozygous editing plants respectively comprise 1 plant and 2 plants. In addition, 15 seedlings were genotyped to detect the occurrence of indel event at the target point, the indel event occurrence efficiency was 18.99%, 66 seedlings were all detected with A-to-G editing event, and the A-to-G editing efficiency was 83.54%. pAYBEv3-hMPG-VP64 vector obtains 74 clusters of transgenic T in Oswall-T3 target spot ₀ For the generation of seedlings, 7 clusters of seedlings (# 33, #40, #70, #43, #53, #54, # 55) detected editing events with genotype A-to-T at the target site, and A-to-T editing efficiency was 9.46%. Wherein the strain #33 contains T5>The double allele editing plant of A5 editing event contains single plant 2, and #40 strain contains T6>The double allele editing plants of A6 editing event comprise single 2 strains, #70 strainsIs composed of T5>Heterozygous editing plants of the A5 editing event comprise editing plants with single plants 2, and the strains of #43, #53, #54, #55 and the like in chimeric state, and respectively comprise single plants 1, 2 and 1; in addition, 4 seedlings were genotyped to detect the occurrence of indel event at the target point, the indel event occurrence efficiency was 5.41%, and 54 seedlings were all detected with A-to-G editing event, and the A-to-G editing efficiency was 72.97%.

pAYBEv4-mhMPG-VP64 vector obtains 82 clusters of transgenic T in OsDEP1 target spot ₀ For seedling replacement, 9 clusters of seedlings (# 34-1, #35, #40-1, #42, #44-1, #44-2, #44-3, #65, # 99) detect an A-to-T editing event at a target point, the A-to-T editing efficiency is 10.98%, and compared with pAYBev3-hMPG-VP64 vector, editing of a stable strain is realized for the first time at an OsDEP1 target point. Wherein the #42 strain has 1 single strain containing A5>Homozygous editing plants for T5 editing event, 3 individual plants for strain #35, and strains #44-1, #44-2, #44-3, etc. were A5-containing>Heterozygous editing plants of T5 editing event, wherein #65 and #99 contain 3 and 1 single plants respectively, and #65, #34-1, #40-1 and other strains all contain A6>Chimeric editing plants for T6 editing event. In addition, 28 seedlings (# 1, #2, #3, #7, #8, #9, #11, #20, #22, #25, #31, #36, #38, #40, #41, #44, #45, #46, #47, #48, #55, #56, #57, #58, #63, #65, #71, # 74) detected the appearance of the indel event at the target site, with an indel event occurrence efficiency of 34.15%, where multiple types of small fragment insertions were replicated at the target site, deleted fragments were concentrated at the A5 locus to nCas9 cut, 64 seedlings all detected the A-to-G editing event, and A-to-G editing efficiency was 78.05%. pAYBEv4-mhMPG-VP64 vector obtains 65 clusters of transgenic T in OsEPSPS target spot ₀ And replacing seedlings, wherein the occurrence of an A-to-Y editing event is not detected at the target point. Wherein 1 cluster of seedlings (# 23) genotype detected the occurrence of indel event at the target spot, the indel event occurrence efficiency was 1.54%, and 33 clusters of seedlings detected the occurrence of A-to-G editing event, and the A-to-G editing efficiency was 50.77%. pAYBEv4-mhMPG-VP64 vector obtains 90 clusters of transgenic T in OsNRT1.1B target spot ₀ The seedlings were replaced, and 2 clusters of seedlings (# 61, # 89) detected genotype A at the target-to-T editing event with a-to-T editing efficiency of 2.22%, 1.68-fold (2.22%/1.32%) improvement in osnrt1.1b target a-to-T editing efficiency compared to the pambi 3-hMPG-VP64 vector. Wherein the #61 strain has 4 individual strains containing A4>Bi-allelic editing plants of T4 editing event, 1 individual in #89 lines, containing A4>Chimeric editing plants of T4 editing event. In addition, the occurrence of indel event was detected at the target point by 5 clusters of seedling genotypes, the indel event occurrence efficiency was 5.56%, and the A-to-G editing event was detected by 74 clusters of seedlings, and the A-to-G editing efficiency was 82.22%. pAYBEv4-mhMPG-VP64 vector obtains 71 clusters of transgenic T on Oswall-T1 target spot ₀ For seedling replacement, 5 clusters of seedlings (# 64, #51, #2, #49, # 50) detect editing events with genotypes of A-to-T at the target points, wherein #2, #49, #50 strains have consistent genotypes and are regarded as the same transformation event, the A-to-T editing efficiency is 4.23%, and compared with pAYBev3-hMPG-VP64 vector, the A-to-T editing efficiency is improved by 2.75 times (4.23%/1.54%) at the Oswall-T1 target point. The #2, #49 and #50 lines contained 3, 1 and 2 single lines, respectively, and T5 was contained >A5、T6>Heterozygous editing plants with A6 editing event, 4 single plants in #64 lines, containing double T5>A5、T6>Double allele editing plants of A6 editing event, #51 lines with 2 individuals, containing T5>A5、T6>Chimeric editing plants for the A6 editing event. In addition, 10 seedlings (# 2, #3, #7, #13, #20, #25, #28, #58, #59, # 63) were genotyped to detect the occurrence of indel event at the target site, the indel event occurrence efficiency was 14.08%, and 45 seedlings detected A-to-G editing event, and the A-to-G editing efficiency was 63.38%. pAYBEv4-mhMPG-VP64 vector obtains 82 clusters of transgenic T on Oswall-T2 target spot ₀ For seedling replacement, 7 clusters of seedlings (# 6, #20, #27, #32, #56, #39, # 74) detect an editing event with genotype A-to-T at a target point, the A-to-T editing efficiency is 8.54%, and compared with pAYBEv3-hMPG-VP64 vector, the A-to-T editing efficiency at an Oswall-T2 target point is improved by 3.38 times (8.54%/2.53%). Wherein #6, #20, #27, #32, #56 are A5-containing>Double allele editing plants of T5 editing event respectively contain 3, 1, 4, 3 and 5 single plants, #39 and #74 containing A5>Chimeric editing plants of the T5 editing event contained individual 2 and 1 plants, respectively. In additionThere were 21 clusters of seedlings (# 2, #3, #4, #5, #7, #8, #10, #13, #15, #16, #20, #21, #25, #27, #28, #29, #81, # 82) genotypes detected the occurrence of indel events at the target spot with an indel event occurrence rate of 25.61%. A-to-G editing event was detected for 62 seedlings, with an A-to-G editing efficiency of 75.61%. pAYBEv4-mhMPG-VP64 vector obtains 58 clusters of transgenic T on Oswall-T3 target spot ₀ For the replacement, 10 clusters of seedlings (# 34, #6, #15, #37, #3, #4, #31, #36, #47, # 51) detected an editing event with genotype A-to-T at the target site, the A-to-T editing efficiency was 17.24%, and the A-to-T editing efficiency was improved by 1.82 times (17.24%/9.46%) at the Oswall-T3 target site compared with pAYBev3-hMPG-VP64 vector. Wherein strain #34 contains T6>The double-allele editing plants of the A6 editing event comprise 3 single plants; strains #6, #15, #37 and the like contain T5>Heterozygous editing plants of the A5 editing event respectively contain 2 single plants, 2 single plants and 3 single plants; strains #3, #4, #31, #36, #47, #51 contain T5>The chimeric editing plants of the A5 editing event respectively contain 2, 1, 3, 2 and 1 single plants. In addition, 6 seedlings (# 15, #16, #25, #31, #47, # 54) genotypes detected the occurrence of the indel event at the target spot, the indel event occurrence efficiency was 10.34%, and 37 seedlings detected the A-to-G editing event, and the A-to-G editing efficiency was 63.79%.

TABLE 9 statistics of efficiency of rice stable transformants pAYBEs

/>

Note that: the PAM sequence is underlined.

Table 10, genotype list of stable A-to-Y Rice transformants

/>

Note that: PAM sequences are underlined; the number of individual plants per line is included in brackets; A-to-Y base editing marks are thickened;

Ho represents homozygosity; he represents heterozygosity; bi represents Bi-allelic; chi represents the fit.

4. Single base editing A to Y off-target detection of plants

Predicting an off-target according to a CRISPR-GE (http:// skl. Scau. Edu. Cn /) website, searching a sequence, designing a corresponding primer pair A-to-Y editing strain, carrying out amplification identification on the off-target site similar to the targets of OsDEP1, osEPSPS, osNRT1.1B, osWaxy-T1, osWaxy-T2, osWaxy-T3 and the like, and after PCR amplification is sequenced by Sanger, displaying that no editing event occurs at the predicted off-target site. Details of the off-target site sequence information are shown in Table 11.

TABLE 11 off-target site analysis

Note that: PAM sequences are underlined; the thickened base is the mismatch base between the off-target site and the target spot.

Claims

1. A kit of parts, said kit of parts being any one of the following M1) -M4):

2. The kit of claim 1, wherein: the adenine deaminase TadA8e is A1) or A2):

a1 Amino acid sequence is a protein shown in sequence 2;

3. The kit of claim 1 or 2, wherein: the Cas9 (D10A) nickase is B1) or B2):

B1 Amino acid sequence is a protein shown in sequence 3;

4. A kit according to any one of claims 1-3, wherein: the human alkyl adenine DNA glycosylase hMPG is C1) or C2):

c1 Amino acid sequence is a protein shown in sequence 6;

5. The kit of any one of claims 1-4, wherein: the transactivator Vp64 is D1) or D2):

d1 Amino acid sequence is a protein shown in sequence 9;

6. The kit of any one of claims 1-5, wherein: the kit further comprises a screening agent resistance protein;

or, the screening agent resistance protein is hygromycin phosphotransferase;

or, the hygromycin phosphotransferase is E1) or E2):

E1 Amino acid sequence is a protein shown in sequence 4;

7. Use of the kit of any one of claims 1-6 in any one of the following S1) -S9):

s1) editing plant genome sequences;

s2) preparing an edited product of plant genome sequences;

s3) improving the editing efficiency of the plant genome sequence;

s5) expanding an editing window of a plant genome sequence;

s7) preparing a plant mutant;

s8) plant breeding;

s9) preparing a plant breeding product.

8. The method as set forth in any one of T1) -T4):

t1) editing method of plant genome sequence, comprising the following steps: allowing plants to express the kit of claim 1 to effect editing of plant genomic sequences;

t2) a method for increasing the editing efficiency of a plant genome sequence, comprising the steps of: allowing plants to express the kit of claim 1 to achieve increased editing efficiency of plant genomic sequences;

T3) expanding the editing window of plant genomic sequences, comprising the steps of: allowing plants to express the set of systems of claim 1 to enable expansion of the editing window of plant genomic sequences;

t4) a method for preparing a plant mutant, comprising the steps of: allowing plants to express the plant set of claim 1 to obtain plant mutants.

9. The kit according to any one of claims 1-6 or the use according to claim 7 or the method according to claim 8, characterized in that: editing the plant genome sequence comprises the step of transversing a base A in the plant genome sequence into a base C or a base T.

10. The kit according to any one of claims 1-6 or the use according to claim 7 or the method according to claim 8, characterized in that: the plant is X1) or X2) or X3):

x1) monocotyledonous or dicotyledonous plants;

x2) a gramineous plant;

x3) rice.