CN116426691A

CN116426691A - Multi-target detection of crRNA of HIV-1, CRISPR-Cas12a system and detection method

Info

Publication number: CN116426691A
Application number: CN202310216989.9A
Authority: CN
Inventors: 金聪; 张鑫
Original assignee: NATIONAL CENTER FOR AIDS/STD CONTROL AND PREVENTION CHINESE CENTER FOR DISEASE CONTROL AND PREVENTION
Current assignee: NATIONAL CENTER FOR AIDS/STD CONTROL AND PREVENTION CHINESE CENTER FOR DISEASE CONTROL AND PREVENTION
Priority date: 2023-03-08
Filing date: 2023-03-08
Publication date: 2023-07-14

Abstract

The invention discloses crRNA for detecting HIV-1 CRISPR-Cas12a, a CRISPR-Cas12a system containing the crRNA, an HIV-1RT-RAA/CRISPR detection method and a kit. The detection method has the characteristics of wide subtype universality, high sensitivity, high specificity and the like, and is suitable for detecting various common and unusual subtypes of HIV-1. The invention can complete the amplification and detection of HIV-1 nucleic acid within 35 minutes, thus being capable of becoming an on-site rapid detection method of HIV-1.

Description

Multi-target detection of crRNA of HIV-1, CRISPR-Cas12a system and detection method

Technical Field

The invention relates to the field of detection of AIDS. More particularly, the invention relates to a primer group for amplifying HIV-1 nucleic acid mediated amplification, CRISPR-Cas12a crRNA for multi-target detection of HIV-1 nucleic acid, a CRISPR-Cas12a system, and an HIV-1RT-RAA/CRISPR detection method and a kit.

Background

Acquired immunodeficiency syndrome (Acquired immune deficiency syndrome, AIDS), also known as AIDS, is a chronic infectious disease caused by the human immunodeficiency virus (Human immunodeficiency virus, HIV). One key element in terminating the prevalence of aids is the detection of HIV-infected persons, and previous studies have found that HIV-infected persons who have not been diagnosed, particularly those with acute stage infections, are important causes of HIV infection transmission. Early detection of infected persons and antiviral treatment at early stage of infection can effectively improve antiviral treatment effect and effectively reduce transmission risk by inhibiting virus replication in vivo. Thus, early diagnosis of HIV infection is of great public health importance for preventing transmission of HIV.

So far, globally prevalent HIV can be divided into two genotypes, HIV-1 and HIV-2.HIV-1 is widely distributed throughout the world and is the primary pathogen responsible for the worldwide epidemic of AIDS. HIV-1 can be further divided into M, N, O, P groups, where M strains are the major strains responsible for global aids epidemics, including at least A, B, C, D, F, G, H, J, K and L10 different subtypes, as well as multiple epidemic recombinants (circulating recombinant form, CRF) and unique recombinants (unique recombinant form, URF). In China, HIV-1 is taken as a main epidemic strain, main subtypes comprise CRF01_AE, CRF07_BC, CRF08_BC, B and the like, new epidemic recombinant types (such as CRF55_ B, CRF85_BC and the like) and unique recombinant types (such as 0107, 01B, 01BC, 01C and the like) are continuously discovered in recent years, and the occurrence of missed detection of detection reagents can be caused by the gene sequence diversity among different HIV-1 subtypes.

There are various commercial HIV-1 nucleic acid detection kits based on different technologies, such as reverse transcription PCR technology (Reverse transcriptase-polymerase chain reaction, RT-PCR), nucleic acid sequence dependent amplification (Nucleic acid sequence-based amplification, NASBA) technology, branched DNA (branched DNA signal amplification, bDNA) technology, real-time fluorescent PCR quantification technology (Quantitative real-time PCR, qPCR), etc., but these detection reagents generally have complicated experimental procedures, rely on temperature-changing equipment, have high cost, and require more than 3 hours for detection time, which have led to HIV-1 nucleic acid detection usually being carried out in large hospitals or laboratories, limiting the popularization and application of HIV-1 nucleic acid detection in resource-limited basic medical institutions.

Therefore, there is a need in the art for an HIV-1 nucleic acid detection method that has broad subtype versatility, high sensitivity, high specificity, and short detection time.

Disclosure of Invention

In order to solve the defects of the existing detection method, the inventor provides a method for detecting HIV-1 by combining reverse transcription-recombinase mediated amplification (Reverse transcription recombinase aided amplification, RT-RAA) and a CRISPR-Cas12a detection system, namely HIV-1RT-RAA/CRISPR. The detection method has the characteristics of wide subtype universality, high sensitivity, high specificity, short detection time and the like. Thus, the present invention was achieved.

Accordingly, in a first aspect, there is provided crRNA for CRISPR-Cas12a for detecting HIV-1, the crRNA being a repeat sequence and a target-specific sequence in order from the 5 'end to the 3' end, wherein the target-specific sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID No.25, SEQ ID No.26 or SEQ ID No. 27:

SEQ ID NO.25：GGGUUUAUUACAGRGACARCAGAGA；

SEQ ID NO.26：UAUGUCUGUUGCUAUUAURUC；

SEQ ID NO.27：CCCUGCACUGUACCCCCCAAUCC。

in a second aspect, there is provided a CRISPR-Cas12a system for detecting HIV-1, comprising: cas12a protein, and one, two, or three of the crrnas of the first aspect.

In a third aspect, there is provided the use of the crRNA for CRISPR-Cas12a for detecting HIV-1 of the first aspect or the CRISPR-Cas12a system of the second aspect for the preparation of an aids diagnostic reagent.

In a fourth aspect, there is provided a method of detecting HIV-1 comprising the steps of:

(1) Providing an HIV-1 nucleic acid sample;

(2) Preparing a CRISPR-Cas12a detection cocktail comprising:

a) Cas12a protein, and one, two or three of the crrnas of the first aspect, or

b) The CRISPR-Cas12a system for detecting HIV-1 of the second aspect;

(3) Performing an amplification reaction on the HIV-1 nucleic acid sample to obtain an amplification product;

(4) The amplification product is mixed and reacted with the CRISPR-Cas12a detection cocktail and the presence or absence of HIV-1 is determined by fluorescence of a fluorescence quenching reporter.

In a fifth aspect, there is provided a kit for detecting HIV-1, comprising:

a) The CRISPR-Cas12a of the first aspect uses crRNA and Cas12a protein, or the CRISPR-Cas12a system of the second aspect;

b) Instructions for use of the kit; and

c) Optionally, a primer set for amplifying HIV-1 nucleic acid:

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3)

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10);

d) Optionally, the reporter is fluorescence quenched.

The invention has the beneficial effects that:

The invention provides a method for detecting HIV-1 by combining RT-RAA and CRISPR-Cas12a detection technology, namely HIV-1RT-RAA/CRISPR, and the detection performance of the detection method is primarily evaluated by using HIV-1 recombinant plasmids and clinical samples. Firstly, the invention screens out a plurality of target specific crRNAs which can be used for CRISPR-Cas12a, and realizes multi-target detection by utilizing the combination of the crRNAs, thereby avoiding the occurrence of missed detection caused by HIV-1 sequence diversity. And secondly, the reagents used by the two technologies are integrated in the same reaction tube, the cover is not required to be opened, and the detection process is simpler.

Compared with the prior art, the HIV-1RT-RAA/CRISPR detection method has the advantages of wide subtype universality, high sensitivity, high specificity, rapid detection completion and the like, and can complete HIV-1 nucleic acid amplification and detection within 35 minutes, so that the method can be used as a beneficial supplement of the existing HIV-1 detection method. Compared with the existing nucleic acid detection technology, the method is more suitable for popularization and use in basic medical institutions with limited resources, and provides a powerful detection tool for promoting early detection and early discovery of HIV-1 infected persons.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a schematic diagram of the CRISPR-Cas12a system recognition and detection of target nucleic acids.

FIG. 2 shows subtype organization of the HIV-1 sequence set.

FIG. 3 shows a schematic diagram of RAA primer and probe positions and lengths.

FIG. 4 shows the results of detection for screening RAA upstream primers.

FIG. 5 shows the results of detection for the screening of RAA downstream primers.

FIG. 6 shows the results of detection of recombinant plasmid selection primer combinations using 4 HIV-1 subtypes (CRF01_AE (labeled "01 AE"), CRF07_BC (labeled "07 BC"), CRF08_BC (labeled "08 BC"), B).

FIG. 7 shows the results of RT-RAA detection under different reaction conditions.

FIG. 8 shows a schematic representation of crRNA position and length.

Fig. 9 shows the detection results of crRNA validation.

Fig. 10 shows the detection results at different concentrations of Cas12a and crRNA.

FIG. 11 shows the detection results of the method of the present invention for 10 HIV subtypes (CRF07_BC, CRF01_AE, CRF08_BC, B, CRF55_ B, CRF85_BC, 0107, BC, 01BC and 01C).

Detailed Description

Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It is to be understood that the following description is intended to illustrate the invention by way of example only, and is not intended to limit the scope of the invention as defined by the appended claims. And, it is understood by those skilled in the art that modifications may be made to the technical scheme of the present invention without departing from the spirit and gist of the present invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided to better understand the present invention.

Where a range of values is provided, such as a range of concentrations, a range of percentages, or a range of ratios, it is to be understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of the range, and any other stated or intervening value in that stated range, is encompassed within the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the subject matter.

In the context of the present invention, many embodiments use the expression "comprising", "including" or "consisting essentially/mainly of … …". The expression "comprising," "including," or "consisting essentially of … …" is generally understood to mean an open-ended expression that includes not only the individual elements, components, assemblies, method steps, etc., specifically listed thereafter, but also other elements, components, assemblies, method steps. In addition, the expression "comprising," "including," or "consisting essentially of … …" is also to be understood in some instances as a closed-form expression, meaning that only the elements, components, assemblies, and method steps specifically listed thereafter are included, and no other elements, components, assemblies, and method steps are included. At this time, the expression is equivalent to the expression "consisting of … …".

For a better understanding of the present teachings and without limiting the scope of the present teachings, all numbers expressing quantities, percentages or proportions used in the specification and claims, and other numerical values, are to be understood as being modified in all instances by the term "about" unless otherwise indicated. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

In a first aspect, there is provided crRNA for CRISPR-Cas12a for detecting HIV-1, the crRNA being a repeat sequence and a target-specific sequence in order from the 5 'end to the 3' end, wherein the target-specific sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID No.25, SEQ ID No.26, or SEQ ID No. 27:

SEQ ID NO.25：GGGUUUAUUACAGRGACARCAGAGA；

SEQ ID NO.26：UAUGUCUGUUGCUAUUAURUC；

SEQ ID NO.27：CCCUGCACUGUACCCCCCAAUCC。

in the present invention, the repeated sequence of the crRNA is a sequence common to Cas12a, which binds to Cas12a protein by forming a unique secondary structure. Those skilled in the art understand that the length and bases of the repeat sequence can be changed without changing its secondary structure. As an example, the repeated sequence may be a sequence shown in AAUUUCUACUCUUGUAGAU (SEQ ID No. 28) or UAAUUUCUACUAAGUGUAGAU (SEQ ID No. 29), but is not limited thereto.

In a specific embodiment, the crRNA is a crRNA as set forth in SEQ ID No.22, SEQ ID No.23, or SEQ ID No. 24:

SEQ ID NO.22：AAUUUCUACUCUUGUAGAUGGGUUUAUUACAGRGACARCAGAGA；

SEQ ID NO.23：AAUUUCUACUCUUGUAGAUUAUGUCUGUUGCUAUUAURUC；

SEQ ID NO.24：AAUUUCUACUCUUGUAGAUCCCUGCACUGUACCCCCCAAUCC。

as can be seen from the sequence alignment, the sequences contained in the three crRNA sequences are the repeated sequences shown in SEQ ID NO. 28.

The CRISPR/Cas detection system depends on the trans-cleavage activity of class II Cas proteins, namely, cas proteins are activated after the target sequences are identified by the guidance of crRNA (or gRNA), and can cut the target sequences and simultaneously non-specifically cut surrounding fluorescence quenching reporter molecules with extremely high efficiency, so that the detection of the target sequences can be realized by releasing fluorescence signals. Currently commonly used Cas proteins are Cas12 and Cas13, which differ in that Cas12 recognizes DNA targets, while Cas13 recognizes RNA targets. The invention applies a Cas12a detection system, and the schematic diagram of the detection principle is shown in figure 1. Cas12a proteins mentioned in the context of the present invention may be selected from a variety of Cas12a proteins of the Cas12a protein family, such as, but not limited to, fnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a or Lb4Cas12a proteins.

In addition, herein, the Cas12a protein may be used in combination with a single crRNA, or may be used in combination with the three crrnas.

In a preferred embodiment, the CRISPR-Cas12a system comprises three of the crrnas of the first aspect.

In a more preferred embodiment, the CRISPR-Cas12a system comprises the crrnas shown in SEQ ID No.22, SEQ ID No.23, and SEQ ID No. 24.

Among the three crrnas shown in SEQ ID No.22, SEQ ID No.23 and SEQ ID No.24, the crRNA shown in SEQ ID No.23 has the best detection effect. When three crrnas are used in combination, preferably, the three crrnas are present in a 1:1:1 ratio, which increases the final fluorescence value, and the combination of the three crrnas prevents off-target events due to HIV-1 nucleic acid sequence variations, thereby increasing the versatility of the detection method for more HIV-1 subtypes.

In a preferred embodiment, the crrnas contained in the crRNA or the CRISPR-Cas12a system are three crrnas present in an equal ratio.

In a more preferred embodiment, the crRNA or the crRNA comprised in the CRISPR-Cas12a system is the crRNA shown in SEQ ID No.22, SEQ ID No.23 and SEQ ID No.24, which are present in equal ratios.

In a specific embodiment, the crRNA or CRISPR-Cas12a system is also used in combination with a primer set for amplifying HIV-1 nucleic acid for the preparation of an aids diagnostic reagent, the primer set comprising:

An upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3), and

a downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10).

In the above primer sequences, A represents adenine, G represents guanine, C represents cytosine, T represents thymine, R represents A/G, Y represents C/T, M represents A/C, K represents G/T, S represents C/G, W represents A/T, H represents A/T/C, B represents G/T/C, V represents G/A/C, D represents G/A/T, and N represents A/T/C/G.

Before the CRISPR-Cas12a system is adopted to detect the HIV-1 nucleic acid, the primer group is adopted to amplify the HIV-1 nucleic acid sample by using an amplification technology, so that the amount of the HIV-1 nucleic acid in the sample can be greatly enriched, and the CRISPR-Cas12a system can be adopted to detect the HIV-1 nucleic acid.

In a specific embodiment, the primer set may be used in a recombinase-mediated amplification reaction (recombinase aided amplification, RAA). Under the action of adenine nucleoside triphosphate (Adenosine triphosphate, ATP), the recombinase forms a complex with the specific primer, when the specific primer recognizes a complementary pairing sequence with the specific primer in a template DNA sequence, the template DNA is melted with the aid of a single-stranded DNA binding protein, and is replicated and extended under the action of DNA polymerase, so that the exponential growth of a reaction product is realized. HIV-1 is an RNA virus and it will be appreciated that a reverse transcription process is required prior to amplification, and thus the present invention employs RT-RAA technology.

The isothermal amplification technology can complete the reaction at a single temperature, so that the requirement of nucleic acid detection on experimental conditions is reduced. Among them, RAA has been widely used in recent years because of its rapid reaction rate, few steps, easy operation, and good tolerance to temperature fluctuations and base mismatches. However, non-specific amplification is likely to occur due to the lack of an annealing process like PCR in isothermal amplification techniques. The CRISPR-Cas system is used as a novel biosensing platform for detecting nucleic acid, and has the characteristics of high reaction speed and high specificity, but lower sensitivity. The CRISPR-Cas is combined with the nucleic acid amplification technology, so that the detection sensitivity can be effectively improved, and the specificity of the detection method can be improved by identifying the specific amplification product. The invention combines two technologies of RT-RAA and CRISPR-Cas12a, and successfully establishes an HIV-1RT-RAA/CRISPR detection method or kit. However, without wishing to be bound by theory, the primer set of the invention may also be used in a variety of other amplification techniques, such as qPCR, RT-PCR, NASBA, bDNA, recombinase polymerase amplification techniques (Recombinase Polymerase Amplification, RPA), enzymatic recombination isothermal amplification techniques (Enzymatic Recombinase Amplification, ERA), loop-mediated isothermal amplification techniques (Loop-mediated isothermal amplification, LAMP), helicase-dependent amplification techniques (helicase-dependent amplification, HAD), strand-displacement amplification techniques (Strand Displacement Amplification, SDA), rolling circle nucleic acid amplification techniques (Rolling Circle Amplification, RCA), and the like. Those skilled in the art will appreciate that primers for RAA can be generic to primers for RPA, ERA, etc.

Fluorescence quenching reporter molecules are also needed when using the CRISPR-Cas12a system to detect HIV-1. In this context, the fluorescence quenching reporter may be a single-stranded DNA with both fluorescence reporter and fluorescence quenching moiety labeled, and the Cas12a protein is capable of non-specifically cleaving the reporter such that its fluorescence reporter is separated from the fluorescence quenching moietyFluorescence is generated. Thus, in an optional embodiment, the CRISPR-Cas12a system is further used in combination with a fluorescence quenching reporter for the preparation of an aids diagnostic agent. In a preferred embodiment, the fluorescence quenching reporter may be labeled 5 'via a fluorescence reporter group such as FAM, HEX, etc., 3' via a fluorescence quenching group such as Iowa

FQ sequencher-labeled, single-stranded DNA comprising a site capable of cleavage by Cas12a, such as, but not limited to, 5 '-TTATT-3'.

The HIV-1 nucleic acid sample used in the context of the present invention may be of any origin, e.g. from a blood sample such as whole blood, serum, plasma, dried blood spots, etc., from a body fluid sample such as secretions, etc., or may be a sample synthesized artificially based on known nucleic acid sequences. In addition, it is also understood that the HIV-1 nucleic acid sample may be obtained by extraction by nucleic acid extraction techniques conventional in the art, and the nucleic acid extraction method and reagents are not particularly limited by the present invention.

(1) Providing an HIV-1 nucleic acid sample;

(2) Preparing a CRISPR-Cas12a detection cocktail comprising:

a) One, two or three of the Cas12a protein, and the crrnas of the first aspect; or alternatively

b) The CRISPR-Cas12a system for detecting HIV-1 of the second aspect of the present invention;

(3) Carrying out a recombinase mediated amplification reaction on the HIV-1 nucleic acid sample, thereby obtaining an amplification product;

It will be appreciated that the method of the present invention for detecting HIV-1 may be used for diagnostic purposes as well as for "non-diagnostic purposes" including, but not limited to, inspection and quarantine, epidemic prevention, and the like.

It will be appreciated that the HIV-1 nucleic acid sample used in the context of the present invention may be of any origin, e.g. from a blood sample such as whole blood, serum, plasma, dried blood spots, etc., from a body fluid sample such as secretions, etc., or may be artificially synthesized based on known nucleic acid sequences. In addition, it is also understood that the HIV-1 nucleic acid sample may be obtained by extraction by nucleic acid extraction techniques conventional in the art, and the nucleic acid extraction method and reagents are not particularly limited by the present invention.

It will also be appreciated that steps (1) - (4) in the above-described methods are for distinguishing purposes only and are not intended to be limiting as to the order of steps unless it is clear from the context that the steps must be performed in a particular order between them. For example, it will be appreciated by those skilled in the art that steps (1) and (2) are not required to be performed sequentially, may be performed simultaneously, or may be performed first and then step (2) may be performed.

In one exemplary embodiment, the Cas12a protein may be a FnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a, or Lb4Cas12a protein, but is not limited thereto.

In a preferred embodiment, the CRISPR-Cas12a detection cocktail comprises three of a Cas12a protein, and the crRNA of the first aspect.

In a preferred embodiment, the total working concentration of the three crrnas is 0.17-0.33 μm.

In a more preferred embodiment, the three crrnas are present in equal ratios and the total working concentration of the three crrnas is 0.17 μm.

In yet another preferred embodiment, the Cas12a protein has a working concentration of 0.17-0.33 μm.

In a more preferred embodiment, the working concentration of the Cas12a protein is 0.33 μm.

In a specific embodiment, a primer set comprising the following is used in the amplification reaction of step (3):

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3)

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10).

In a preferred embodiment, in step (3), the amplification reaction may be a recombinase-mediated amplification reaction. As previously mentioned, HIV-1 is an RNA virus and thus the present invention employs RT-RAA. Without wishing to be bound by theory, the primer set of the invention may also be used in a variety of other amplification techniques, such as RPA, ERA, qPCR, RT-PCR, NASBA, bDNA, LAMP, HAD, SDA, RCA, etc. Those skilled in the art will appreciate that primers for RAA can be generic to primers for RPA, ERA, etc.

In the case of RT-RAA amplification, it will be appreciated that the amplification reaction system used in step (3) also includes other reagents for performing RT-RAA amplification reactions, such as reverse transcriptase, RAA recombinase, single-stranded binding protein, DNA polymerase, exonuclease III, dNTP, RNase inhibitor, magnesium acetate, buffers, negative controls, positive controls, and the like. The person skilled in the art is able to select the reagents described above for the RT-RAA amplification reaction according to the actual needs, these reagents being all commercially available. For example, a Jiangsu Qishi gene technology Co., ltd RT-RAA kit (product number B00R 00) may be used in the amplification reaction, wherein a single-unit RT-RAA reaction unit comprises a reverse transcriptase, a RAA recombinase, a single-strand binding protein, a DNA polymerase, dNTPs, an RNase inhibitor, and the like, but is not limited thereto.

In a specific embodiment, in step (3), each primer in the amplification reaction is operated at a concentration of 0.2 to 1.0. Mu.M.

In a preferred embodiment, in step (3), the working concentration of each primer in the amplification reaction is 0.4 to 0.8. Mu.M.

In a more preferred embodiment, in step (3), the working concentration of each primer in the amplification reaction is 0.6. Mu.M.

In yet another specific embodiment, in step (3), the amplification reaction is performed at 37 ℃ to 41 ℃ for at least 20 minutes. In a preferred embodiment, the amplification reaction is carried out at a temperature of 41 ℃.

In a specific embodiment, the method further comprises: before the amplification reaction of the step (3) is started, the CRISPR-Cas12a detection mixed solution is pre-placed in a reaction tube for the amplification reaction of the step (3) at a position separated from an amplification reaction system, and after the amplification reaction of the step (3) is finished, the CRISPR-Cas12a detection mixed solution and the amplification product are uniformly mixed. For example, the CRISPR-Cas12a detection mixture is placed in advance in the tube cap of the reaction tube for the amplification reaction, and after the amplification reaction of step (3) is completed, the CRISPR-Cas12a detection reaction can be started by merely reversing the reaction tube to mix the CRISPR-Cas12a detection mixture with the amplification product without opening the cap.

According to the invention, by integrating an amplification reaction such as RT-RAA amplification and CRISPR-Cas12a detection into the same reaction tube, the step of opening/closing the cover to add a reagent during the amplification and detection reaction is omitted, so that the detection process is simpler, and false positive caused by introducing unnecessary pollutants in the operation of opening/closing the reaction tube cover under complex field detection conditions is avoided.

In yet another embodiment, a fluorescence quenching reporter is also included in the detection system of step (4). Without wishing to be bound by theory, the fluorescence quenching reporter may be pre-placed in the amplification reaction system of step (3) and interact with the amplification product, CRISPR-Cas12a detection mix in step (4), thereby enabling the determination of the presence or absence of HIV-1 by comparing the fluorescence emission of the fluorescence quenching reporter to a fluorescence threshold. For example, the fluorescence quenching reporter may be 3' labeled at the 5' end via a fluorescent reporter group such as FAM, HEX, etc 'Terminated by fluorescence quenching groups, e.g. Iowa

In a fifth aspect, there is provided a kit for detecting HIV-1, comprising:

a) The CRISPR-Cas12a of the first aspect uses crRNA and Cas12a protein, or the CRISPR/Cas12a system of the second aspect;

b) Instructions for use of the kit; and

c) Optionally, a primer set for amplifying HIV-1 nucleic acid:

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3)

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10);

d) Optionally, the reporter is fluorescence quenched.

Likewise, as an example, the Cas12a protein may be a FnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a, or Lb4Cas12a protein, but is not limited thereto.

In a preferred embodiment, in step c), the amplification may be a recombinase-mediated amplification reaction.

However, without wishing to be bound by theory, the primer set of the present invention may also be used in a variety of other amplification techniques, such as RPA, ERA, qPCR, RT-PCR, NASBA, bDNA, LAMP, HAD, SDA, RCA, etc. Those skilled in the art will appreciate that primers for RAA can be generic to primers for RPA, ERA, etc.

In the context of the present invention, the kit may be used to bind reverse transcription-recombinase mediated amplification (RT-RAA) to a CRISPR-Cas12a system for detection of HIV-1 nucleic acids. It will thus be appreciated that the kit further comprises other reagents for performing an RT-RAA amplification reaction, such as reverse transcriptase, RAA recombinase, single stranded binding protein, DNA polymerase, dNTPs, RNase inhibitors, magnesium acetate, buffers, negative controls, positive controls, etc., used in combination with the primer set, which are well known to those skilled in the art and commercially available (e.g., RT-RAA kit, cat. Number B00R00, available from Jiangsu Qihai Gene technology Co., ltd.), and is not particularly limited herein.

In an optional embodiment, the kit further comprises a fluorescence quenching reporter. For example, the fluorescence quenching reporter may be labeled 5 'via a fluorescence reporter group such as FAM, HEX, etc., and 3' via a fluorescence quenching group such as Iowa

Examples

In the following examples, the detection method of HIV-1 of the invention and characterization of relevant properties are shown. Unless otherwise indicated, all test procedures used herein were conventional, and all test materials used in the examples described below were purchased from a conventional reagent store, unless otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It should be noted that the terminology used in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The foregoing summary of the invention and the following detailed description are only for the purpose of illustrating the invention and are not intended to limit the invention in any way. The scope of the invention is determined by the appended claims without departing from the spirit and scope of the invention.

Material

1. Main instrument

Table 1: main instrument and equipment and related brands and models

2. Main reagent and consumable

(1)QIAamp Viral RNA Mini Kit(Cat#5290)：QIANGEN；

(2) Full-automatic nucleic acid extraction kit for li zhu (cat# 01070028): martensitic reagent Co., ltd;

(3) RT-RAA nucleic acid amplification kit (Cat#B00R 00): jiangsu qi Tian;

(4) Cas12a (Cpf 1) nuclease (cat#32104): shanghai Tuanlu harbor Biotech Co., ltd;

(5) RNase inhibitor (Cat#N 8080119): a Weijieshiji;

(6) Primers, probes, fluorescence quenching reporter (ssDNA-FQ), crRNA, and plasmids were all synthesized from the division of biological engineering (Shanghai);

3. experimental sample

The HIV-1 infected person plasma samples, 8E5 cells, HIV-1 subtype B strain, HBV infected person plasma samples, HCV infected person plasma samples and TP infected person plasma samples used in this study were all from the national AIDS reference laboratory sample library.

Example 1: design and screening of primers for HIV-1 recombinase-mediated amplification

The HIV-1 gene sequence set of China is established by using the HIV-1 gene sequence of China in the Los Alamos database, and is shown in figure 1. The sequence set contains 610 HIV-1 complete gene sequences together, 34 subtypes are included, and common HIV-1 subtypes such as CRF07_BC, CRF01_AE, CRF08_BC and B subtypes in China are also included, and C subtypes, G subtypes, various CRFs (CRF55_ B, CRF85_BC, CRF57_BC, CRF59_ B, CRF _BC, CRF64_BC, CRF65_cpx, CRF67_ B, CRF68_01B and the like) and various URFs (0107, BC, 01B, 01C and the like) are also included. Sequences were cleaned and analyzed using BioEdit software and aligned to find conserved sequences of different subtype sequences.

For the conserved sequence of HIV-1, RAA primers were designed according to the following principles:

(1) The GC content of the target area is 40-60%, and the target area does not contain forward or reverse repetitive sequences and palindromic sequences as much as possible;

(2) The primer length is 30-35 bases;

(3) Primer sequence:

1) The 5' -end (the first 3-5 bases) avoids the occurrence of repeated G, preferably C or T;

2) The 3' -end (last 3 bases) preferably has G and C;

3) The GC content is not more than 70% or less than 30%;

4) Avoiding the formation of secondary structure and primer dimer between the primers;

(4) Product length: the length of the amplified product is not more than 500bp, and the ideal length is 100-200bp.

Based on the objective of screening RAA primers and further optimizing RT-RAA amplification reaction parameters, the design of fluorescent probes was performed according to the following principles:

the probe length of the real-time fluorescence RAA is 46-52 bases generally, and the 3' -end is modified by a blocking group to prevent the replication and the extension of DNA polymerase. A Tetrahydrofuran (THF) modification site for exonuclease cleavage is designed in the probe, the THF modification site is at least 30 bases away from the 5 'end and at least 15 bases away from the 3' end, and fluorescent groups and quenching groups are marked on two sides of the THF modification site. When the probe binds to the template, exonuclease III cleaves THF residues, and the fluorescent group separates from the quenching group, producing a fluorescent signal.

HIV-1 sequences have high variability, it is difficult to find long conserved sequences in HIV-1 genomes that are suitable as RAA amplification targets, and it is difficult to design multiple sets of primers and probes that fully meet the above criteria in defined conserved sequence regions. A large number of experiments show that even if the primer which does not completely accord with the principle can still obtain good amplification effect, and the primer is superior to the primer combination which accords with the principle. Therefore, on the basis of the RAA design principle, the invention performs optimal design and screening. Through a large number of experiments in the early stage, 6 candidate upstream primers (F1-F4), 4 candidate downstream primers (R1-R4) and 1 fluorescent probe (P) are initially obtained in the HIV-1 conserved region (pol region). Their position, length and sequence information are shown in fig. 3 and table 2 below.

Table 2: RAA primer and probe position, length and sequence information

HIV-1 sequences have a high degree of variability and may affect amplification efficiency if RAA primers do not match perfectly with viral nucleic acid sequences. In order to obtain the HIV-1 specific primer with higher matching degree with the HIV-1 subtype sequence in China, the invention further carries out multiple rounds of screening by using HIV-1 simulation samples of various subtypes, and selects the primer by comprehensively considering the peak time and the final fluorescence value of an amplification curve.

First, primer selection was performed using nucleic acid extracted from a T lymphocyte leukemia cell line (8E 5 cells) containing HIV-1 subtype B provirus as a template. Screening all reverse primers by adopting one forward primer to obtain candidate reverse primers with good amplification effect; and screening all forward primers by using the screened reverse primers to obtain candidate forward primers with good amplification effect.

Based on the results of the sequence analysis of HIV-1 in China, four subtypes CRF01_AE (GenBank: JX 112829.1), CRF07_BC (GenBank: KC 492737.1), CRF08_BC (GenBank: KF 835534.1), and pol region fragments (located in HXB2 4600-5100 bp) SEQ ID NO.12-15 of B (GenBank: KU 724103.1) which are mainly popular in the HIV-1 in China are cloned on a pUC57 vector to obtain HIV-1 recombinant plasmids, and quantification is carried out by using a NanoDrop One ultraviolet spectrophotometer.

The candidate upstream and downstream primers screened using 8E5 cells were then re-screened in pairs using the recombinant plasmids of the four HIV-1 subtypes (CRF01_AE, CRF07_BC, CRF08_BC, B) as templates. HIV-1 recombinant plasmid was used as a template (concentration 10) ⁷ copy/mL), each set of primers is repeated three times, preferably to obtain a primer combination for subsequent detection.

In order to reduce the difference caused by different reaction batches in the primer probe screening process and ensure the comparability of results under different reaction conditions, a high-flux Bio-rad CFX96 instrument is selected for detection in the process, and the specific operation steps are as follows:

(1) The RT-RAA fluorescent kit (Jiangsu Qiyan F00R 01) is equilibrated to room temperature, and contains a reaction buffer solution V, a single-person reaction unit containing reaction components such as freeze-dried recombinase and magnesium acetate. The reaction mixtures shown in table 3 were prepared:

table 3: reaction mixture

(2) Adding 42.5 mu L of reaction mixed solution into a reaction unit, gently mixing to ensure that the freeze-dried powder in a reaction tube is fully and uniformly dissolved, transferring the uniformly mixed reaction solution into a PCR tube, and carrying out subsequent reaction.

(3) 2.5 mu L of magnesium acetate is added on the cover of the PCR tube, finally 5 mu L of template is added into the PCR tube, the PCR tube is covered, and then the PCR tube is put into a sample pretreatment system (Jiangsu Qiyan, B6108) to be automatically vibrated, mixed evenly and centrifuged to the bottom of the tube, and then the PCR tube is immediately placed in a Bio-rad CFX96 instrument. Nuclease-free water was also set up as a negative control for each experiment.

(4) Reaction conditions: the reaction was pre-reacted at 39℃for 40 seconds, after which the fluorescence was read every 30 seconds, and the reaction was set to end after 40 fluorescence reads.

Designed RAA primers were screened using 8E5 cell extracted nucleic acid as template. The combination of the downstream primer R4 with the upstream primers F1 to F6 was first performed, and the results are shown in FIG. 4. Preliminary screening results for the upstream primers showed that the primers were not significantly different in peak time, but the final fluorescence values were significantly different. The F4 and F3 amplification curves have early peak time and high final fluorescence value, and are set as candidate upstream primers. The downstream primers R1 to R4 were screened using the candidate upstream primer F4, and the results are shown in FIG. 5. The amplification curves of R3 and R4 had the earliest peak time, and R1 was slightly later than R3 and R4 in peak time of the amplification curves, but the final fluorescence values were highest, with R1, R3 and R4 being set as candidate downstream primers.

Further use is made of a high concentration (10 ⁷ Copy/. Mu.L) of the four HIV-1 subtype recombinant plasmids (CRF01_AE, CRF07_BC, CRF08_BC, B) as template screening candidate primers, combining the candidate upstream primer and the candidate downstream primer two by two, and repeating the detection of the recombinant plasmid of each subtype three times, the results of which are shown in FIG. 6. The F3/R4 and F4/R4 combination shows good amplification effect on recombinant plasmids of four subtypes. Since the length of the amplified product fragment is generally related to the amplification efficiency, it is preferable to use the F3/R4 primer combination with a shorter amplified fragment length as a primer combination for subsequent detection, although it is not excluded that the F4/R4 primer combination also has good detection performance, as a standard for shortening the amplified product length as much as possible to improve the amplification efficiency.

Example 2: optimization of recombinase-mediated amplification reaction conditions

In the present embodiment, use is made of

Viral RNA Mini Kit kit extracts RNA of HIV-1B subtype strain as template, optimizes RT-RAA amplification reaction system and reaction temperature. In order to set the temperature gradient and compare the detection results under different reaction conditions at the same time, reduce the difference caused by different reaction batches and ensure the comparability of the results, a high-throughput Bio-rad CFX96 instrument is also selected for detection in the process, and the detection method is shown in example 1.

(1) Optimizing primer concentration

The mixture of primers and probes (primer 10. Mu.M; probe 3.3. Mu.M) was added to the real-time fluorescent RT-RAA reaction system separately: the experiments were repeated three times at 1. Mu.L, 2. Mu.L, 3. Mu.L, 4. Mu.L, 5. Mu.L, and the results are shown in FIG. 7. And comparing the peak time and the final fluorescence value of the real-time fluorescence amplification curve to obtain the optimal primer probe concentration. As can be seen from FIG. 7, when the final concentrations of the primer and probe were 0.6. Mu.M and 0.2. Mu.M, respectively, the peak time of the amplification curve was the shortest and the final fluorescence value was relatively high.

(2) Optimizing reaction temperature

The recommended temperature for the RT-RAA amplification reaction was 39℃and 5 temperature gradients were set based on a temperature interval (37℃to 41 ℃) of 39℃increase or decrease of 2℃for optimal reaction temperature: the experiment was repeated three times at 37℃at 38℃at 39℃at 40℃at 41℃and the results are shown in FIG. 7. The detection result shows that the peak time of the amplification curve is shortened with the increase of the reaction temperature in the temperature range of 37-41 ℃, and the peak time is earliest when the reaction temperature is set to 41 ℃.

By optimizing the reaction conditions, the final primer concentration in the subsequent RT-RAA amplification reaction system was determined to be 0.6. Mu.M, and the reaction temperature was set to 41 ℃.

Example 3: design and screening of HIV-1 specific crRNA

For the target region amplified by RT-RAA, crRNA was designed according to the following basic principles:

(1) crrnas are typically 40-44 bases, including Direct Repeat (DR) sequences recognized by Cas12a (AAUUUCUACUCUUGUAGAU) followed by specific fragments of 21-25 bases;

(2) The GC content is not more than 80% or less than 20%.

Inside the amplified fragment sequence of the RT-RAA primer, a plurality of crRNAs are designed according to the crRNA design principle, and by comprehensively considering the slope and the final fluorescence value of the fluorescence signal curve, the following 3 crRNAs with good detection effect are optimized, and the positions and the lengths are shown in FIG. 8 and Table 4.

Table 4: crRNA position, length information and sequence information

Since different enzymes are used for amplification and detection, respectively, the reaction buffer composition required for the reaction is also different. Simply mixing the two reaction systems suppresses amplification of the target sequence, resulting in failure of detection. Through a large number of experiments, the invention finally determines the use proportion and the operation steps of each component, integrates the two steps into a single reaction tube, and establishes an HIV-1RT-RAA/CRISPR detection method. HIV-1RT-RAA/CRISPR assays the RT-RAA primer set screened in example 1, the optimized reaction parameters in example 2, and crRNA shown in SEQ ID NOS.22-24 were used.

The RT-RAA nucleic acid amplification kit is purchased from Jiangsu Qishi gene company (product number B00R 00), and contains a reaction buffer V, a single-person reaction unit containing reaction components such as freeze-dried recombinase and magnesium acetate. Cas12a detection reagent is purchased from origami, and contains Cas12a protein and Tolo buffer. The method comprises the following specific steps:

(1) Preparing RT-RAA amplification reaction mixed solution (the components are shown in the following table 5), adding the amplification reaction mixed solution into a reaction unit, fully and re-dissolving and uniformly mixing freeze-dried powder by gentle finger-flicking, collecting the liquid to the bottom of a tube by instantaneous centrifugation, and transferring the liquid to a new PCR tube.

Table 5: amplification reaction mixture

(2) Preparing CRISPR-Cas12a detection mixture (the components are shown in Table 6), premixing crRNA and Cas12a protein, and incubating for 10 minutes at room temperature (the crRNA is melted on ice, diluted with ice water, and frozen and thawed for no more than three times, so as to prevent the degradation of the crRNA).

Table 6: CRISPR-Cas12a detection mixed solution

(3) Adding 5 mu L of RNA template into a PCR tube, adding 2.5 mu L of magnesium acetate onto a PCR cover, covering the PCR tube cover, uniformly mixing and centrifuging for 10 seconds, and discarding the PCR tube cover;

(4) 4 mu L of CRISPR-Cas12a detection mixed solution and 6 mu L of Tolo buffer which are prepared in advance are added into a new PCR cover, the new PCR cover is covered, and the mixture is immediately placed into a real-time fluorescence quantitative PCR instrument for reaction for 20 minutes at 41 ℃.

(5) After the amplification reaction is finished, reversing and uniformly mixing the PCR tube, fully and uniformly mixing the CRISPR-Cas12a reaction component on the tube cover and the RT-RAA amplification product, uniformly mixing and centrifuging for 10 seconds, immediately placing the mixture into a real-time fluorescence quantitative PCR instrument, performing reaction at 37 ℃, reading fluorescence every 30 seconds, setting the reaction to be finished after 20 times of fluorescence reading, and judging that the detection is positive when exceeding a fluorescence threshold value.

Recombinant plasmids of four HIV-1 subtypes of CRF01_AE, CRF07_BC, CRF08_BC and B subtype constructed in example 1 were used as templates (concentration 10 ⁷ copy/mL), subtype versatility was further verified for the three crrnas (crRNA 1, crRNA2, crRNA 3) and the equal ratio combination of the three crrnas (crRNA 1-crRNA 3) designed, and the results are shown in fig. 9. The results in FIG. 9 show that the use of crRNA1, crRNA2, and crRNA3 is effective in detecting recombinant plasmids of four HIV-1 subtypes. Wherein, the fluorescence signal curve of crRNA2 has the highest slope, and then crRNA1 and crRNA3. After the three crrnas are combined in equal proportion, the slope of the fluorescence signal curve is not greatly different from that of crRNA2, but the final fluorescence value can be effectively improved. And the three crRNAs recognize different sites of the target sequence, so that the condition of missed detection caused by sequence difference can be avoided by combined use. Thus, a combination of the three crrnas described above was used in subsequent HIV-1RT-RAA/CRISPR detection experiments.

Example 4: optimization of CRISPR-Cas12a detection reaction conditions

The RNA extracted from HIV-1B subtype strain is used as a template, the ratio and the final concentration of crRNA and Cas12a protein are changed, the experiment is repeated twice, and the CRISPR-Cas12a detection reaction system is optimized by comparing the slope of a fluorescence signal curve with the final fluorescence value, and the detection method is described in example 3.

As shown in fig. 10, changing the ratio and final concentration of Cas12a to crRNA in the CRISPR-Cas12a detection system, the slope and final fluorescence value of the fluorescence signal curve was found to be directly related to Cas12a final concentration. When the final concentration of Cas12a is 0.33 μm, the slope and the final fluorescence value of the fluorescence signal curve are both significantly increased compared to the final concentration of Cas12a of 0.17 μm, but the change of the crRNA final concentration has less influence on the detection effect. The slope and final fluorescence values of the fluorescence signal curve were combined to determine 0.17 μm crRNA and 0.33 μm Cas12a final concentrations in the subsequent HIV RT-RAA/CRISPR detection reaction system.

Example 5: clinical sample test results

25 HIV-1 positive samples of known HIV-1 subtype and viral load (sample information is shown in Table 7, involving five subtypes CRF07_BC, CRF55_ B, CRF01_AE, CRF08_BC, 01B), 20 HIV-1 negative samples and 9 HBV (hepatitis B), HCV (hepatitis C) and TP (treponema pallidum) infection samples (3 parts each for each pathogen) were taken, viral nucleic acid was extracted using a Lizhu nucleic acid extraction kit with a Lizhu full-automatic nucleic acid extractor, and HIV-1RT-RAA/CRISPR detection was performed, see example 3 for detection methods.

Table 7: viral load and subtype information table of 25 HIV-1 positive samples

Note that: the sample subtype is typed by the pol region; viral load detection used Rogowski reagent (Cobas TaqMan HIV-1v 2.0).

The detection results are shown in Table 8 below. The positive coincidence rate and the negative coincidence rate of the detection method are 100 percent (25/25, 0/20). The detection method of the present invention shows no cross-reaction with common blood-borne pathogens (HBV, HCV and TP) when detecting HIV-1, and shows high specificity against HIV-1.

Table 8: results of HIV-1RT-RAA/CRISPR detection of clinical samples

Example 6: analog sample detection

Although in the above-described example 5, real clinical specimens concerning five subtypes of crf07_bc, crf55_ B, CRF01_ae, crf08_bc, 01B have been examined, in order to further verify the subtype versatility and detection sensitivity of the detection method provided by the present invention, the present invention further examined 10 recombinant plasmids of the more common HIV-1 subtype in China, crf07_bc (GenBank: KC 492737.1), crf08_bc (GenBank: KF 835534.1), crf01_ae (GenBank: JX 112829.1), B (GenBank: KU 724103.1), crf55_01b (GenBank: MN 067522), crf85_bc (GenBank: KU 992930), 0107 (GenBank: KX 159285), genBank: AY 967805), 01 (GenBank: KF 250407), 01C (GenBank: KY 200517), respectively, wherein the former four types of the above-mentioned four were verified as examples, thereby overcoming the problems of the subtype in the example 1. The pol region fragment shown in SEQ ID No.12-21 was cloned into pUC57 vector by the same synthesis method as described in example 1, thereby synthesizing 10 HIV-1 recombinant plasmids. For specific detection methods see example 3.

The HIV-1 recombinant plasmid samples of the 10 subtypes were quantified and converted in copy number using an ultraviolet spectrophotometer, diluted by a factor of ten, and then detected using six gradient samples of each subtype (10 ⁰ To 10 ⁵ Copy/. Mu.L). The detection results are shown in FIG. 11. The results show that the detection method provided by the invention can detect but is not limited to the 10 HIV-1 subtypes in 35 minutes, and shows the universality of the method for a plurality of HIV-1 subtypes. At concentrations as low as 10 copies/. Mu.L, all 10 subtypes above were successfully detected; at concentrations as low as 1 copy/. Mu.L, part of the subtype is still detectable, indicating a high sensitivity of the method. Furthermore, as can be seen from the detection results of fig. 11, after the RAA amplification reaction is completed, the fluorescence values of all the detected samples at 5 cycles (within about 5 minutes) after the start of the CRISPR detection reaction have significantly exceeded the threshold, so that the CRISPR detection reaction time can be further shortened to 5 minutes (the whole amplification and detection process can be shortened to 25 minutes), and the final detection result is not affected, thereby enabling rapid detection of HIV-1.

Sequence listing

SEQ ID NO.1: f1 primer

GTACARATGGCAGTDTTCATHCACAATTTTAA

SEQ ID NO.2: f2 primer

GCAGTACARATGGCAGTDTTCATHCACAATT

SEQ ID NO.3: f3 primer

ACAGCAGTACARATGGCAGTDTTCATHCACAA

SEQ ID NO.4: f4 primer

AARACAGCAGTACARATGGCAGTDTTCATHCAC

SEQ ID NO.5: f5 primer

TAARACAGCAGTACARATGGCAGTDTTCAT

SEQ ID NO.6: f6 primer

GCTGARCAYCTTAARACAGCAGTACARATGGCA

SEQ ID NO.7: r1 primer

CTTCACCTTTCCARAGNAGYTTKGCTGGTCCTT

SEQ ID NO.8: r2 primer

TACTGCCCCTTCACCTTTCCARAGNAGYTT

SEQ ID NO.9: r3 primer

TGTATYACTACTGCCCCTTCACCTTTCCARA

SEQ ID NO.10: r4 primer

CYTGTATYACTACTGCCCCTTCACCTTTCCA

SEQ ID NO.11: fluorescent probe

GGATTGGGGRRTACAGTGCAGGRGAAAGAATATAGAYATAATAGCAAC

SEQ ID NO.12: pol gene sequence of cn.2013.bjmp3116b

TACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCTGCCTGTTGGTGGGCA

GGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAAT

CTATGAATAATGAATTAAAAAAGATTATAGGACAGGTAAGAGACCAGGCTGAACATCT

TAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATT

GGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACT

AAGGAACTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACA

GCAGAGATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAG

TAGTAATACAACATAACAGTGA

SEQ ID NO.13: pol gene sequence of crf07_bc.cn.2005.pxjdc6291

TTCACCAGTGCTGCAGTTAAGGCAGCCTGTTGGTGGGCAGGTATCCAACAGGAATTTG

GAATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAA

GAAAATTATAGGGCAGGTAAGAGATCAAGCTGAGCACCTTAAGACAGCAGTACAAAT

GGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGG

GAAAGAATAATAGATATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAA

ATTATAAAAATTCAAAATTTCCGGGTTTATTACAGAGACAGCAGAGACCCCATTTGGA

AAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATA

GTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGATTATGGAAAAC

AGATGGCAGGTGCTGATTGTGTGGCAGGTAGACAGGATGA

SEQ ID NO.14: pol gene sequence of CRF08_BC.CN.2007.07CNYN355

GCAGGTGTCCACCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAG

AATCCATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTAAGAGATCAAGCTGAGC

ACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGG

GATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACA

AACAAGAGAATTACAAAAACAAATTATAAAAATTCAAAATTTTCGGGTTTATTACAGA

GACAGCAGAGACCCCATTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGG

GCAGTAGTAATACAAGATAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAA

ATCATTAAGGACTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGG

ATGAAGATTAGAACATGGAATAGTTTAGTAAAACACCATA

SEQ ID NO.15: pol gene sequence of crf01_ae.cn.2007.gx070003

ATCCCCTACAATCCCCAAAGTCAAGGGGTAGTAGAATCCATGAATAAGGAATTAAAGA

AAATCATAGGGCAGATAAGAGAGCAAGCTGAACATCTTAAGACAGCAGTACAAATGG

CAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGA

AAGAATAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAAT

TACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAA

GGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGT

GATATAAAAGTAGTACCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAG

ATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACATGGAACAGT

TTAGTAAAACATCATATGTACATCTCAAAGAAAGCTAAAA

SEQ ID NO.16: pol gene sequence of 01BC (KF 250407)

TGCAGCCAAGGCCGCCTGTTGGTGGGCGGGGATCAAGCAGGAATTTGGAATTCCCTAC

AATCCCCAAAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAG

GGCAGGTAAGAGACCAAGCAGAGCACCTTAAGACAGCAGTACAAATGGCAGTATTCA

TTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAA

TAGACATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAAAA

TTCAAAATTTTCGGGTTTATTACAGGGACAACAGAGATCCACTTTGGAAAGGACCAGC

AAAGCTTCTTTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAACAGTGACATAAA

AGTAGTGCCAAGAAGAAAAGCAAAAATCATCAGGGATTATGGAAAACAGATGGCAGG

GGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACA

SEQ ID NO.17: pol gene sequence of 01C (KY 200517)

TGCAGTTAAAGCAGCCTGTTGGTGGGCCAATGTCCGACAGGAATTTGGAATTCCCTAC

AATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAGGAATTAAAGAAAATCATAG

GGCAGGTAAGAGAGCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCAT

TCACAATTTTAAAAGAAAAGGGGGGATTGGGGAGTACAGTGCAGGGGAAAGAATAAT

AGACATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAAAAT

TCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCA

AAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGATATAAAA

GTAGTACCAAGAAGAAAAGCGAAGATCATCAGAGATTATGGAAAACAGATGGCAGGT

GATGATTGTGTGGCAGGTAGACAGGATGAGAATTAGAACA

SEQ ID NO.18: pol gene sequence of CRF85_BC (KU 992930)

TGCAGTTAAGGCAGCCTGCTGGTGGGCAGGTATCCATCAGGAATTTGGAATTCCCTAC

AATCCCCAAAGTCAGGGGGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAG

GGCAGGTAAGAGATCAAGCTGAGCACCTTAAAACAGCAGTACAAATGGCAGTATTCAT

TCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAAT

AGATATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAGATTACAAAAAT

TCAAAATTTTCGGGTTTATTACAGAGACAGCAGAGACCCCAGTTGGAAAGGACCAGCC

AAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAG

GTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAAAACAGATGGCAGGT

GCTGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACASEQ ID NO.19:0107 (KX 159285) pol Gene sequence

TGCAGTTAAGGCAGCCTGTTGGTGGGCAGGTCTCCAACAAGAATTTGGAATTCCCTAC

AATCCCCAGAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAG

GGCAGGTAAGAGATCAAGGTGAGCACGTTAAGACAGCAGTACAAATGGCAGTATTCAT

TCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAAT

AGACATAATAGCAACAGACATACAAAATAAAGAATTACAAAAACAAATTACAAAAAT

CCAAAATTTTCGGGTTTATTACAGAGACAGCAGAGACCCCAGTTGGAAAGGACCAGCC

AAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGACATAAAG

GTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAAAACAGATGGCAGGC

GCTGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACASEQ ID NO.20: pol gene sequence of BC (AY 967805)

TTCGGTTAAGGCCGCCTGTTGGTGGGCGGGGATCAAACAGGAATTTGGCATTCCCTAC

AATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAG

GACAGATAAGAGATCAAGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCAT

CCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAGT

AGACATAATAGCAACAGACATACAAACTAGAGAATTACAAAAACAAATTACAAAAAT

TCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCCATTTGGAAAGGACCAGCC

AAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAG

GTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAACACAGATGGCAGGT

GCTGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACASEQ ID NO.21: pol gene sequence of CRF55_01B (MN 067522)

TGCAGTCAAAGCAGCCTGTTGGTGGGTCAATGTCCAACAGGAATTTGGGATCCCCTAC

AATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAGGAATTAAAGAAAATCATAG

GACAGGTAAGAGAGCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCAT

TCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAAT

AGACATAATAGCAACAGACATGCAAACTAAAGAATTACAAAAACAAATTACAAAAAT

TCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCA

AAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGATATAAAA

GTAGTACCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGT

GATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACA

SEQ ID NO.22：crRNA1

AAUUUCUACUCUUGUAGAUGGGUUUAUUACAGRGACARCAGAGA

SEQ ID NO.23：crRNA2

AAUUUCUACUCUUGUAGAUUAUGUCUGUUGCUAUUAURUC

SEQ ID NO.24：crRNA3

AAUUUCUACUCUUGUAGAUCCCUGCACUGUACCCCCCAAUCC

SEQ ID NO.25: targeting specific sequences included in crRNA1

GGGUUUAUUACAGRGACARCAGAGA

SEQ ID NO.26: targeting specific sequences included in crRNA2

UAUGUCUGUUGCUAUUAURUC

SEQ ID NO.27: targeting specific sequences included in crRNA3

CCCUGCACUGUACCCCCCAAUCC

SEQ ID NO.28: repeated sequence

AAUUUCUACUCUUGUAGAU

SEQ ID NO.29: repeated sequence

UAAUUUCUACUAAGUGUAGAU

Claims

1. A crRNA for CRISPR-Cas12a for detecting HIV-1, which crRNA is a repeat sequence and a targeting-specific sequence in order from 5 'end to 3' end, wherein the targeting-specific sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID No.25, SEQ ID No.26, or SEQ ID No. 27:

SEQ ID NO.25：GGGUUUAUUACAGRGACARCAGAGA；

SEQ ID NO.26：UAUGUCUGUUGCUAUUAURUC；

SEQ ID NO.27：CCCUGCACUGUACCCCCCAAUCC；

preferably, the repeated sequence is the sequence shown as SEQ ID NO.28 or SEQ ID NO. 29;

more preferably, the crRNA is a crRNA as shown in SEQ ID No.22, SEQ ID No.23 or SE Q ID No. 24:

SEQ ID NO.22：AAUUUCUACUCUUGUAGAUGGGUUUAUUA CAGRGACARCAGAGA；

SEQ ID NO.23：AAUUUCUACUCUUGUAGAUUAUGUCUGUU GCUAUUAURUC；

SEQ ID NO.24：AAUUUCUACUCUUGUAGAUCCCUGCACUGU ACCCCCCAAUCC。

2. a CRISPR-Cas12a system for detecting HIV-1, comprising:

1) Cas12a proteins, such as FnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a or Lb4Cas12a proteins, and

2) One, two or three, preferably three, of the crrnas of claim 1.

3. Use of the CRISPR-Cas12a of claim 1 with crRNA or the CRISPR-Cas12a system for detecting HIV-1 of claim 2 for the preparation of an aids diagnostic reagent;

preferably, the crRNA or crRNA comprised in the CRISPR-Cas12a system is an equal ratio of the three crrnas present, preferably the crrnas shown in SEQ ID No.22, SEQ ID No.23 and SEQ ID No.24 present.

4. The use of claim 3, wherein the crRNA or CRISPR-Cas12a system is further used in combination with a primer set for amplifying HIV-1 nucleic acid for the preparation of an aids diagnostic reagent, the primer set comprising:

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3)

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10);

preferably, the amplification is a recombinase mediated amplification reaction;

optionally, the crRNA or CRISPR/Cas12a system is further used in combination with a fluorescence quenching reporter for the preparation of an aids diagnostic; for example, the fluorescence quenching reporter is labeled with a fluorescent reporter group such as FAM, HEX, etc. at the 5 'end and a fluorescence quenching group such as Iowa at the 3' end

FQ sequencer labeled single stranded DNA.

5. A method of detecting HIV-1 for non-diagnostic purposes comprising the steps of:

(1) Providing an HIV-1 nucleic acid sample;

(2) Preparing a CRISPR-Cas12a detection cocktail comprising:

a) Cas12a proteins, such as one, two or three, preferably three, of FnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a or Lb4Cas12a proteins, and crrnas as described in claim 1; or alternatively

b) The CRISPR-Cas12a system for detecting HIV-1 of claim 2;

preferably, the crRNA or the crRNA comprised in the CRISPR-Cas12a system is an equal ratio of the three crrnas present, preferably the crrnas shown in SEQ ID No.22, SEQ ID No.23 and SEQ ID No.24 present;

(4) Mixing and reacting the amplification product with the CRISPR-Cas12a detection cocktail and determining the presence or absence of HIV-1 by fluorescence quenching the fluorescent emission of the reporter; for example, the fluorescence quenching reporter may be labeled 5 'via a fluorescence reporter group such as FAM, HEX, etc., and 3' via a fluorescence quenching group such as Iowa

FQ queue marker single-stranded DNA.

6. The method of claim 5, wherein the three crrnas are present in an equimolar concentration and have a working concentration of 0.17-0.33 μΜ, preferably 0.17 μΜ, and the Cas12a protein has a working concentration of 0.17-0.33 μΜ, preferably 0.33 μΜ.

7. The method according to claim 5 or 6, wherein the following primer sets are used in the amplification reaction:

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3)

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10);

preferably, the amplification reaction is a recombinase-mediated amplification reaction;

more preferably, the working concentration of each primer in the amplification reaction is 0.2 to 1.0. Mu.M, preferably 0.4 to 0.8. Mu.M, more preferably 0.6. Mu.M.

8. The method according to any one of claims 5-7, wherein the amplification reaction is performed at 37 ℃ to 41 ℃, preferably at 41 ℃ for at least 20 minutes.

9. The method of any of claims 5-8, wherein the method further comprises: before the amplification reaction of step (3) is started, the CRISPR-Cas12a detection mixed solution is pre-placed in a place, such as a tube cover, separated from an amplification reaction system in a reaction tube for the amplification reaction of step (3), and after the amplification reaction of step (3) is finished, the CRISPR-Cas12a detection mixed solution is uniformly mixed with the amplification product for detection.

10. A kit for detecting HIV-1, comprising:

a) The crRNA and Cas12a protein for CRISPR-Cas12a of claim 1 (e.g., fnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a, or Lb4Cas12a protein), or the CRISPR-Cas12a system of claim 2;

b) Instructions for use of the kit; and

c) Optionally, a primer set for amplifying HIV-1 nucleic acid:

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3)

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10);

the amplification is preferably recombinase-mediated amplification;

d) Optionally, a fluorescence quenching reporter; preferably, the fluorescence quenching reporter may be labeled with a fluorescent reporter group such as FAM, HEX, etc. at the 5 'end and a fluorescence quenching group such as Iowa at the 3' end

FQ sequencer labeled single stranded DNA.