CN116411139A

CN116411139A - Universal primer group, probe and detection method for detecting multi-subtype HIV-1

Info

Publication number: CN116411139A
Application number: CN202310238647.7A
Authority: CN
Inventors: 金聪; 张鑫
Original assignee: NATIONAL CENTER FOR AIDS/STD CONTROL AND PREVENTION CHINESE CENTER FOR DISEASE CONTROL AND PREVENTION
Current assignee: NATIONAL CENTER FOR AIDS/STD CONTROL AND PREVENTION CHINESE CENTER FOR DISEASE CONTROL AND PREVENTION
Priority date: 2023-03-08
Filing date: 2023-03-08
Publication date: 2023-07-11

Abstract

The invention discloses a primer group for amplifying HIV-1 nucleic acid, a fluorescent probe for detecting HIV-1 nucleic acid, and a method and a kit for detecting HIV-1 by using the primer group and the fluorescent probe. The detection method has the characteristics of wide subtype universality, high sensitivity, high specificity and the like, and is suitable for detecting various common and unusual subtypes of HIV-1. In particular, the invention can complete detection within 10-25 minutes, thus being capable of being used as an on-site rapid detection method of HIV-1.

Description

Universal primer group, probe and detection method for detecting multi-subtype HIV-1

Technical Field

The invention relates to the field of detection of HIV. More particularly, the present invention relates to a primer set for amplifying HIV-1 nucleic acid, a fluorescent probe for detecting HIV-1 nucleic acid, and a method and kit for rapid detection of HIV-1 virus using the same.

Background

Acquired immunodeficiency syndrome (Acquired immune deficiency syndrome, AIDS), also known as AIDS, is a chronic infectious disease caused by the human immunodeficiency virus (Human immunodeficiency virus, HIV). One key element in terminating the prevalence of aids is the detection of HIV-infected persons, and previous studies have found that HIV-infected persons who have not been diagnosed, particularly those with acute stage infections, are important causes of HIV infection transmission. Early detection of infected persons and antiviral treatment at early stage of infection can effectively improve antiviral treatment effect and effectively reduce transmission risk by inhibiting virus replication in vivo. Thus, early diagnosis of HIV infection is of great public health importance for preventing transmission of HIV.

So far, globally prevalent HIV can be divided into two genotypes, HIV-1 and HIV-2.HIV-1 is widely distributed throughout the world and is the primary pathogen responsible for the worldwide epidemic of AIDS. HIV-1 can be further divided into M, N, O, P groups, where M strains are the major strains responsible for global aids epidemics, including at least A, B, C, D, F, G, H, J, K and L10 different subtypes, as well as multiple epidemic recombinants (circulating recombinant form, CRF) and unique recombinants (unique recombinant form, URF). In China, HIV-1 is taken as a main epidemic strain, main subtypes comprise CRF01_AE, CRF07_BC, CRF08_BC, B and the like, new epidemic recombinant types (such as CRF55_ B, CRF85_BC and the like) and unique recombinant types (such as 0107, 01B, 01BC, 01C and the like) are continuously discovered in recent years, and the occurrence of missed detection of detection reagents can be caused by the gene sequence diversity among different HIV-1 subtypes.

There are various commercial HIV-1 nucleic acid detection kits based on different technologies, such as reverse transcription PCR technology (Reverse transcriptase-polymerase chain reaction, RT-PCR), nucleic acid sequence dependent amplification (Nucleic acid sequence-based amplification, NASBA) technology, branched DNA (branched DNA signal amplification, bDNA) technology, real-time fluorescent PCR quantification technology (Quantitative real-time PCR, qPCR), etc., but these detection reagents generally have complicated experimental procedures, rely on temperature-changing equipment, have high cost, and require more than 3 hours for detection time, which have led to HIV-1 nucleic acid detection usually being carried out in large hospitals or laboratories, limiting the popularization and application of HIV-1 nucleic acid detection in resource-limited basic medical institutions.

Thus, there is a need in the art for a rapid detection method of HIV-1 that has multiple subtype versatility, and is highly sensitive and highly specific.

Disclosure of Invention

In order to solve the defects of the existing detection method, the inventor conducts deep research based on 610 HIV-1 complete gene sequences in Los Alamos HIV Sequence Database China, wherein the 610 HIV-1 complete gene sequences relate to 34 subtypes, and not only covers common HIV-1 subtypes in China, such as CRF07_BC, CRF01_AE, CRF08_BC, B and CRF55_ B, CRF85_BC subtypes, but also comprises various URFs (including 0107, BC, 01C and the like). The sequence analysis is carried out on the sequence conservation region of the epidemic HIV-1 in China, a primer and probe sequence with wide subtype coverage is designed, and a general nucleic acid detection method for the HIV-1 subtype in China is provided based on the real-time fluorescent reverse transcription-recombinase mediated amplification (Reverse transcription recombinase aided amplification, RT-RAA) technology. The detection method is short in time consumption, and meanwhile has the characteristics of high sensitivity, high specificity, no need of complex temperature changing equipment and the like. Thus, the present invention was achieved.

Accordingly, in a first aspect, the present invention provides a primer set for amplifying HIV-1 nucleic acid, the primer set comprising:

an upstream primer: ACAGCAGTACARATGGCAGTDTTCATHCACAA (SEQ ID NO. 3) or AARACAGCAGTACARATGGCAGTDTTCATHCAC (SEQ ID NO. 4), and a method for producing the same

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10).

In a second aspect, there is provided a fluorescent probe for detecting HIV-1 nucleic acid, the fluorescent probe having the nucleic acid sequence: 5'-GGATTGGGGRRTACAGTGCAGGRGAAAGAATATAGAYATAAT AGCAAC-3' (SEQ ID NO. 11).

In a third aspect, there is provided the use of a primer set for amplifying an HIV-1 nucleic acid as described in the first aspect and a fluorescent probe for detecting an HIV-1 nucleic acid as described in the second aspect in the preparation of an HIV-1 diagnostic reagent.

In a fourth aspect, there is provided a method of detecting HIV-1 for non-diagnostic purposes comprising the steps of:

(1) Providing an HIV-1 nucleic acid sample;

(2) Preparing a real-time fluorescent RT-RAA reaction system, wherein the real-time fluorescent RT-RAA reaction system comprises: an HIV-1 nucleic acid as a template, a primer set according to the first aspect, and a fluorescent probe according to the second aspect;

(3) And carrying out RT-RAA amplification reaction on the real-time fluorescent RT-RAA reaction system, and determining whether HIV-1 exists according to the slope of an amplification curve.

In a fifth aspect, there is provided a kit for detecting HIV-1, comprising:

a) The primer set of the first aspect;

b) The fluorescent probe according to the second aspect; ###

c) Instructions for how to use the kit.

The invention has the beneficial effects that:

the invention provides a rapid detection method of HIV-1 based on real-time fluorescence recombinase mediated amplification (RT-RAA), and the detection performance of the detection method is primarily evaluated by using HIV-1 recombinant plasmid and clinical samples. Compared with the prior art, the novel method for rapidly detecting the HIV-1 has the advantages of wide subtype universality, high sensitivity, high specificity, no need of complex temperature changing equipment and the like, and can complete detection within 10-25 minutes, so that the novel method can be used as a beneficial supplement of the existing HIV-1 detection method. Compared with the existing nucleic acid detection technology, the method is more suitable for popularization and use in basic medical institutions with limited resources, and provides a powerful detection tool for promoting early detection and early discovery of HIV-1 infected persons.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows subtype organization of the HIV-1 sequence set.

FIG. 2 shows a schematic diagram of RAA primer and probe positions and lengths.

FIG. 3 shows the results of detection for screening RAA upstream primers.

FIG. 4 shows the results of detection for the screening of RAA downstream primers.

FIG. 5 shows the results of detection of recombinant plasmid selection primer combinations using 4 HIV-1 subtypes (CRF01_AE (labeled "01 AE"), CRF07_BC (labeled "07 BC"), CRF08_BC (labeled "08 BC"), B).

FIG. 6 shows the results of RT-RAA detection under different reaction conditions.

FIG. 7 shows the detection results of the method of the present invention for 10 HIV-1 subtypes (CRF07_BC, CRF01_AE, CRF08_BC, B, CRF55_ B, CRF85_BC, 0107, BC, 01BC and 01C).

Detailed Description

Hereinafter, the present invention will be described in detail with reference to the accompanying drawings. It is to be understood that the following description is intended to illustrate the invention by way of example only, and is not intended to limit the scope of the invention as defined by the appended claims. And, it is understood by those skilled in the art that modifications may be made to the technical scheme of the present invention without departing from the spirit and gist of the present invention. The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter described herein belongs. Before describing the present invention in detail, the following definitions are provided to better understand the present invention.

Where a range of values is provided, such as a range of concentrations, a range of percentages, or a range of ratios, it is to be understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of the range, and any other stated or intervening value in that stated range, is encompassed within the subject matter unless the context clearly dictates otherwise. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and such embodiments are also included in the subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the subject matter.

In the context of the present invention, many embodiments use the expression "comprising", "including" or "consisting essentially/mainly of … …". The expression "comprising," "including," or "consisting essentially of … …" is generally understood to mean an open-ended expression that includes not only the individual elements, components, assemblies, method steps, etc., specifically listed thereafter, but also other elements, components, assemblies, method steps. In addition, the expression "comprising," "including," or "consisting essentially of … …" is also to be understood in some instances as a closed-form expression, meaning that only the elements, components, assemblies, and method steps specifically listed thereafter are included, and no other elements, components, assemblies, and method steps are included. At this time, the expression is equivalent to the expression "consisting of … …".

For a better understanding of the present teachings and without limiting the scope of the present teachings, all numbers expressing quantities, percentages or proportions used in the specification and claims, and other numerical values, are to be understood as being modified in all instances by the term "about" unless otherwise indicated. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

In a first aspect, the present invention provides a primer set for amplifying HIV-1 nucleic acid, the primer set comprising:

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10).

In the above primer sequences, A represents adenine, G represents guanine, C represents cytosine, T represents thymine, R represents A/G, Y represents C/T, M represents A/C, K represents G/T, S represents C/G, W represents A/T, H represents A/T/C, B represents G/T/C, V represents G/A/C, D represents G/A/T, and N represents A/T/C/G.

In the context of the present invention, the primer set may be used for a recombinase-mediated amplification (Recombinase Aided Amplification, RAA) reaction. The principle of the recombinase mediated amplification technology is that under the action of adenine nucleoside triphosphate (Adenosine triphosphate, ATP), the recombinase forms a complex with a specific primer, when the specific primer recognizes a complementary pairing sequence with the specific primer in a template DNA sequence, the template DNA is melted under the assistance of a single-stranded DNA binding protein, and is replicated and extended under the action of DNA polymerase, so that the exponential growth of a reaction product is realized. HIV-1 is an RNA virus and it will be appreciated that a reverse transcription process is required prior to amplification, and thus the present invention employs RT-RAA technology.

Also without wishing to be bound by theory, the primer set of the invention may also be used in other various amplification techniques, such as qPCR, RT-PCR, NASBA, bDNA, recombinase polymerase amplification techniques (Recombinase Polymerase Amplification, RPA), enzymatic recombination isothermal amplification techniques (Enzymatic Recombinase Amplification, ERA), loop-mediated isothermal amplification techniques (Loop-mediated isothermal amplification, LAMP), helicase-dependent amplification techniques (helicase-dependent amplification, HAD), strand-displacement amplification techniques (Strand Displacement Amplification, SDA), rolling circle nucleic acid amplification techniques (Rolling Circle Amplification, RCA), etc. Those skilled in the art will appreciate that primers for RAA can be generic to primers for RPA, ERA, etc. Real-time fluorescence detection of RNA nucleic acid can be achieved by adding reverse transcriptase and fluorescent probes to the reaction system.

Thus, in a second aspect, there is provided a fluorescent probe for detecting HIV-1 nucleic acid, the fluorescent probe having the nucleic acid sequence: 5'-GGATTGGGGRRTACAGTGCAGGRGAAAGAATATAGAYATAATAGCAAC-3' (SEQ ID NO. 11).

In a preferred embodiment, there is a tetrahydrofuran residue (THF residue) modification site in the fluorescent probe, which is at least 30 bases from the 5' end of the fluorescent probe and at least 15 bases from the 3' end of the fluorescent probe, the tetrahydrofuran residue site is labeled with a fluorescent group and a quenching group on both sides, respectively, and the 3' end of the fluorescent probe is modified with a blocking group.

In a preferred embodiment, the base (T) at position 31 of the fluorescent probe is modified with a fluorescent reporter group, the base (T) at position 34 is modified with a fluorescent quenching group, and the base at position 33 is replaced with a tetrahydrofuran residue.

In a more preferred embodiment, the fluorescent reporter group is FAM, the fluorescent quenching group is BHQ1, and the blocking group is C3-Spacer.

In a most preferred embodiment, the sequence of the fluorescent probe may be expressed as: 5'-GGATTGGGGRRTACAGTGCAGGRGAAAGAA/FAM-dT/A/THF// BHQ-dT/AGAYATAATAGCAAC-3' -C3-Spacer.

When the fluorescent probe binds to the template, exonuclease III cleaves THF residues, and the fluorescent group separates from the quencher group, thereby generating a fluorescent signal.

However, without wishing to be bound by theory, the primer sets and probes of the invention may also be used in a variety of other amplification techniques, such as RPA, ERA, RT-PCR, NASBA, bDNA, qPCR, LAMP, HAD, SDA, RCA, and the like.

When the fluorescent probe of the present invention hybridizes to an amplification product in an RT-RAA amplification reaction, exonuclease III cleaves THF residues in the fluorescent probe, thereby separating the fluorescent group from the quencher group, producing a fluorescent signal.

HIV-1 as used in the context of the present invention may be of any origin, e.g. from a blood sample such as whole blood, serum, plasma, dried blood spots, etc., from a body fluid sample such as secretions, etc.

In the context of the present invention, the primer set for amplifying HIV-1 nucleic acid of the present invention may be combined with a fluorescent probe for detecting HIV-1 nucleic acid to form an HIV-1 diagnostic reagent for detecting HIV-1 by real-time fluorescent RT-RAA.

In a fourth aspect, there is provided a method of detecting HIV-1, the method comprising the steps of:

(1) Providing an HIV-1 nucleic acid sample;

The method of the invention may be used for diagnostic purposes as well as for non-diagnostic purposes. It will be appreciated that the "non-diagnostic purpose" of the method of the invention for detecting HIV-1 may be any other purpose not including diagnostic purposes, including but not limited to quarantine and epidemic prevention and control, and the like.

It will be appreciated that in step (1) the HIV-1 nucleic acid sample may be of any origin, for example from a blood sample such as whole blood, serum, plasma, dried blood spots, etc., from a body fluid sample such as secretions, etc., or may be artificially synthesized based on known nucleic acid sequences. In addition, it is also understood that the HIV-1 nucleic acid sample may be obtained by extraction using nucleic acid extraction techniques conventional in the art.

It will be appreciated that in step (2), the real-time fluorescent RT-RAA reaction system also includes other reagents for performing the RT-RAA amplification reaction, such as reverse transcriptase, RAA recombinase, single-stranded binding protein, DNA polymerase, exonuclease III, dNTP, RNase inhibitor, magnesium acetate, buffer V, negative control, positive control, etc. The person skilled in the art is able to select the reagents described above for the RT-RAA amplification reaction according to the actual needs, these reagents being all commercially available.

In a specific embodiment, in step (2), each primer is used at a working concentration of 0.2 to 1.0. Mu.M.

In a preferred embodiment, in step (2), each primer is used at a working concentration of 0.4 to 0.8. Mu.M.

In a more preferred embodiment, in step (2), the working concentration of each primer is 0.6. Mu.M.

In yet another specific embodiment, in step (2), the working concentration of the fluorescent probe is 0.07 to 0.33. Mu.M.

In a preferred embodiment, in step (2), the working concentration of the fluorescent probe is 0.13 to 0.27. Mu.M.

In a more preferred embodiment, in step (2), the working concentration of the fluorescent probe is 0.2. Mu.M.

In yet another specific embodiment, in step (3), the amplification reaction is performed at 37 ℃ to 41 ℃ for 25 minutes or less, for example 10 minutes. In fact, it is expected by those skilled in the art from the amplification results of the following exemplary embodiments that the time of the amplification reaction can be set shorter for the method of the present invention without affecting the detection results.

In a preferred embodiment, the amplification reaction is performed at 41 ℃.

In a fifth aspect, there is provided a kit for detecting HIV-1, comprising:

a) The primer set of the first aspect;

b) The fluorescent probe according to the second aspect; and

c) Instructions for how to use the kit.

In the context of the present invention, the kit may be used to bind reverse transcription-recombinase mediated amplification (RT-RAA) to a fluorescent probe for detecting HIV-1. Thus, it will be appreciated that the kit may also include other reagents for performing an RT-RAA amplification reaction, such as reverse transcriptase, RAA recombinase, single-stranded binding protein, DNA polymerase, exonuclease III, dNTPs, RNase inhibitor, magnesium acetate, buffers, negative controls, positive controls, etc., in combination with the primer set.

The invention is described in further detail below by way of examples and with reference to the accompanying drawings.

Examples

In the following examples, the rapid detection method of HIV-1 nucleic acids of the invention and characterization of relevant properties are shown. Unless otherwise indicated, all test procedures used herein were conventional, and all test materials used in the examples described below were purchased from a conventional reagent store, unless otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It should be noted that the terminology used in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The foregoing summary of the invention and the following detailed description are only for the purpose of illustrating the invention and are not intended to limit the invention in any way. The scope of the invention is determined by the appended claims without departing from the spirit and scope of the invention.

Material

1. Main instrument

Table 1: the main instrument used and the relevant brands and models

2. Main reagent

(1)QIAamp Viral RNA Mini Kit(Cat#5290)：QIANGEN；

(2) Full-automatic nucleic acid extraction kit for li zhu (cat# 01070028): martensitic reagent Co., ltd;

(3) RT-RAA nucleic acid amplification kit (fluorescence method) (Cat#F00R01): jiangsu qi Tian;

(4) Primers, probes, and plasmids were synthesized from the biological engineering (Shanghai) Co., ltd;

3. experimental sample

The HIV-1 infected person plasma samples, 8E5 cells, HIV-1 subtype B strain, HBV infected person plasma samples, HCV infected person plasma samples and TP infected person plasma samples used in this study were all from the national AIDS reference laboratory sample library.

Example 1: design and screening of specific primer probe for rapid detection of HIV-1 nucleic acid

The HIV-1 gene sequence set of China is established by using the HIV-1 gene sequence of China in the Los Alamos database, and is shown in figure 1. The sequence set contains 610 HIV-1 complete gene sequences together, 34 subtypes are included, and common HIV-1 subtypes in China, such as CRF07_BC, CRF01_AE, CRF08_BC, B, CRF55_ B, CRF85_BC subtype, C subtype, G subtype, CRF57_BC, CRF59_ B, CRF _BC, CRF64_BC, CRF65_cpx, CRF67_ B, CRF68_01B and the like, and various URFs (0107, BC, 01B, 01C and the like) are also included. Sequences were cleaned and analyzed using the Bioedit software and conserved sequences of the different subtype sequences were aligned.

The RAA primer and fluorescent probe were designed for the conserved sequence of HIV-1 according to the following principles:

RAA primer design principle:

(1) The GC content of the target area is 40-60%, and the target area does not contain forward or reverse repetitive sequences and palindromic sequences as much as possible;

(2) The primer length is 30-35 bases;

(3) Primer sequence:

1) The 5' -end (the first 3-5 bases) avoids the occurrence of repeated G, preferably C or T;

2) The 3' -end (last 3 bases) preferably has G and C;

3) The GC content is not more than 70% or less than 30%;

4) Avoiding the formation of secondary structure and primer dimer between the primers;

(4) Product length: the length of the amplified product is not more than 500bp, and the ideal length is 100-200bp.

The probe length of the real-time fluorescence RAA is 46-52 bases generally, and the 3' -end is modified by a blocking group to prevent the replication and the extension of DNA polymerase. A Tetrahydrofuran (THF) modification site for exonuclease cleavage is designed in the probe, the THF modification site is at least 30 bases away from the 5 'end and at least 15 bases away from the 3' end, and fluorescent groups and quenching groups are marked on two sides of the THF modification site. When the probe binds to the template, exonuclease III cleaves THF residues, and the fluorescent group separates from the quenching group, producing a fluorescent signal.

HIV-1 sequences have high variability, it is difficult to find long conserved fragments in the HIV-1 genome that are suitable as RAA amplified target sequences, and it is difficult to design sets of primers and probes that fully conform to the principles described above in defined conserved sequence regions. A large number of experiments show that even if the primer which does not completely accord with the principle can still obtain good amplification effect, and the primer is superior to the primer combination which accords with the principle. Therefore, on the basis of the RAA design principle, the invention performs optimal design and screening. Through a large number of experiments in the early stage, 6 candidate upstream primers (F1-F4), 4 candidate downstream primers (R1-R4) and 1 fluorescent probe (P) are initially obtained in the HIV-1 conserved region (pol region), and the position, length and sequence information of the primers are shown in FIG. 2 and the following table 2.

Table 2: RAA primer and probe position, length and sequence information

HIV-1 sequences have a high degree of variability and may affect amplification efficiency if the primers do not match perfectly with the viral nucleic acid sequences. In order to obtain the HIV-1 specific primer with higher matching degree with the HIV-1 subtype sequence in China, the invention further carries out multiple rounds of screening by using HIV-1 simulation samples of various subtypes, and selects the primer by comprehensively considering the peak time and the final fluorescence value of an amplification curve.

First, primer selection was performed using nucleic acid extracted from a T lymphocyte leukemia cell line (8E 5 cells) containing HIV-1 subtype B provirus as a template. Screening all reverse primers by adopting one forward primer to obtain candidate reverse primers with good amplification effect; and screening all forward primers by using the screened reverse primers to obtain candidate forward primers with good amplification effect.

Based on the results of the sequence analysis of HIV-1 in China, four subtypes CRF07_BC (GenBank: KC 492737.1), CRF08_BC (GenBank: KF 835534.1), CRF01_AE (GenBank: JX 112829.1), and pol region fragments (located in HXB2 4600-5100 bp) of B (GenBank: KU 724103.1) SEQ ID NO.12-15, which are mainly popular in HIV-1 in China, were cloned into pUC57 vectors to obtain four HIV-1 recombinant plasmids, and quantified using a Nanodrop One ultraviolet spectrophotometer.

These four recombinant plasmids were then used as templates (concentration 10 ⁷ copy/mL), the candidate upstream and downstream primers screened by the application 8E5 cells are screened again in pairs, each set of primers is repeated for three times, and preferably, the primer combination for subsequent detection is obtained.

In order to reduce the difference caused by different reaction batches in the primer probe screening process and ensure the comparability of results under different reaction conditions, a high-flux Bio-rad CFX96 instrument is selected for detection in the process, and the specific operation steps are as follows:

(1) The RT-RAA fluorescent kit (Jiangsu Qiyan F00R 01) is equilibrated to room temperature, and contains a reaction buffer solution V, a single-person reaction unit containing reaction components such as freeze-dried recombinase and magnesium acetate. The reaction mixtures shown in table 3 were prepared:

table 3: reaction mixture

(2) Adding 42.5 mu L of reaction mixed solution into a reaction unit, gently mixing to ensure that the freeze-dried powder in a reaction tube is fully and uniformly dissolved, transferring the uniformly mixed reaction solution into a PCR tube, and carrying out subsequent reaction.

(3) 2.5 mu L of magnesium acetate is added on the cover of the PCR tube, finally 5 mu L of template is added into the PCR tube, the PCR tube is covered, and then the PCR tube is put into a sample pretreatment system (Jiangsu Qiyan, B6108) to be automatically vibrated, mixed evenly and centrifuged to the bottom of the tube, and then the PCR tube is immediately placed in a Bio-rad CFX96 instrument. Nuclease-free water was also set up as a negative control for each experiment.

(4) Reaction conditions: the reaction was pre-reacted at 39℃for 40 seconds, after which the fluorescence was read every 30 seconds, and the reaction was set to end after 40 fluorescence reads.

Designed RAA primers were screened using 8E5 cell extracted nucleic acid as template. The combination of the downstream primer R4 with the upstream primers F1 to F6 was first performed, and the results are shown in FIG. 3. Preliminary screening results for the upstream primers showed that the primers were not significantly different in peak time, but the final fluorescence values were significantly different. The F4 and F3 amplification curves have early peak time and high final fluorescence value, and are set as candidate upstream primers. The downstream primers R1 to R4 were screened using the candidate upstream primer F4, and the results are shown in FIG. 4. The amplification curves of R3 and R4 had the earliest peak time, and R1 was slightly later than R3 and R4 in peak time of the amplification curves, but the final fluorescence values were highest, with R1, R3 and R4 being set as candidate downstream primers.

Further use is made of a high concentration (10 ⁷ Copy/. Mu.L) of the four HIV-1 subtype recombinant plasmids (CRF01_AE, CRF07_BC, CRF08_BC, B) as template screening candidate primers, combining the candidate upstream primer and the candidate downstream primer two by two, and repeating the detection of the recombinant plasmid of each subtype three times, the results of which are shown in FIG. 5. The F3/R4 and F4/R4 combination shows good amplification effect on recombinant plasmids of four subtypes. Since the length of the amplified product fragment is generally related to the amplification efficiency, it is preferable to use the F3/R4 primer combination with a shorter amplified fragment length as a primer combination for subsequent detection, although it is not excluded that the F4/R4 primer combination also has good detection performance, as a standard for shortening the amplified product length as much as possible to improve the amplification efficiency.

Example 2: optimization of HIV-1 rapid detection reaction conditions

In the present embodiment, use is made of

Viral RNA Mini Kit kit extracts HIV-1 subtype B strain RNA as a template, and optimizes the reaction system and reaction temperature of the HIV real-time fluorescence RT-RAA detection method. In order to set the temperature gradient and compare the detection results under different reaction conditions at the same time, reduce the difference caused by different reaction batches and ensure the comparability of the results, a high-throughput Bio-rad CFX96 instrument is also selected for detection in the process, and the detection method is shown in example 1.

(1) Optimizing primer and probe concentrations

The mixture of primers and probes (primer 10. Mu.M; probe 3.3. Mu.M) was added to the real-time fluorescent RT-RAA reaction system separately: the experiments were repeated three times at 1. Mu.L, 2. Mu.L, 3. Mu.L, 4. Mu.L, 5. Mu.L, and the results are shown in FIG. 6. And comparing the peak time and the final fluorescence value of the real-time fluorescence amplification curve to obtain the optimal primer probe concentration. As can be seen from FIG. 6, when the final concentrations of the primer and probe were 0.6. Mu.M and 0.2. Mu.M, respectively, the peak time of the amplification curve was the shortest and the final fluorescence value was relatively high.

(2) Optimizing reaction temperature

The recommended temperature for the RT-RAA amplification reaction was 39℃and 5 temperature gradients were set based on a temperature interval (37℃to 41 ℃) of 39℃increase or decrease of 2℃for optimal reaction temperature: the experiment was repeated three times at 37℃at 38℃at 39℃at 40℃at 41℃and the results are shown in FIG. 6. The detection result shows that the peak time of the amplification curve is shortened with the increase of the reaction temperature in the temperature range of 37-41 ℃, and the peak time is earliest when the reaction temperature is set to 41 ℃.

By optimizing the reaction conditions, it was confirmed that the final primer concentration was 0.6. Mu.M and the final probe concentration was 0.2. Mu.M in the subsequent RT-RAA detection reaction system, and the reaction temperature was set at 41 ℃.

Example 3: clinical sample detection

25 HIV-1 positive samples of known HIV-1 subtypes and viral loads (sample information is shown in Table 4, involving five subtypes CRF07_BC, CRF55_ B, CRF01_AE, CRF08_BC, 01B), 20 HIV-1 negative samples, and 9 HBV (hepatitis B virus), HCV (hepatitis C virus) and TP (treponema pallidum) infected samples (3 each for each pathogen) were taken for detection.

Table 4: viral load and subtype information table of 25 HIV-1 positive samples

Note that: the sample subtype is typed by the pol region; viral load detection used Rogowski reagent (Cobas TaqMan HIV-1v 2.0).

The detection comprises the following specific steps:

1. nucleic acid extraction: and (3) after the plasma sample is balanced to the room temperature, extracting virus nucleic acid by adopting a Lizhu nucleic acid extraction kit and a Lizhu full-automatic nucleic acid extraction instrument.

2. Nucleic acid detection:

(1) The RT-RAA fluorescent kit (Jiangsu Qijian, F00R 01) is equilibrated to room temperature, and contains a reaction buffer solution V, a single-person reaction unit containing reaction components such as freeze-dried recombinase and magnesium acetate. Primers and probes Using the primers and probes determined in example 1, reaction mixtures as shown in Table 5 were prepared:

table 5: reaction mixture

(2) Adding 42.5 mu L of reaction mixture into a reaction unit, adding 2.5 mu L of magnesium acetate on a reaction unit cover, adding 5 mu L of template into a reaction unit pipe, covering the pipe cover, putting into a sample pretreatment system (Jiangsu Qiyan, B6108), automatically oscillating, uniformly mixing, centrifuging to the bottom of the pipe, immediately putting into a constant temperature nucleic acid amplification analyzer (Jiangsu Qiyan, F1628), setting the reaction temperature to 41 ℃ and the reaction time to 25 minutes. Nuclease-free water was also set up as a negative control for each experiment. Positive is determined when an amplification curve occurs and the slope is > 20.

The detection results are shown in Table 6 below. The positive coincidence rate and the negative coincidence rate of the detection method are 100 percent (25/25, 0/20). The detection method of the present invention shows no cross-reaction with common blood-borne pathogens (HBV, HCV and TP) when detecting HIV-1, and shows high specificity against HIV-1.

Table 6: results of real-time fluorescent RT-RAA detection of clinical samples

Example 4: analog sample detection

Although in example 3 above, authentic clinical samples related to five HIV-1 subtypes crf07_bc, crf55_ B, CRF01_ae, crf08_bc, 01B have been tested, in order to further verify the subtype versatility and detection sensitivity of the detection method provided by the present invention, the present invention used authentic sequence synthesis recombinant plasmids of 10 HIV-1 subtypes to simulate HIV-1 samples, thereby overcoming the sample limitation problem. The 10 more common domestic HIV-1 subtypes are CRF07_BC (GenBank: KC 492737.1), CRF01_AE (GenBank: JX 112829.1), CRF08_BC (GenBank: KF 835534.1), CRF55_01B (GenBank: MN 067522), B (GenBank: KU 724103.1), CRF85_BC (GenBank: KU 992930), 0107 (GenBank: KX 159285), BC (GenBank: AY 967805), 01BC (GenBank: KF 250407), 01C (GenBank: KY 200517), respectively, of which the first four are the four subtypes identified in example 1. The pol region fragment shown in SEQ ID No.12-21 was cloned into pUC57 vector by the same synthesis method as described in example 1, thereby synthesizing 10 HIV-1 recombinant plasmids.

The HIV-1 recombinant plasmid samples of the above 10 subtypes were quantified and converted in copy number using an ultraviolet spectrophotometer, diluted by a factor of ten, and then detected using five gradient samples of each subtype (10 ⁰ To 10 ⁴ Copy/. Mu.L), detection method is described in example 3.

The detection results are shown in FIG. 7. The results show that the detection method provided by the invention can detect but is not limited to the 10 HIV-1 subtypes in the set amplification reaction time of 25 minutes, and shows the universality of the method for a plurality of HIV-1 subtypes. At concentrations as low as 10 copies/. Mu.L, all 10 subtypes above were successfully detected; at concentrations as low as 1 copy/. Mu.L, part of the subtype is still detectable, indicating a high sensitivity of the method. In addition, as can be seen from the detection results of FIG. 7, the amplification curves of all the detected samples have peaked within 10 minutes, so that the amplification reaction time can be further shortened to 10 minutes without affecting the final detection results, thereby realizing rapid detection of HIV-1.

Sequence listing

SEQ ID NO.1: f1 primer

GTACARATGGCAGTDTTCATHCACAATTTTAA

SEQ ID NO.2: f2 primer

GCAGTACARATGGCAGTDTTCATHCACAATT

SEQ ID NO.3: f3 primer

ACAGCAGTACARATGGCAGTDTTCATHCACAA

SEQ ID NO.4: f4 primer

AARACAGCAGTACARATGGCAGTDTTCATHCAC

SEQ ID NO.5: f5 primer

TAARACAGCAGTACARATGGCAGTDTTCAT

SEQ ID NO.6: f6 primer

GCTGARCAYCTTAARACAGCAGTACARATGGCA

SEQ ID NO.7: r1 primer

CTTCACCTTTCCARAGNAGYTTKGCTGGTCCTT

SEQ ID NO.8: r2 primer

TACTGCCCCTTCACCTTTCCARAGNAGYTT

SEQ ID NO.9: r3 primer

TGTATYACTACTGCCCCTTCACCTTTCCARA

SEQ ID NO.10: r4 primer

CYTGTATYACTACTGCCCCTTCACCTTTCCA

SEQ ID NO.11: fluorescent probe

GGATTGGGGRRTACAGTGCAGGRGAAAGAATATAGAYATAATAGCAAC

SEQ ID NO.12: pol gene sequence of cn.2013.bjmp3116b

TACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCTGCCTGTTGGTGGGCAGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAATGAATTAAAAAAGATTATAGGACAGGTAAGAGACCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAAGGAACTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAACATAACAGTGA

SEQ ID NO.13: pol gene sequence of crf07_bc.cn.2005.pxjdc6291

TTCACCAGTGCTGCAGTTAAGGCAGCCTGTTGGTGGGCAGGTATCCAACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTAAGAGATCAAGCTGAGCACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGATATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTATAAAAATTCAAAATTTCCGGGTTTATTACAGAGACAGCAGAGACCCCATTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGATTATGGAAAACAGATGGCAGGTGCTGATTGTGTGGCAGGTAGACAGGATGA

SEQ ID NO.14: pol gene sequence of CRF08_BC.CN.2007.07CNYN355

GCAGGTGTCCACCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTAAGAGATCAAGCTGAGCACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACAAGAGAATTACAAAAACAAATTATAAAAATTCAAAATTTTCGGGTTTATTACAGAGACAGCAGAGACCCCATTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACATGGAATAGTTTAGTAAAACACCATA

SEQ ID NO.15: pol gene sequence of crf01_ae.cn.2007.gx070003

ATCCCCTACAATCCCCAAAGTCAAGGGGTAGTAGAATCCATGAATAAGGAATTAAAGAAAATCATAGGGCAGATAAGAGAGCAAGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGATATAAAAGTAGTACCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACATGGAACAGTTTAGTAAAACATCATATGTACATCTCAAAGAAAGCTAAAA

SEQ ID NO.16: pol gene sequence of 01BC (KF 250407)

TGCAGCCAAGGCCGCCTGTTGGTGGGCGGGGATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTAAGAGACCAAGCAGAGCACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAACAGAGATCCACTTTGGAAAGGACCAGCAAAGCTTCTTTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAACAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAAATCATCAGGGATTATGGAAAACAGATGGCAGGGGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACA

SEQ ID NO.17: pol gene sequence of 01C (KY 200517)

TGCAGTTAAAGCAGCCTGTTGGTGGGCCAATGTCCGACAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAGGAATTAAAGAAAATCATAGGGCAGGTAAGAGAGCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGAGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAACTAAAGAACTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGATATAAAAGTAGTACCAAGAAGAAAAGCGAAGATCATCAGAGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGAATTAGAACA

SEQ ID NO.18: pol gene sequence of CRF85_BC (KU 992930)

TGCAGTTAAGGCAGCCTGCTGGTGGGCAGGTATCCATCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAGGGGGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTAAGAGATCAAGCTGAGCACCTTAAAACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGATATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAGATTACAAAAATTCAAAATTTTCGGGTTTATTACAGAGACAGCAGAGACCCCAGTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAAAACAGATGGCAGGTGCTGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACA

SEQ ID NO.19:0107 (KX 159285) pol Gene sequence

TGCAGTTAAGGCAGCCTGTTGGTGGGCAGGTCTCCAACAAGAATTTGGAATTCCCTACAATCCCCAGAGTCAGGGAGTAGTAGAATCCATGAATAAAGAATTAAAGAAAATTATAGGGCAGGTAAGAGATCAAGGTGAGCACGTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATACAAAATAAAGAATTACAAAAACAAATTACAAAAATCCAAAATTTTCGGGTTTATTACAGAGACAGCAGAGACCCCAGTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAAAACAGATGGCAGGCGCTGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACA

SEQ ID NO.20: pol gene sequence of BC (AY 967805)

TTCGGTTAAGGCCGCCTGTTGGTGGGCGGGGATCAAACAGGAATTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGATAAGAGATCAAGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAGAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGACCCCATTTGGAAAGGACCAGCCAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAGGTAGTACCAAGGAGGAAAGCAAAAATCATTAAGGACTATGGAACACAGATGGCAGGTGCTGATTGTGTGGCAGGTAGACAGGATGAAGATTAGAACA

SEQ ID NO.21: pol gene sequence of CRF55_01B (MN 067522)

TGCAGTCAAAGCAGCCTGTTGGTGGGTCAATGTCCAACAGGAATTTGGGATCCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAGGAATTAAAGAAAATCATAGGACAGGTAAGAGAGCAAGCTGAACACCTTAAGACAGCAGTACAAATGGCAGTATTCATTCACAATTTTAAAAGAAAAGGGGGGATTGGGGGATACAGTGCAGGGGAAAGAATAATAGACATAATAGCAACAGACATGCAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAATTTGGAAAGGACCAGCAAAACTACTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGACAATAGTGATATAAAAGTAGTACCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAGGTAGACAGGATGAGGATTAGAACA。

Claims

1. A primer set for amplifying HIV-1 nucleic acid, the primer set comprising:

A downstream primer: CYTGTATYACTACTGCCCCTTCACCTTTCCA (SEQ ID NO. 10).

2. A fluorescent probe for detecting HIV-1 nucleic acid, the fluorescent probe having the nucleic acid sequence: 5'-GGATTGGGGRRTACAGTGCAGGRGAAAGAATATAGAYA TAATAGCAAC-3' (SEQ ID NO. 11); preferably, the fluorescent probe is provided with a tetrahydrofuran residue modification site, the site is at least 30 bases away from the 5' end of the fluorescent probe and at least 15 bases away from the 3' end of the fluorescent probe, a fluorescent group and a quenching group are respectively marked on two sides of the tetrahydrofuran residue site, and the 3' end of the fluorescent probe is modified by a blocking group.

3. The fluorescent probe according to claim 2, wherein the 31 st base of the fluorescent probe is modified with a fluorescent reporter group, the 34 th base is modified with a fluorescent quenching group, and the 33 th base is replaced with a tetrahydrofuran residue.

4. The fluorescent probe of claim 3, wherein the fluorescent reporter group is FAM, the fluorescent quenching group is BHQ1, and the blocking group is C3-Spacer.

5. Use of the primer set for amplifying HIV-1 nucleic acid according to claim 1 and the fluorescent probe for detecting HIV-1 nucleic acid according to any one of claims 2-4 for the preparation of an HIV-1 diagnostic reagent.

6. A method of detecting HIV-1 for non-diagnostic purposes comprising the steps of:

(1) Providing an HIV-1 nucleic acid sample;

(2) Preparing a real-time fluorescent reverse transcription-recombinase mediated amplification (RT-RAA) reaction system, the real-time fluorescent RT-RAA reaction system comprising: an HIV-1 nucleic acid as a template, the primer set of claim 1, and the fluorescent probe of any one of claims 2-4;

7. The method according to claim 6, wherein the amplification reaction is carried out at 37 ℃ to 41 ℃, preferably 41 ℃ for 25 minutes or less, such as 10 minutes.

8. The method according to claim 6 or 7, wherein the working concentration of each primer is 0.2-1.0. Mu.M, preferably 0.4-0.8. Mu.M, more preferably 0.6. Mu.M.

9. The method according to any one of claims 6-8, wherein the concentration of the fluorescent probe is 0.07-0.33 μΜ, preferably 0.13-0.27 μΜ, more preferably 0.2 μΜ.

10. A kit for detecting HIV-1, comprising:

a) The primer set of claim 1;

b) The fluorescent probe according to any one of claims 2 to 4; and

c) Instructions for how to use the kit.