miRNA combination for identifying stem cell exosomes and qRCR primer thereof
Technical Field
The invention belongs to the technical field of exosome identification, and in particular relates to a miRNA combination for identifying stem cell exosomes and a qPCR primer thereof.
Background
The exosomes consist of lipid bilayers, the exosomes contain a variety of transmembrane proteins, and the lipid bilayers contain a variety of nucleic acids, including RNA and DNA. Exosomes play an important role in many physiological pathologies, such as antigen presentation in immunity, tumor growth and migration, repair of tissue damage, etc.
In recent years, research has begun to emphasize the importance of miRNAs, including EV secreted miRNAs, due to their role in regulating the regulatory network of target genes involved in important cellular processes. These mirnas are non-coding regulatory RNAs consisting of 21-24 nucleotides that play an important role in posttranscriptional gene expression by binding to the 3 'untranslated region (3' utr) of the target messenger RNA (mRNA), resulting in mRNA degradation or inhibition of translation. Each miRNA can regulate hundreds of mRNA targets in the stem cell gene regulatory network and has been shown to regulate and control the function of various stem cells, including their ability to self-renew, differentiate, age, induce pluripotency and reprogram. In addition, certain mirnas control cell fate decisions, transdifferentiation, and lineage conversion, and thus play a critical role in the aging process.
Currently, the identification of stem cell exosomes is mainly reflected by the following aspects: 1. protein content: the exosomes were analyzed qualitatively and quantitatively for specific proteins by ELISA and Sodium Dodecyl Sulfate (SDS) -polyacrylamide gel electrophoresis (PAGE). Or using conventional BCA protein assay kit for protein quantification. 2. Identification of surface markers: the use of antibodies to exosome markers, followed by flow cytometry to quantify marker proteins from exosomes (e.g., CD9, CD63 and CD 81), is currently used in a wide range of nanofluidics by the xiaomen fowls. 3. Physicochemical properties of exosomes: such as particle size and concentration and morphology, concentration and particle size analysis of exosomes can be performed using NanoSight instruments or Tuned Resistance Pulse Sensing (TRPS), transmission Electron Microscopy (TEM) to observe the morphology and size of exosomes. 4. Identification of the content: the qPCR method is used for identifying certain miRNAs in exosomes, and is widely used for developing kits for early diagnosis of cancers.
The existing protein quantification method can only quantitatively analyze surface markers, exosomes with different sources have no obvious difference, and the quality and activity of the exosomes have no specific relation with the surface markers; the detection sensitivity of the grain size, concentration and morphology of exosomes is low, the exosome amount required by detection is large, and no standard specific relation is established between exosome activity and the indexes. Less research on identification of exosome miRNA inclusion, especially anti-inflammatory and senescence-associated miRNAs for stem cell exosomes, lacks specific identification qPCR primers.
Disclosure of Invention
The technical problem to be solved by the present invention is to overcome the above problems in the prior art, and first provide a miRNA combination for identifying stem cell exosomes.
A second object of the present invention is to provide a primer set for identifying the stem cell exosome miRNA combination.
A third object of the present invention is to provide a kit for identifying the stem cell exosome miRNA combination.
The aim of the invention is achieved by the following technical scheme:
a miRNA combination for identifying stem cell exosomes, the miRNA combination comprising miR125b-1, miR-183, miR-17-3p.
According to the invention, through carrying out high-throughput sequencing analysis on microRNA of stem cell exosomes, the microRNA with the most abundant content in the stem cell exosomes is found to be: miR125b-1, miR-183 and miR-17-3p. Thus the miRNA combinations may be used as miRNA combinations for identifying stem cell exosomes.
The invention also provides a primer group for identifying the stem cell exosome miRNA combination, and the sequence of the primer group is shown as SEQ ID NO: 1-3.
The invention also provides a kit for identifying the stem cell exosome miRNA combination, which comprises the primer group.
The invention also provides a method for performing qPCR by using the kit.
Preferably, the method comprises the following steps:
s1, extracting miRNA from stem cell exosome body weight;
s2, taking the miRNA obtained in the S1 as a template, and finishing tailing and reverse transcription in the same reaction system; the primer set of claim 2 in the reaction system;
and S3, carrying out reverse transcription to obtain cDNA for qPCR detection.
More preferably, the reaction system of S2 is: total RNA 7. Mu. L, trans
mi RNART Enzyme Mix 1. Mu.L, 2X TS miRNAReaction Mix. Mu. L, RNase-
free Water 3. Mu.L, and a total volume of 20. Mu.L.
More preferably, the conditions for S3 reverse transcription are: 25℃for 5 min, 50℃for 45 min and 85℃for 5 min.
Compared with the prior art, the invention has the following beneficial effects:
according to the invention, through carrying out high-throughput sequencing analysis on microRNA of stem cell exosomes, the microRNA with the most abundant content in the stem cell exosomes is found to be: miR125b-1, miR-183 and miR-17-3p. Thus the miRNA combinations may be used as miRNA combinations for identifying stem cell exosomes. These three mirnas are related to stem cell exosomes anti-inflammatory and anti-aging, and the amount of exosomes extracted with mirnas is very low (only 2E8 exosome particles). Meanwhile, qPCR primers aiming at the miRNA combination are designed, and the three primers have strong specificity and can be used for identifying stem cell exosomes in a qPCR method.
Drawings
FIG. 1 shows the detection of exosome particle size and concentration by a nanoflow instrument;
FIG. 2 is an illustration of the anti-inflammatory activity of stem cell exosomes;
FIG. 3 is a graph showing qPCR detection results.
Detailed Description
The following describes the invention in more detail. The description of these embodiments is provided to assist understanding of the present invention, but is not intended to limit the present invention. In addition, the technical features of the embodiments of the present invention described below may be combined with each other as long as they do not collide with each other.
EXAMPLE 1 extraction of Stem cell exosomes and verification of Activity
Exosomes are extracted from the supernatant of umbilical cord mesenchymal stem cells by using an ultracentrifugation method, and the concentration and vesicle purity of the exosomes are detected by using a nanofluidic instrument after extraction.
The extraction method comprises the following steps:
taking 20ml of mesenchymal stem cell supernatant, centrifuging 10000g for 30 minutes, taking supernatant, centrifuging 100000g for 90 minutes, discarding sediment, and re-suspending the supernatant with 1ml of 1 XPBS to obtain exosomes.
Nano flow meter detection conditions: taking 50 μl of exosome sample, performing on-machine detection, recording the particle number in 60s, storing a report, and calculating the particle size and concentration of the exosome sample by software according to the data of the concentration standard and the particle standard.
The results are shown in FIG. 1, where the left panel shows the particle size range of the exosome samples (the particle sizes of stem cell exosomes are all substantially in the range of 50-150 nm).
Human PBMC cells were treated with the resulting stem cell exosomes. The supernatants were then collected and assayed for IFN-gamma secretion by PBMC cells under different treatment conditions by ELISA. Treatment conditions: stem cell exosomes at different concentrations were incubated with human PBMC cells for 24h, cell supernatants were collected and assayed for IFN-gamma secretion by ELISA. The results show that the stem cell exosomes obtained in the present invention have anti-inflammatory effects, and are able to reduce IFN- γ secretion (fig. 2).
Example 2 establishment of qPCR method for detecting quality of Stem cell exosomes
The stem cell exosomes were subjected to microRNA high throughput sequencing as follows: and extracting microRNA by using a microRNA detection kit, and then realizing accurate quantification of miRNA by second generation sequencing (NGS). As a result, the microRNAs with the most abundant content in stem cell exosomes are found as follows: miR125b-1, miR-183 and miR-17-3p.
qPCR primer sequences of miR125b-1, miR-183 and miR-17-3p are designed and synthesized, and are shown in tables 1, 2 and 3.
TABLE 1 qPCR primer sequences for miR125b-1
TABLE 2 qPCR primer sequences for miR-183
Primer name
|
Primer sequence (5 '-3')
|
miR-183-1
|
CCGCAGAGTGTGACTCCTGT
|
miR-183-2
|
AGCAGAGACAGATCCACGA
|
miR-183-3
|
CACTGTGAACAGTCTCAGTCA
|
miR-183-4
|
ACTGGTAGAATTCACTGTGAAC |
TABLE 3 qPCR primer sequences for miR-17-3p
Primer name
|
Primer sequence (5 '-3')
|
miR-17-3p-1
|
GTCAGAATAATGTCAAAGTGC
|
miR-17-3p-2
|
ACTGCAGTGAAGGCACTTGTA
|
miR-17-3p-3
|
AAAGTGCTTACAGTGCAGGTA |
To verify the accuracy of the sequencing data, the test was performed using Poly (a) tailing and q PCR.
Taking 1×10
9 Extracting individual stem cell exosome sample, extracting microRNA from the sample by using miRNA extraction kit, using the extracted microRNA as template, and using Trans in the same reaction system
mi RNART Enzyme Mix (comprising tailing enzyme and reverse transcriptase), 2X TS mi RNAReaction Mix one step to accomplish efficient tailing and first strand cDNA synthesis. Poly (A) tailing and reverse transcription are completed in the same reaction system. RNA samples were taken and 20. Mu.L of the reaction system (on ice) was prepared according to the kit instructions, gently mixed, incubated at 37℃for 1 hour, and heated at 85℃for 5s to inactivate RT Enzyme Mix. The cDNA obtained after reverse transcription was used for qPCR detection, reverse transcription conditions: 25 ℃ for 5 minutes, 50 ℃ for 45 minutes, and 85 ℃ for 5 minutes; the reverse transcription system is shown in Table 4.
TABLE 4 reverse transcription system
Table 5Cq value comparison
The qPCR method can detect miR125b-1, miR-183 and miR-17-3p in stem cell exosomes, the three miRNAs are related to anti-inflammatory and anti-aging of the stem cell exosomes, the dosage of extracting the miRNA exosomes is extremely low (only 2E8 exosome particles), and the specificity of three primers miR125b-1-3, miR-183-4 and miR-17-3p-3 is high as obtained from a qPCR detection peak diagram (figure 3) and a Cq value (table 5), so that the method can be used for identifying the stem cell exosomes in the qPCR method.
The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, and yet fall within the scope of the invention.