CN115873937B

CN115873937B - Biomarker for predicting occurrence of repeated planting failure and application thereof

Info

Publication number: CN115873937B
Application number: CN202210973641.XA
Authority: CN
Inventors: 黄伯贤; 陆嘉逢; 郭灵; 李红; 刘振兴; 钱春凤
Original assignee: Suzhou Municipal Hospital
Current assignee: Suzhou Municipal Hospital
Priority date: 2022-08-15
Filing date: 2022-08-15
Publication date: 2023-07-14
Anticipated expiration: 2042-08-15
Also published as: CN115873937A

Abstract

The invention discloses a biomarker NSUN2 for predicting repeated planting failure occurrence in an assisted reproduction technology. The effect of NSUN2 expression levels or methylation levels on the occurrence of repeated planting failures is disclosed, and the efficiency of embryo ball adhesion is found to be significantly reduced after NSUN2 overexpression or hypermethylation. The discovery of the invention provides a new thought and theoretical basis for the prediction, diagnosis and prognosis of diseases related to embryo adhesion, implantation and implantation.

Description

Biomarker for predicting occurrence of repeated planting failure and application thereof

Technical Field

The invention belongs to the technical field of endometrial function detection, and particularly relates to a repeated planting failure prediction biomarker and application thereof in endometrial receptivity detection.

Background

Repeated planting failure (Recurrent Implantation FailureRIF) refers to embryo transfer failure with an age of <40 years and more than or equal to 3 times in the past; or more than or equal to 2 embryo transfer failures, and the number of transferred embryos is more than or equal to 4 high-scoring blastomeres (D3 embryos of class I or class II) or more than or equal to 2 high-scoring blasts (Gardner blasts scoring AA/AB/BA/BB) or 2 high-scoring blastomeres and 1 high-scoring blasts.

Pregnancy is the result of successful implantation of the embryo into the endometrium, followed by adequate deciduation of the endometrium, and placenta formation. Each of these steps requires the participation of a number of cytokines and physiological processes to reach the necessary balance for gestational development. Implantation is the binding of a dynamic interaction between the functioning endometrium and blastocyst. The implantation phase requires the involvement of a variety of physiological processes, requiring the adhesion of embryos, invasion of trophoblasts and homeostasis of immunomodulation. Successful implantation depends to a large extent on the proper structure and adequate tolerability of the endometrium. The period of higher embryo implantation rate, which we call the implantation window (Thewindow of implantationWOI), depends on the high tolerability of the endometrium. Endometrial receptivity is the result of a number of physiological and molecular mechanisms, and during embryo transfer, it is important to identify WOI and maintain endometrial receptivity.

The negative detection of blood HCG indicates implantation failure after embryo transfer about half a month. Due to the complex embryo implantation process, assessment of the cause of RIF is required from multiple layers. Although the exact mechanism of the occurrence of RIF has not been fully elucidated, many studies have shown that hormonal imbalance, angiogenesis and immune regulator disorders, certain genetic polymorphisms are associated with the occurrence of RIF. RiF risk factors mainly comprise female age, BMI, pressure, smoking of male and female, etc., and the occurrence causes mainly comprise embryo factors, endometrial receptivity, diseases, etc. Embryo factors include chromosomal or genetic abnormalities, embryo culture conditions, zona pellucida hardening, type and technique of embryo transfer. Factors affecting endometrial receptivity mainly include immune factors, infectious factors, expression of related cellular molecules, uterine cavity abnormalities, and the like. The existing research finds NK cells and T cells in cellular immunity; IL1a, IL1b, IL6, IL15 of the interleukin family; leukemia inhibitory factor (Leukemia Inhibitory Factor, LIF) vascular endothelial growth factor VEGF; homologous box gene a10 (HOXA 10); fork transcription factors FOXO1, KLF12; claudin family protein 4 (CLDN 4) and the like are involved in the regulation of the mechanism of RIF generation.

RNA methylation is one of the common chemical modification modes of RNA, belongs to the category of epigenetic science, and recent researches find that RNA methylation is involved in the regulation of various biological functions and is related to pathogenesis of various diseases. More studies are currently being made on m6A (N6-methyladenosine, 6-methyladenine) and m5C (5-methyladenosine, 5-methylcytosine). m5C is widely present in a variety of RNAs, including cytoplasmic and mitochondrial ribosomes RNA (cytoplasmic and mitochondrial ribosomal RNA) and transfer RNAs (trnas), as well as messenger RNAs (mrnas), enhancer RNAs (enonas), and many non-coding RNAs (ncrnas). In eukaryotes, m5C methylation is catalyzed by the NOL1/NOP2/SUN domain (NSUN) family of enzymes (NSUN 1-7) and the DNA methyltransferase homolog DNMT 2. In recent years, numerous studies have revealed a variety of molecular functions of m5C in RNA processing, such as mRNA export, RNA stability, translation, and long distance transport of plant RNA. In addition, m5C modification of RNA also plays an important regulatory role in mitochondrial activity, stress, gametogenesis and embryogenesis, neurological and brain development, and the development and migration of a variety of tumors.

In summary, no exact index is available at present to predict the occurrence of repeated planting failures. Therefore, a marker capable of accurately predicting the occurrence of repeated planting failure is urgently needed, and theoretical basis is provided for diagnosis and treatment of the occurrence of repeated planting failure.

Disclosure of Invention

In view of the above problems, the inventors have found through multi-angle studies that an increase in the expression level of NSUN2 causes a decrease in the embryo adhesion level, and NSUN2 can be used as a biomarker to predict the occurrence of repeated planting failure.

In particular, a first aspect of the invention provides the use of the NSUN2 gene or protein as a biomarker in the manufacture of a reagent for repeated planting failure (RIF), embryo implantation failure risk prediction and/or endometrial receptivity assessment.

In a second aspect, the invention provides the use of a detection reagent for NSUN2 gene or protein in the manufacture of a kit for repeated planting failure (RIF), embryo implantation failure risk prediction and/or endometrial receptivity assessment.

In certain embodiments, the agent detects the level of transcription of the gene by one or a combination of methods of real-time fluorescent quantitative PCR and high throughput sequencing.

Preferably, the detection reagent of the NSUN2 gene comprises a primer and/or a probe for NSUN2 real-time fluorescence quantitative PCR detection; more preferably, the forward primer and the reverse primer of the NSUN2 real-time fluorescent quantitative PCR detection are respectively set forth in SEQ ID NO:1 (ACCTGGCTCAAAGACCACACAG) and SEQ ID NO:2 (TGGCTTGATGGACGAGCAGGTA).

In certain embodiments, the agent detects the level of the protein by one or a combination of methods selected from BCA protein quantification, immunohistochemistry, western blotting, and ELISA.

Preferably, the detection reagent for the NSUN2 protein comprises an NSUN2 specific antibody.

In certain embodiments, the reagent detects the methylation level of the gene by high throughput sequencing.

In certain embodiments, the test sample of the kit is endometrial tissue of a RIF patient; preferably endometrial tissue during the embryo implantation window.

In a third aspect the invention provides a kit for repeated planting failure (RIF), embryo implantation failure risk prediction and/or endometrial receptivity assessment, said kit comprising: reagents for detecting the transcriptional level of the NSUN2 gene, reagents for detecting the methylation level of the NSUN2 gene, and/or reagents for detecting the level of the NSUN2 protein.

In a fourth aspect, the invention provides a method for assessing the endometrial receptivity in a tissue sample for non-disease diagnostic and therapeutic purposes, said method comprising detecting the level of NSUN2 gene transcription, the level of NSUN2 gene methylation and/or the level of NSUN2 protein in the tissue; taking the transcriptional level of NSUN2, the methylation level of NSUN2 gene or the NSUN2 protein level value of patients with repeated planting failure or embryo implantation failure as a control; a level of NSUN2 gene transcription, a level of NSUN2 gene methylation, and/or a NSUN2 protein higher than the control indicates poor endometrial tissue intima tolerance.

A fifth aspect of the invention provides a system for repeated planting failure (RIF), embryo implantation failure risk prediction, and/or endometrial receptivity assessment, comprising: 1) A reagent for detecting the transcript level of NSUN2, the methylation level of NSUN2 and/or the detection of the protein level of NSUN 2; 2) The device comprises a data input module, a data comparison module and a conclusion output module.

In certain embodiments, the data input module is configured to input a transcript level value of NSUN2 in the test sample.

In certain embodiments, the data comparison module is configured to compare the transcriptional level value of the test sample NSUN2 with a control value; the control value is the transcript level of NSUN2, the methylation level of NSUN2 gene or the protein level of NSUN2 in patients with repeated planting failure or embryo bed failure.

In some embodiments, the conclusion output module is configured to output the conclusion according to the following criteria: if the transcript level of NSUN2, methylation level of NSUN2 gene or NSUN2 protein level in the sample of the subject is higher than or close to the control value, the subject is a repeated planting failure or candidate embryo implantation failure or poor endometrial receptivity.

Compared with the prior art, the invention has the beneficial effects that:

the invention discovers a biomarker NSUN2 for repeated planting failure (RIF) for the first time. The expression level or methylation level of NSUN2 affects the risk of repeated planting failures, and after NSUN2 is over-expressed or over-methylated, the adhesion efficiency of embryo balls is significantly reduced. The invention provides a new thought and theoretical basis for prediction, diagnosis and prognosis of diseases related to embryo adhesion, implantation and implantation.

Drawings

Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:

FIG. 1BCA measures NSUN2 protein levels in RIF patients.

FIG. 2 real-time quantitative PCR detection of mRNA levels in RIF patients.

FIG. 3 high throughput sequencing detects mRNA levels and methylation levels in RIF patients. FIG. 3A shows a comparison of m5C related writers in RIF group versus CTRL group expression level differences; FIG. 3B shows a thermal map analysis of the overall methylation level of genes between RIF and CTRL groups. FIG. 3C shows a comparison of the number of sites of m5C modification in RIF and CTRL groups. FIG. 3D shows a comparison of the number of m5C modified genes in RIF and CTRL groups.

FIG. 4 effect of over-expression of NSUN2 on adhesion efficiency of embryos. Fig. 4A shows comparison of the NSUN2 over-expressed group versus the control group for blastomere adhesion. Fig. 4B shows the embryo ball adhesion efficiency statistics for NSUN2 over-expressed group versus control group. Fig. 4C shows comparison of embryo ball adhesion efficiency for NSUN2 over-expressed group versus control group.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. It will be apparent that the described embodiments are some, but not all, embodiments of the invention. All other embodiments, which can be made by a person skilled in the art without creative efforts, based on the described embodiments of the present invention fall within the protection scope of the present invention.

Unless defined otherwise, technical or scientific terms used herein should be given the ordinary meaning as understood by one of ordinary skill in the art to which this invention belongs.

The invention is illustrated below with reference to specific examples.

EXAMPLE 1BCA determination of NSUN2 protein levels in RIF patients

From among cases clinically treated for assisted reproduction, 3 cases (designated as RIF1, RIF2, RIF 3) of patients with repeated planting failure (RIF) and 3 cases (designated as Ctrl1, ctrl2, ctrl 3) of control group were collected, and medium-term endometrium was secreted. Protein in intima tissue was extracted after grinding the tissue and lysing with lysate, BCA measured protein concentration. The protein concentration was diluted to 2. Mu.g/. Mu.L, and the protein was subjected to protein electrophoresis in equal amounts. After transfer, blocking was performed with 5% skim milk and incubation was performed overnight with primary antibodies to NSUN2 and GAPDH on a 4 ℃ shaker.

The next day is incubated with secondary antibodies of the same species, and development and photographing are carried out by preparing a developing solution. As a result, as shown in fig. 1, NSUN2 protein expression levels in endometrial tissues of patients with repeated failure of implantation were found to be significantly higher than those of the control group.

EXAMPLE 2 real-time quantitative PCR detection of mRNA levels in RIF patients

3 cases of repeated planting failure (RIF) patients and 3 cases of control group cases were collected from cases of clinically assisted reproductive treatment. Tissue was ground using a cryogrinder and then added to Trizol to lyse cells, releasing RNA from the cells. The obtained RNA precipitate is eluted with a proper amount of enzyme-free water after chloroform extraction, isopropanol precipitation and ethanol washing, and concentration measurement is carried out. The obtained RNA was subjected to reverse transcription to obtain a single-stranded DNA template, and then subjected to further Q-PCR experiments to determine the mRNA expression levels of NSUN2 and GAPDH. The results are shown in fig. 2, where the mRNA expression level of NSUN2 in endometrial tissue was significantly higher than that of the control group in secretory phase of patients with repeated failure of planting.

The primer probe sequence of the Q-PCR is as follows:

NSUN2(human)F：ACCTGGCTCAAAGACCACACAG(SEQ ID NO：1)；

NSUN2(human)R：TGGCTTGATGGACGAGCAGGTA(SEQ ID NO：2)；

GAPDH(human)F:GTCTCCTCTGACTTCAACAGCG(SEQ ID NO：3)；

GAPDH(human)R：ACCACCCTGTTGCTGTAGCCAA(SEQ ID NO：4)。

example 3 high throughput sequencing detection of mRNA and methylation levels in RIF patients

3 cases of repeated planting failure (RIF) patients and 3 cases of control group cases were collected from cases clinically treated for assisted reproduction, mid-secretion endometrium and RNA was extracted. mRNA was isolated from total RNA and further subjected to BSP experiments to convert the C base on the mRNA, modified by m5C, to a U base. And constructing an RNA library, and performing high-throughput methylation sequencing after quality control is qualified. The results are shown in fig. 3, which shows that the expression level of NSUN2 is significantly increased in the patient with repeated planting failure, while the overall methylation level of the endomembrane is significantly increased in the patient with repeated planting failure. Specifically, FIG. 3A shows a comparison of m5C related writers in RIF group versus CTRL group expression level differences; FIG. 3B shows a thermal map analysis of the overall methylation level of genes between RIF and CTRL groups. FIG. 3C shows a comparison of the number of sites of m5C modification in RIF and CTRL groups. FIG. 3D shows a comparison of the number of m5C modified genes in RIF and CTRL groups.

Example 4 Effect of over-expression of NSUN2 on adhesion efficiency of embryos

NSUN2 was overexpressed on the endometrial cancer cell line (Ishikawa), plated on 6-well plates on the first day using Ishikawa, with a plating cell number of 3.0X10≡5. Plasmid transfection was performed 24 hours after plating, NSUN2 over-expression plasmid was transfected into 3 wells, while the other 3 wells were incubated with pcdna3.1 as a control, serum-free DMEM was used for 48 hours, serum-containing DMEM was replaced, suspension culture was performed with human choriocarcinoma cell line (Bewo), and cell balloon mock blasts of uniform diameter were selected.

The same number of mock embryo spheres was inoculated into NSUN2 overexpressing Ishikawa cells as well as control cells. After 2 hours of co-culture, the dish was gently shaken and the detached cell pellet was washed off with dPBS. 4% paraformaldehyde is fixed for 30 minutes at room temperature. The residual adherent cell pellet count was performed under a microscope and the results are shown in fig. 4, where the embryo pellet adhesion efficiency was significantly lower in NSUN2 overexpressed tissues than in the control group. Specifically, fig. 4A shows comparison of the NSUN2 over-expressed group with the control group, and the embryo ball adhesion. Fig. 4B shows the embryo ball adhesion efficiency statistics for NSUN2 over-expressed group versus control group. Fig. 4C shows comparison of embryo ball adhesion efficiency for NSUN2 over-expressed group versus control group.

While the fundamental and principal features of the invention and advantages of the invention have been shown and described, it will be apparent to those skilled in the art that the invention is not limited to the details of the foregoing exemplary embodiments, but may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.

Furthermore, it should be understood that although the present disclosure describes embodiments, not every embodiment is provided with a separate embodiment, and the description is provided for clarity only, and those skilled in the art will recognize that the embodiments of the disclosure may be combined appropriately to form other embodiments that will be understood by those skilled in the art.

Claims

Use of a detection reagent for NSUN2 gene expression level or NSUN2 protein level in the preparation of a kit for endometrial receptivity assessment; the detection sample of the kit is endometrial tissue in embryo implantation window period.
2. The use according to claim 1, wherein the reagent detects the NSUN2 gene expression level by one or a combination of two methods of real-time fluorescent quantitative PCR and high throughput sequencing.
3. Use according to claim 2, characterized in that the detection reagent of the NSUN2 gene expression level comprises primers and/or probes for real-time fluorescent quantitative PCR detection of NSUN2 gene.
4. The use according to claim 3, wherein the forward primer and the reverse primer of the NSUN2 gene real-time fluorescent quantitative PCR assay are set forth in SEQ ID NO:1 and SEQ ID NO: 2.
5. The use according to claim 1, wherein the reagent detects the NSUN2 protein level by BCA protein quantification method.
6. Use of an agent that detects NSUN2 gene expression levels and/or NSUN2 protein levels in the manufacture of an endometrial receptivity assessment system, characterized in that the system comprises: 1) An agent for detecting NSUN2 gene expression level and/or NSUN2 protein level; 2) The device comprises a data input module, a data comparison module and a conclusion output module; the detection sample of the reagent is endometrial tissue in embryo implantation window.