CN113881674B

CN113881674B - Application of LINC00958 in preparation of reagent and kit for diagnosing and monitoring chronic myelocytic leukemia

Info

Publication number: CN113881674B
Application number: CN202111253160.3A
Authority: CN
Inventors: 姚芳苡; 黄波; 程瑛; 钟芳敏; 王小中
Original assignee: Second Affiliated Hospital to Nanchang University
Current assignee: Second Affiliated Hospital to Nanchang University
Priority date: 2021-10-27
Filing date: 2021-10-27
Publication date: 2022-11-25
Anticipated expiration: 2041-10-27
Also published as: CN113881674A

Abstract

The invention discloses application of a long-chain non-coding RNA LINC00958 in preparation of a reagent for diagnosing and monitoring diseases of chronic myelocytic leukemia or a kit containing the diagnostic reagent. The invention has higher sensitivity and specificity, can more simply and accurately observe the change of the disease condition so as to adopt treatment means in time, and has higher clinical application value.

Description

Application of LINC00958 in preparation of reagent and kit for diagnosing and monitoring chronic myelocytic leukemia

Technical Field

The invention relates to application of a long-chain non-coding RNA LINC00958 serving as a marker in diagnosis and disease monitoring of chronic myelocytic leukemia, and application in preparation of a corresponding detection reagent and a kit.

Background

Chronic Myelogenous Leukemia (CML) is a malignant clonal disease originating from pluripotent hematopoietic stem cells, is one of the most common leukemias in our country, and accounts for about 15% -20% of new adult leukemias. Philadelphia chromosome (Philadelphia, ph) [ t (9; 22) (q 34; q 11) ] is a characteristic cytogenetic alteration that encodes the production of a BCR/ABL1 fusion protein with strong tyrosine kinase activity that abnormally activates multiple downstream signaling pathways for sustained phosphorylation, stimulates abnormal proliferation and malignant transformation of hematopoietic cells, and is closely associated with the onset of CML. The natural course of CML is generally divided into three stages of a chronic stage, an accelerated stage and an acute stage, the chronic stage is relatively long and the symptoms are controllable, in recent years, the application of targeted TKIs medicaments has better clinical curative effect, partial patients can achieve complete remission, but the conditions of untimely and reasonable treatment, poor medicament reaction, relapse and the like still exist, so that the disease progresses, the disease enters the acute stage after a short accelerated stage, and once the disease is changed suddenly, the prognosis is very poor.

The existing treatment measures of CML mainly comprise chemotherapy, targeted drug therapy, bone marrow transplantation and the like, applicable treatment schemes are different in different stages of the disease course, the disease condition needs to be accurately judged, and an effective treatment scheme is selected, so that early diagnosis of the disease, disease monitoring and sudden change early warning have important guiding significance for clinical treatment.

For the diagnosis of CML diseases, there is no unified standard at home and abroad at present. The main diagnosis indexes include bone marrow/peripheral blood primary cell count, splenomegaly degree, fusion gene bcr/abl quantification, clinical drug reactivity and the like. However, there is no specific symptom in the early stage of CML, and these indicators are too dependent on the biological phenotype and clinical expression of CML cells, and have diagnostic value only in a certain stage, and are not sensitive enough for early diagnosis, and the disease course cannot be monitored effectively and continuously, resulting in missing the optimal treatment time in clinic. Therefore, the two closely connected important links of early diagnosis and disease monitoring of CML are urgent to seek breakthrough.

Early changes in cancer include deregulation of epigenetic events, such as abnormal levels of non-coding RNAs. The long-chain non-coding RNA is RNA which is more than 200 nucleotides in length and does not code protein, can interact with DNA, RNA and protein, plays a role in various biological processes such as cell proliferation, differentiation, apoptosis and the like through the modes of chromatin reconstruction, the whole process of transcription, regulation, post-transcriptional modification and the like, and is an important role in the biological progress of human health and diseases. Long-chain non-coding RNA expression has spatiotemporal specificity for organs, tissues, cell types, developmental stages, and disease conditions, making it a candidate for diagnostic and prognostic biomarkers and gene therapy targets. Recent studies show that long non-coding RNA is closely related to tumorigenesis and development. Retrospective studies show that the CML characteristic fusion gene BCR/ABL1 can be regulated by long-chain non-coding RNA and is closely related to the CML disease occurrence and disease progression.

The long-chain non-coding RNA LINC00958 is a newly discovered non-coding RNA, and the length of the non-coding RNA is 1576 nucleic acids. According to the invention, the abnormal level of LINC00958 is closely related to the CML development for the first time, the overexpression of LINC00958 can inhibit the CML development, the action mechanism of the LINC00958 needs to be further researched, and the action of LINC00958 in CML is not reported yet at present. The research of the invention finds that LINC00958 can be used as a novel biomarker for CML patients, so that the invention clarifies the feasibility of using LINC00958 to carry out CML diagnosis and disease monitoring on patients for the first time.

Disclosure of Invention

The invention aims to provide a diagnostic reagent and a diagnostic kit which can be used for accurately and early diagnosing chronic myelocytic leukemia and monitoring the disease condition, and a method for detecting the LINC00958 expression amount by using the reagent or the kit.

One aspect of the invention provides a use of LINC00958 in preparing a reagent for diagnosing and monitoring chronic myelocytic leukemia or a kit containing the reagent, wherein the LINC00958 nucleotide sequence is shown as SEQ ID No. 1.

Another aspect of the invention is: a method of diagnosing and disease monitoring for diagnosing whether a subject is chronic myeloid leukemia is provided, the method comprising at least three steps: (a) Determining the expression level of LINC00958 in a sample of peripheral blood PBMCs from a subject suspected of being in chronic myeloid leukemia; and

(b) Assessing whether the subject has chronic myelogenous leukemia based on the expression level of LINC 00958; and

(c) The subject is assessed for chronic/acute/complete remission stage of chronic myelogenous leukemia based on the amount of LINC00958 expression.

As a preferred embodiment of the present invention, the evaluating comprises:

(1) Assessing whether the subject has chronic myelogenous leukemia based on the determined expression level of LINC 00958; comparing the expression level with a predetermined threshold value, wherein the expression level is lower than the threshold value a, indicating that the subject has chronic myelocytic leukemia.

(2) Assessing whether the subject is in chronic stage of chronic myelogenous leukemia based on the determined expression level of LINC 00958; comparing the expression level with a predetermined threshold, the expression level being below threshold a and above threshold b, indicating that the subject is in chronic phase of chronic myelogenous leukemia.

(3) Assessing whether the subject is in chronic myelogenous leukemia acute phase based on the determined expression level of LINC 00958; comparing the expression level with a predetermined threshold, wherein an expression level below threshold b indicates that the subject is in acute stage of chronic myelogenous leukemia.

(4) Assessing whether the chronic myelogenous leukemia of the subject is completely remitted according to the determined expression level of LINC 00958; the expression level is compared to a predetermined threshold, and an expression level above threshold c indicates complete remission in the subject.

As a preferred embodiment of the invention, the diagnostic and condition monitoring agent comprises an agent that detects the expression level of the long non-coding RNA LINC00958 or a partial fragment thereof.

As a preferred embodiment of the invention, the diagnostic and condition monitoring kit comprises reagents for detecting the expression level of the long non-coding RNA LINC00958 or a partial fragment thereof.

As a preferred embodiment of the invention, the reagent for detecting the expression level of the long-chain non-coding RNA LINC00958 or the partial fragment thereof comprises a nucleic acid amplification primer pair for detecting the long-chain non-coding RNA LINC 00958.

As a preferred embodiment of the invention, the sequences of the primer pair are shown as SEQ ID NO.2 and SEQ ID NO.3, and the upstream 5'-3' of the primer pair is: ctacacagaccgccaggtagc, downstream 5'-3': GGCTGGAGCCCACCATCCATTAG.

As a preferred embodiment of the present invention, the diagnostic and disease monitoring kit comprises a nucleic acid amplification primer pair of LIN00958 and/or a nucleic acid amplification primer pair for detecting reference gene GAPDH.

As a preferred embodiment of the present invention, the nucleic acid amplification primer pair for detecting LIN00958 has a primer upstream 5'-3': ctacacagaccgccaggtagc, downstream 5'-3': GGCTGGAGCCCACCATCCATTAG. The nucleic acid amplification primer pair for detecting the reference gene GAPDH has a primer upstream 5'-3': tgcaccaccacacactgcttagc 3, downstream 5'-3'; GGCATGGACTGTGGTCATGAG.

As a preferred embodiment of the invention, the kit also comprises a reverse transcription reagent, SYBR Green fluorescent dye, PCR buffer solution and DEPC water.

The invention has the following beneficial effects:

the LINC00958 is used for diagnosing chronic myelocytic leukemia and monitoring the disease condition, has higher sensitivity and specificity, can observe the disease progress in a simpler and more accurate method as soon as possible, adopts treatment means in time, and has higher clinical application value.

Drawings

FIG. 1 is a graph of RT-qPCR verified that LINC00958 expresses in various groups.

FIG. 2 is a graph of the diagnostic value of LINC00958 of the present invention between groups.

FIG. 3 is a graph of the present invention over-expressing LINC00958 inhibiting CML cell line proliferation and promoting apoptosis.

Detailed Description

The present invention will be described in further detail with reference to specific examples. It should be understood that the scope of the above-described subject matter of the present invention is not limited to the following examples, and any technique realized based on the contents of the present invention is within the scope of the present invention. The technical means and procedures used in the following examples are conventional means and procedures well known to those skilled in the art, and the raw materials used are commercially available, unless otherwise specified.

The inventor adopts RT-qPCR technology to detect the expression condition of LINC00958, compares CML acute change patients, CML chronic stage patients and CML total RNA difference of Peripheral Blood Mononuclear Cells (PBMCs) of completely remitting patients and normal control groups, and finds that the expression quantity of LINC00958 has obvious difference between healthy people and CML at different disease stages. The effect of LINC00958 in CML is preliminarily verified by adopting a disease cell model, and the result proves that the high-expression LINC00958 can inhibit malignant biological behaviors of a CML cell line.

Experimental procedures for the specific conditions not specified in the examples below are generally performed according to conventional conditions such as those described in Sambrook et al, A handbook of molecular cloning laboratories (New York: cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations.

Example 1

1. CML patient group specimen Collection

According to NCCN diagnostic standard of CML in 2016, 39 cases of a CML chronic phase group (CML-CP) which is not treated in the primary diagnosis, 12 cases of a CML acute phase group (CML-BP) and 23 cases of a CML complete remission group (CML-CHR) are collected, and 30 samples of the same-period health physical examination are collected as a control group.

2. Peripheral blood mononuclear cell extraction

Ficoll density gradient centrifugation: (1) putting 2.5ml of whole blood into a 15ml centrifuge tube, diluting with 2.5ml of PBS solution, and gently mixing; (2) a15 ml centrifuge tube was first charged with 5ml of Ficoll solution. The diluted blood was then gently pipetted onto the Ficoll upper layer (to avoid mixing the two solutions); (3) centrifuging at 2000rpm for 20min; (4) sucking the white cell layer (PBMC) by a pipette and putting the white cell layer into a clean 15ml centrifuge tube; (5) adding PBS to 10-15ml,1500rpm,10min, centrifuging, removing supernatant, adding Trizol, and mixing. Storing at-80 deg.C for use.

3. Total RNA extraction

TRIzol method: (1) adding 0.5ml TRIzol/5 × 106 PBMCs, placing in a ribozyme-free EP tube, repeatedly blowing, and standing at room temperature for 5min; (2) adding 0.1ml chloroform/1 ml TRIzol, shaking vigorously for 15s, standing at room temperature for 2-3min; (3) centrifuging at 12000rpm for 15min at 4 deg.C, wherein the top colorless aqueous layer (about 50%) is RNA layer (three visible layers, and mixing of three layers of liquid is avoided); (4) gently sucking the upper layer water phase into a new EP tube (avoiding sucking the middle layer), adding 0.25ml isopropanol/1 ml TRIzol, reversing and mixing, and standing at 4 deg.C for 20min; (5) centrifuging at 12000rpm for 10min at 4 deg.C, discarding supernatant, and allowing colloidal precipitate to be visible on the side wall and bottom of EP tube; (6) the RNA sediment is blown and beaten by 0.5ml of 75 percent ethanol solution (prepared by absolute ethanol and ribozyme-free water), mixed evenly and washed, and then centrifuged for 5min at 4 ℃ and 8000 rpm; (7) removing supernatant to obtain RNA precipitate, drying at room temperature for 5-10min, adding ribozyme-free water (appropriate amount) to dissolve RNA, and storing at-80 deg.C for use.

4. RT-qPCR analysis

1. And quantitatively detecting the expression level of LINC00958 among groups by a real-time fluorescent quantitative PCR method. Total RNA from each group was removed with RQ1 DNase to remove DNA. And (4) determining the purity and concentration of the total RNA for later use.

2. Synthesis of template DNA, cDNA: the prepared total RNA is subjected to reverse transcription according to the instruction of a Takara reverse transcription reaction kit, and a reaction system is prepared as follows:

of these, 100ng of total RNA was converted into the volume required to be added according to the RNA concentration. The preparation system needs to be operated on ice, so that accurate sample adding is realized, and operation errors are avoided. The prepared system needs to be stippled, mixed evenly and centrifuged, then placed on a PCR amplification instrument for reverse transcription, the reaction conditions are 15min at 37 ℃, 5s at 85 ℃ and 30min at 4 ℃, the amplification product (namely the template cDNA) is taken out in time after the reverse transcription is finished, and the amplification product is stored at 20 ℃ for later use.

SYBR Green method RT-qPCR detection: (1) LINC00958 primer and reference gene GAPDH primer are synthesized by Huada gene company, and are respectively dissolved in water without ribozyme to be 20nmol/ml for standby; (2) RT-qPCR reaction system prepared according to Takara fluorescent quantitative kit is as follows:

(3) reaction conditions are as follows: firstly, the temperature is 95 ℃ for 30s, then the circulation is carried out for 40 times according to the sequence of 95 ℃ for 5s and 60 ℃ for 34s, and finally the temperature is 95 ℃ for 15s, 60 ℃ for 60s and 95 ℃ for 15s; (4) to reduce the test error, 3 replicates were run for each sample. (5) And (3) analysis results: the amplification effect is judged by combining the amplification curve and the dissolution curve, and 2 ^-ΔΔCt Calculating the expression level of the target gene.

5. Experimental implementation

1. Grouping design: case samples 39 cases in CML-CP group, 12 cases in CML-BP group, 23 cases in CML-CHR group, and 30 cases in HC group.

2. Main test consumable

6. Results of the experiment

Analysis of RT-qPCR results

The expression level of LINC00958 is detected by RT-qPCR, the expression conditions of LINC00958 in peripheral blood mononuclear cells of a healthy control group (30 cases), a CML chronic phase group (39 cases), a CML acute change group (12 cases) and a CML complete remission group (23 cases) are analyzed, and the results show that compared with healthy controls, LINC00958 is low expressed in CML patients, the expression level of CML-BP patients is obviously lower than that of CML-CP patients, and the expression level of LINC00958 of CML-CRH patients is obviously higher than that of CML-CP and CML-BC. The difference was statistically significant (P < 0.05), the CML-CHR expression level was not different from that of healthy controls, and the difference was not statistically significant (FIGS. 1A-B). Namely the expression level of LINC00958 in CML patients is related to the disease progression, and the expression level of LINC00958 is reduced along with the disease progression and is increased along with the disease remission, so that the LINC00958 can be used for monitoring the CML disease.

Diagnostic value of LINC00958 in CML.

ROC curve analysis was used to assess the significance of LINC00958 in CML.

(1) LINC00958 was able to significantly distinguish between the healthy control group and the CML group (i.e. CML chronic phase group and CML acute phase group). The ROC curve is shown in FIGS. 2A-C, the combined diagnostic AUC values for healthy control and CML are 0.877, 95% confidence interval-1.455to-0.7694, P < 0.0001; the AUC values for the diagnosis of the healthy control group and CML-CP were 0.840, 95% confidence interval-1.41to-0.634, P < 0.0001, the AUC values for the diagnosis of the healthy control group and CML-BP were 1.000, 95% confidence interval-2.062to-0.7492, P < 0.0001, indicating that the detection of the expression level of LINC00958 is of higher value for the diagnosis as well as for the early diagnosis of CML patients.

(2) LINC00958 was able to significantly distinguish the CML-CP group from the CML-BP group. The ROC curve, as shown in FIG. 2D, with AUC values of 0.966, 95% confidence interval-0.6296to-0.1379, P =0.0029, indicates that detection of LINC00958 expression levels is of higher value for early warning of acute changes in CML patients.

(3) LINC00958 can significantly distinguish CML group and CML-CHR group (i.e. CML chronic phase group and CML acute phase group). The ROC curve is shown in FIG. 2E, the AUC value is 0.862, 95% confidence interval 1.183-2.269, and P is less than 0.0001, which indicates that the detection of LINC00958 expression level provides basis for the determination of remission of CML patients.

Therefore, the invention considers that the LINC00958 expression level in the PBMCs of peripheral blood can be used as a biomarker for CML diagnosis and disease condition monitoring.

Example 2

1. The biological behavior of LINC00958 on CML cell line K562 cells.

EDU staining: for detecting cell proliferation. According to the operation of the reagent specification, 1 × 106 cells in logarithmic growth phase are taken, the EdU solution diluted by the complete medium 1 is incubated for 2 hours together, PBS is used for washing twice, 4% paraformaldehyde is fixed for 30 minutes at room temperature, and 2mg/mL glycine is used for decoloring; 0.5% Triton X penetrant incubation, adding Apollo staining reaction solution, incubating for 30 minutes at room temperature in the dark, 0.5% Triton X penetrant decolorizing shaking table incubation for 10min, adding Hoechst33342, incubating for 30 minutes at room temperature in the dark, washing with PBS, staining completed, and taking a photograph with a fluorescence microscope.

CCK8 experiment: used for detecting the proliferation condition of cells. Taking each group of transfected cells, adjusting the cell density to be 1 multiplied by 105/mL, taking 0.1 mL/well to inoculate a 96-well cell culture plate, respectively culturing for 0h, 12h, 24h and 48h in a 5-percent CO2 incubator at 37 ℃, adding 10 microliter CCK8 reagent into each well, continuously culturing for 3h in the incubator, measuring the absorbance OD value of each well at 450nm/630nm by using an enzyme labeling instrument, repeating 3 wells in each group of experiments, and calculating and drawing a cell proliferation curve.

Flow cytometry: used for detecting the apoptosis condition. Each set of 1X 106 cells was collected by centrifugation according to kit instructions, rinsed 2 times with pre-chilled PBS, and the cells resuspended by adding 0.1ml of 1X Binding Buffer. 5 microliters of Annexin V-PE and 5 microliters of 7-AAD were added, incubated for 10 minutes in the dark, and 0.4ml of 1 XBinding Buffer was added. The flow cytometer detects the fluorescent intensity of the FL2 and FL3 channels at an excitation wavelength of 488nm within 1 hour.

2. Experimental implementation

1. Grouping design: CML cell lines K562 and KCL22 were transfected as required and divided into NC group for transfection of empty plasmid and LINC00958 group for overexpression of LINC00958, respectively.

2. Main test consumable

3. Results of the experiment

Overexpression of LINC00958 inhibited CML cell line proliferation and promoted apoptosis.

Successful transfection was confirmed by RT-qPCR after overexpression of LINC00958 in CML cell lines K562 and KCL22 (FIG. 3A). CCK8 experiments show that the proliferation curve of the LINC00958 overexpression group is obviously lower than that of the control group (figure 3C), P is less than 0.001, and the difference has statistical significance. In EdU staining, cell proliferation in the LINC00958 overexpressing group was significantly less than in the NC control group (fig. 3B) in 2H co-cultured with cells and EdU, i.e., the proliferative capacity of the CML cell line was significantly reduced after overexpression of LINC 00958. Flow cytometry detection of apoptosis ratio of each group shows that apoptosis rate of CML cell line is increased remarkably after LINC00958 is over-expressed (FIG. 3D). Suggesting that LINC00958 overexpression can promote CML apoptosis. The results show that the high-expression LINC00958 can inhibit malignant biological behavior of the CML cell line, which is consistent with the condition that LINC00958 is low expressed when the condition of the CML cell line progresses and is high expressed when the condition of the CML cell line is relieved.

The above steps are preferred embodiments of the present patent, but the present patent is not limited to the above embodiments, and those skilled in the art or researchers can make corresponding changes in various fields of knowledge without departing from the spirit of the present patent.

Sequence listing

<110> second subsidiary Hospital of Nanchang university

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1575

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 1

tctctctctc tctcctgctg cattgtgaag aaactgcttg cttccctctc accctctgca 60

gtttcctgag gcctccccag ccatgcggaa cgctgtagac caagacctgg aattaacaca 120

tcagaagatt ctatgaggaa acccatttaa aaataggatg catttttttc ttttctgcac 180

agggagaaag tttaagctct cctcactatg agttttcaag tataaaagac tttttcttcc 240

acgattttga gaacaactga ggactcttgt gaccaggaca acagggaagc ttgcagcaag 300

atagctccag gttggattca tgcttcgcac cccaagggct gccagccaga gaggaggaga 360

agcaatcact cctgcagttt ctgaacacta cacagacgcc aggtagcttc ttcaggagaa 420

cagccctctg aggaggcagg aagaggaggc ttatctttca gcagccggag ctgctgagat 480

ctctgggcag attaagctct ctctaatgga tgggctccag cctggcacat tcagtggaga 540

gggatccact catccatcat caacataata tggtcctccc tgcacttcac agtgtcctct 600

tgctattgaa aaggcttttt tgccttctca agtttctttg tcaacagtct acaggaagaa 660

gctcaggccg ccaccggcag aggtgaatgc aagctcacgt tttatttctg actgcttaat 720

cattgcctcg atcactgctc aagctctgcc tttgtttcca aaggttacct gtgggaaaac 780

ttctttttct atgctgaaat taatagggag gcaaagatga gtccactgat aagcagagcc 840

ttaaaactca catagagaaa caactttgct ggagtgtgtg tgagtgaacc actaaggaat 900

cagatagtgt gatggcagtt atcattgcag gttaagacat ttctacaaat atttcgacat 960

ctccatatac tcactccttt cccccctgag tggagagact cagctaccaa gagaggaagc 1020

tcaaaaaaaa cagaagcttc aaacaaacaa ccaaccaaaa aaaaaaaaaa actgtgggtt 1080

catcagaggt ggtagggaag acaaaaacat gggaggagca gctgggcacg gtggctcaag 1140

cctgtaatcc cagcactttg cgaggctgag gtgggtggat cacctgaggt caggagttcg 1200

agaccagcct ggccaacatg gtgaaacccc atctctacta aaaatacaaa aaattagccg 1260

ggcgttgtgg tacgcacctg taatcccagc tactccggag gctgaggcag cagaatcgct 1320

tgaacccagg aggcagaggt tgcaacgagc caagatcgca ccattgcact ccagcctggg 1380

caacaagagc gaaactccat ctaaaaaaaa caaacaagca aacaaacaaa aaacacggga 1440

ggagcaataa aaaggaatcc atgctttgat tttttttttt agtgagagga agggaaggct 1500

gctgcctctc acttctccct gttttgttgt tcttttaagt agcatgtgtc actctgtaaa 1560

aaaaaaaaaa aaaaa 1575

<210> 2

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 2

ctacacagac gccaggtagc 20

<210> 3

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 3

ggctggagcc catccattag 20

<210> 4

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 4

tgcaccacca actgcttagc 20

<210> 5

<211> 21

<212> DNA

<213> Unknown (Unknown)

<400> 5

ggcatggact gtggtcatga g 21

Claims

1. The application of a reagent for detecting the expression level of the long-chain non-coding RNA LINC00958 in preparing a kit for diagnosing and monitoring the condition of chronic myelocytic leukemia is disclosed, wherein the nucleotide sequence of the long-chain non-coding RNA LINC00958 is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein the reagent for detecting the expression level of the long-chain non-coding RNA LINC00958 comprises a nucleic acid amplification primer pair for detecting the long-chain non-coding RNA LINC 00958.

3. The use according to claim 1, wherein the primer pair has the sequence shown in SEQ ID NO.2 and SEQ ID NO.3, and has a primer sequence 5'-3' upstream of the primer pair: ctacacagaccgccaggtagc, downstream 5'-3': GGCTGGAGCCCATCATTAG.

4. The use of claim 1, wherein the kit further comprises a reference gene GAPDH primer pair; the sequences of the GAPDH primer pair are shown as SEQ ID NO. 4 and SEQ ID NO. 5.

5. The use of claim 1, wherein the kit further comprises a reverse transcription reagent, SYBR Green fluorescent dye, PCR buffer, DEPC water.