CN108938659A

CN108938659A - A kind of method and drug and their application of modulation of appetite and weight

Info

Publication number: CN108938659A
Application number: CN201710356871.0A
Authority: CN
Inventors: 彭长庚; 温婷
Original assignee: Kunshan Pengji Kaifeng Biological Science & Technology Co Ltd
Current assignee: Kunshan Pengji Kaifeng Biological Science & Technology Co Ltd
Priority date: 2017-05-19
Filing date: 2017-05-19
Publication date: 2018-12-07
Also published as: WO2018210259A1

Abstract

The present invention relates to biomedicine fields, disclose the method and drug and their application of a kind of modulation of appetite and weight.It discloses and miR-183 function is inhibited to put on weight, enhancing functions of intestines and stomach, increasing the application in subcutaneous fat and Skin Cell in fat content.Also disclose the method for inhibiting the function of miR-183, it include: to contact miR-183 inhibitor with the target cell of expression miR-183, also disclose the inhibitor for inhibiting miR-183 function, it include the pharmaceutical composition and kit of the inhibitor, they are preventing and/or treating weak syntexis, anorexia, indigestion, functions of intestines and stomach, skin care, are enhancing application at least one of skin elasticity and gloss.By inhibiting the function of miR-183, it can effectively whet the appetite with functions of intestines and stomach to put on weight and body fat content, reach constitutional purpose.

Description

A kind of method and drug and their application of modulation of appetite and weight

Technical field

The present invention relates to biomedicine fields, and in particular, to by inhibiting the function of miR-183 putting on weight, increasing Application in strong appetite and functions of intestines and stomach, increase subcutaneous fat and Skin Cell in fat content, a kind of function inhibiting miR-183 Can method, a kind of inhibitor based on miR-183, pharmaceutical composition and kit and they in the function for inhibiting miR-183 Application in energy is especially preventing and/or is treating weak syntexis, anorexia, indigestion, functions of intestines and stomach, skin care, enhancing skin Application at least one of skin elasticity and gloss.

Background technique

Existing research shows that brain (hypothalamus is even more important)-stomach central axis is to appetite, digestion and absorption and sugar, rouge generation It thanks and plays important adjustment effect^[1], thus gene expression with the variation of astogeny is likely to the elderly in hypothalamus-stomach Thin, the main reason for functions of intestines and stomach is weak, subcutaneous fat content is low and skin kraurosis.In addition, some researches show that brain-stomach-livers Central axis plays important adjustment effect to glycolipid metabolism^[2], show that brain-stomach-liver central axis may be the new target device of metabolic disease Official's system^[3]。

More and more evidences show that microRNA (microRNA, miRNA) plays important work in energy metabolism regulation With^[4].MicroRNA be a kind of length be 16-25nt non-coding RNA molecule (www.mirbase.org), can by with target gene Partial complementarity matches rna expression and/or protein expression to identify simultaneously silencing of target genes.Mature microRNA is loaded into RNA induction Silencing complex (RISC) on after, combined by base pairing with the complementary series in target gene mRNA 3'-UTR, from And causes the degradation of mRNA and/or inhibit the translation of its protein.The second at the end microRNA 5' is to the 8th nucleotide quilt The complementary pairing of referred to as " core sequence ", this seven nucleotide and target gene is the key that identification target gene, and pairing degree is higher, In conjunction with adjust target gene a possibility that and ability it is bigger.Other sequences and target gene except microRNA " core sequence " simultaneously Complementary pairing can also enhance its combine and regulation target gene ability.It just because of microRNA is known by non-fully matching Not and the expression of target gene is adjusted, just enables a microRNA intracellular while adjusting to varying degrees multiple target bases at one Cause.

Summary of the invention

The drug of control appetite, digestion and absorption and glycolipid metabolism the purpose of the present invention is exploitation based on microRNA.

To achieve the goals above, on the one hand, the present invention provides inhibit the function of miR-183 putting on weight, enhancing Application in appetite and functions of intestines and stomach, increase subcutaneous fat and Skin Cell in fat content, especially in preparation for preventing And/or drug and/or food that treatment syntexis, anorexia, indigestion, functions of intestines and stomach are weak, or for skin care, enhancing skin Application in the cosmetics and skincare product of skin elasticity and gloss.

Second aspect, the present invention provides a kind of methods of function of inhibiting miR-183, wherein this method comprises: will MiR-183 inhibitor is contacted with the target cell of expression miR-183.

The third aspect, the present invention provides a kind of miR-183 inhibitor, wherein the miR-183 inhibitor is that antisense is few Nucleotide, including antisense DNA and antisense RNA, the antisense oligonucleotides is complementary with miR-183, and has 8-40 nucleotide Length；Or the miR-183 inhibitor is the siRNA of miR-183 precursor.

Fourth aspect, the present invention also provides a kind of pharmaceutical compositions, wherein the pharmaceutical composition contains as described above MiR-183 inhibitor and pharmaceutically acceptable carrier.

5th aspect, the present invention also provides a kind of kits, wherein the kit includes miR- as described above 183 inhibitor, optionally, the kit further include pharmaceutically acceptable carrier.

6th aspect, the present invention also provides method as described above, miR-183 inhibitor as described above, institutes as above Application of the pharmaceutical composition and/or kit as described above stated in the function of inhibiting miR-183；Especially increasing body Weight whets the appetite and the application in functions of intestines and stomach, increase subcutaneous fat and Skin Cell in fat content；More preferably preventing And/or treatment syntexis, anorexia, indigestion, functions of intestines and stomach are weak, skin care, enhance in skin elasticity and gloss at least one Application in kind.

7th aspect, the present invention also provides miR-183 inhibitor as described above, pharmaceutical compositions as described above to exist Prepare the application in the drug for inhibiting the function of miR-183；Especially in preparation for preventing and/or treating syntexis, detest Food, indigestion, functions of intestines and stomach weak drug and/or food, or the beauty for skin care, enhancing skin elasticity and gloss Hold the application in skin care item.

The present invention can sufficiently be inhibited by contacting miR-183 inhibitor with the target cell of expression miR-183 The function of miR-183 is (including inhibiting the combination of miR-183 and its target gene or reducing the expression quantity of miR-183, to inhibit The function of miR-183), when for individual administration, it can effectively prevent and/or treat miR-183 expression quantity and increase to be drawn The disease risen, for example, diseases such as syntexis, anorexia, indigestion, functions of intestines and stomach are weak, subcutaneous fat is few.Therapy provided by the invention Can comprehensively modulation of appetite, stomach digestion and absorption function and glycolipid metabolism, and be oligonucleotides；Thus effect is powerful and secondary work With small.

Other features and advantages of the present invention will the following detailed description will be given in the detailed implementation section.

Detailed description of the invention

The drawings are intended to provide a further understanding of the invention, and constitutes part of specification, with following tool Body embodiment is used to explain the present invention together, but is not construed as limiting the invention.In the accompanying drawings:

Fig. 1 be hypothalamus, in stomach and liver miR-183 expression figure, wherein the miR-183 in 12 monthly age mouse Expression is significantly higher than the expression of the miR-183 in the mouse at 2 monthly ages.

Fig. 2A is the linear relationship chart that miR-183ASO dosage inhibits the functional effect of miR-183 with it.

Fig. 2 B is that miR-183ASO, random controls nucleotide, miR-183 mispairing ASO inhibit miR-183 on a cellular level Functional effect comparison diagram.

Fig. 3 A is the comparison diagram of the mouse changes of weight at any time of stomach-filling miR-183ASO and PBS respectively.

Fig. 3 B is the comparison diagram of the mouse body weight increase rate at any time of stomach-filling miR-183ASO and PBS respectively.

Fig. 4 is the appetite comparison diagram of the mouse of stomach-filling miR-183ASO and PBS respectively.

Fig. 5 is pair of the kidney for distinguishing the mouse of the trimestral miR-183ASO and PBS of stomach-filling, the weight of epididymal adipose tissues stomach function regulating Than figure.

Fig. 6 is the comparison diagram that the siRNA and random controls RNA of miR-183 influences miR-183 expression.

Specific embodiment

Detailed description of the preferred embodiments below.It should be understood that described herein specific Embodiment is merely to illustrate and explain the present invention, and is not intended to restrict the invention.

Unless otherwise indicated, there is scientific and technical terminology used herein the term routinely understood with those skilled in the art to have There is identical meaning.

The present inventor has found in the process of research, compared to the mouse at 2 monthly ages, master control appetite, digest and assimilate and MiR-183 in the hypothalamus of energetic supersession-stomach axle center is obviously raised in 12 monthly age mouse, and the expression in liver And significantly raise.Based on the above discovery, inventor utilizes TargetScanHuman (www.targetscan.org) to calculate again Method predicts the target gene of the miR-183 guarded in vertebrate, then compares and finds with KEGG access, many miR-183 Target gene be enriched in gastric acid secretion, salivary secretion, phosphatidylinositols signal path, insulin signaling pathway and type-II diabetes Signal path (table 1).Separately there is the target gene of 68 miR-183 to be located at the access in MAPK signal path and takes part in fat cell point Change, cholesterol transport, type-II diabetes^[5,6]；There is the target base of 84 miR-183 to belong to and adjusts glucose metabolism, fat cell point The PI3K-Akt signal path of change^[5,7]；It is located at TGF- relevant to obesity, diabetes, hepatopathy with the target base of 26 miR-183 Beta signal path^[5,8,9]；And the target base of 34 miR-183 is located at the GnRH signaling for adjusting blood glucose and metabolism Pathway [10] (table 1).

Table 1

Based on the above research, the inventors found that miR-183 can be used as the marker of appetite and functions of intestines and stomach, And it then demonstrates by inhibiting the function of miR-183 that appetite can be enhanced and increasing function, weight and the fat weight of stomach.

Therefore, the present invention provides inhibit the function of marker miR-183 preventing and/or treating following disease and/disease Application in shape: caused by the diseases such as syntexis, anorexia, indigestion, functions of intestines and stomach are weak, subcutaneous fat is few and subcutaneous fat reduction Wrinkle of skin and chapped skin, increase skin elasticity and gloss at skin care.The present invention also provides a kind of miR-183 inhibition Agent by the miR-183 inhibitor in the method for the function of inhibiting miR-183, and includes the drug of miR-183 inhibitor Composition and kit and they put on weight, whet the appetite with functions of intestines and stomach, increase in subcutaneous fat and Skin Cell Application in fat content；More preferably prevent and/or treat weak syntexis, anorexia, indigestion, functions of intestines and stomach, skin care, Enhance the application at least one of skin elasticity and gloss；Further preferably preparation for prevent and/or treat it is thin, Anorexia, indigestion, functions of intestines and stomach weak drug and/or food, or for skin care, enhancing skin elasticity and gloss Application in cosmetics and skincare product.

In the present invention, term " functions of intestines and stomach is weak " refers to compared with the functions of intestines and stomach under normal or daily state, individual Functions of intestines and stomach decline, it may for example comprise the decrease of the functions such as digestion and absorption of gastrointestinal system.

Method

The present invention provides a kind of methods of function of inhibiting miR-183, wherein this method comprises: miR-183 is inhibited Agent is contacted with the target cell of expression miR-183.

In a preferred case, miR-183 has SEQ ID No:1 (the miR-183 sequence complete one of people and mouse Cause) nucleotide sequence shown in (UAUGGCACUGGUAGAAUUCACU).

According to the present invention, described " function of inhibiting miR-183 " refers to compared to without using the same of the method for the present invention processing The degree that miR-183 lowers its expression of target gene in the target cell of the expression miR-183 of kind, using described in of the invention handle Expressing the degree lowered to its expression of target gene of miR-183 in the target cell of miR-183 reduces at least 0.5 times, usually can be with Reduce at least 1 times, such as Fig. 2A and Fig. 2 B.

The present invention provides the method for inhibiting miR-183 function in the target cell for expressing miR-183 in vivo or in vitro.Term " function of inhibiting miR-183 ", which refers to, to be made with reagent and directly or indirectly acting on miR-183 by miR-183 adjusting The expression quantity of target gene increases.Its method includes but is not limited to following several:

1) small molecule compound

MiR-183 inhibitor includes but is not limited to naturally occurring or artificial synthesized small molecule compound, and this kind of small point Sub- compound directly acts on miR-183 and the expression quantity by the miR-183 target gene adjusted is increased, usually molecular weight Organic compound greater than 50 and less than 2500 dalton.This kind of candidate compound possesses and protein, and especially hydrogen bond is mutual The functional group of effect, and at least one amine is generally comprised, carbonyl, hydroxy or carboxy group.These small molecules miR-183 inhibits Agent can be found by suitable screening technique or other methods.

2) antisense oligonucleotides

The antisense oligonucleotides can by the function of binding directly to inhibit target miR-183 with target miR-183, including Antisense RNA and antisense DNA.Preferably, the antisense oligonucleotides is complementary with miR-183, the length with 8-40 nucleotide, And there is the sequence complementary with the 2-8 of miR-183 position nucleotide.

As described in the background section, well known, microRNA can be identified and be sunk by matching with target gene partial complementarity The expression and/or translation of silent target gene, similarly, miR-183 also can be by combining the nucleotide sequence with its partial complementarity And Reverse transcriptase its own function, to raise the expression of the target gene of miR-183.Therefore, in the present invention, term is " mutually Mend " it include not only complete complementary, it further include partial complementarity, as long as can be combined with miR-183 and inhibit its function.

Therefore, the antisense oligonucleotides has following nucleotide sequence:

A) nucleotide sequence (AGTGAATTCTACCAGTGCCATA) shown in SEQ ID No:4；

B) in the nucleotide sequence shown in SEQ ID No:4 through missing, substitution or one or several nucleotide of addition and The nucleotide sequence complementary with miR-183.

In the case where non-fully complementary, that is, when the antisense oligonucleotides is by shown in the SEQ ID No:4 Nucleotide sequence in the case where the nucleotide sequence that is obtained through missing, substitution or one or several nucleotide of addition, mutual Mend in nucleotide region, the antisense oligonucleotides preferably should at least have 60% with miR-183,65%, 70%, 75%, 80%, 85%, 90% or 95% complementation.More preferably, in the nucleotide region that the 2-8 of miR-183 is, the antisense Oligonucleotides at most has the nucleotide of 3 with miR-183 mispairing.

As described above, in the case where the antisense oligonucleotides is non-fully complementary with miR-183, further preferably , compared with SEQ ID No:4, will at most there are 10,9,8,7,6,5,3,2 or 1 cores in length The difference of thuja acid.

In a preferred case, the antisense oligonucleotides non-fully complementary with miR-183 has SEQ ID No:5 institute The nucleotide sequence (AGTGAGCTCTACCAGTGGCATA) stated.

In addition, few to improve the antisense the invention also includes some conventional modifications are carried out to the antisense oligonucleotides The stability and activity of nucleotide, these are all belonged to the scope of the present invention.

The present invention is pointed out that with the complete of characteristic as above or non-fully complementary RNA also in guarantor of the invention It protects in range.Comprehensively consider stability in the cell, the preferably described antisense oligonucleotides of the present invention is DNA.

Due to the antisense oligonucleotides can (complete complementary or partial complementarity) complementary with miR-183, when described When antisense oligonucleotides is contacted with the target cell of expression miR-183 in vivo or in vitro, the antisense oligonucleotides can be with MiR-183 carries out complementary pairing, and inhibits miR-183 and the combination (that is, the activity for inhibiting miR-183) of its target gene, from And miR-183 is broken to the silencing of its target gene.

According to the present invention, the method includes a effective amount of and miR-183 complementation antisense oligonucleotides is introduced into table Up in the target cell of miR-183.Wherein, described " effective quantity " is different and different according to the target cell for expressing miR-183, And certain dosage effect is showed, as shown in the lower Fig. 2A of the present invention, those skilled in the art are according to conventional experiment hand Section and expected purpose achieved can readily determine the effective dose of the target cell for expression miR-183.

It, can be by the method for conventional nucleic acid administration by antisense widow's core of the invention when the contact is contact in vivo Thuja acid is administered in individual.It is, for example, possible to use the administrations that following method carries out the antisense oligonucleotides: the antisense is few Nucleotide, which can directly take orally, to be perhaps administered by the method for virus infection, microinjection or Vesicle fusion or can also To be used for the intramuscular delivery of the antisense oligonucleotides by the method for jet injection.Alternatively, it is also possible to by the antisense widow core Thuja acid is coated on golden particle, then carries out percutaneous dosing by the known methods such as particle bombardment equipment or " particle gun ".These It is this field conventional technology, this is no longer going to repeat them by the present invention.

Furthermore the target that the antisense oligonucleotides can also be introduced into expression miR-183 in the method for expression vector is thin In born of the same parents.This kind of expression vector has the convenience restriction site positioned at promotor-proximal sequence in order to the antisense oligonucleotides Insertion.Wherein, the transcription box in the expression vector may include transcription initiation region, target gene or its segment and transcription Terminator.The carrier for example can be but be not limited to that plasmid, virus etc., those skilled in the art can be according to reality Situation is voluntarily selected.

In addition, the antisense oligonucleotides can also be introduced in expression by way of respiratory tract spray delivery In the target cell of miR-183, such as it is administered by way of being prepared into spray formulation.

In addition, the mode that the antisense oligonucleotides can also be administered orally is to be introduced in expression miR-183 Target cell in, such as be administered by way of being prepared into oral preparation, or by by the antisense oligonucleotides and food Mixed mode is administered orally.

Individual as described above can be any mammalian cell, including but not limited to: ungulate, for example, ox, mountain Sheep, pig, sheep etc.；Rodent, for example, hamster, mouse, rat, rabbit；Primate, for example, monkey, baboon, mankind etc..

When it is described contact be vitro exposure when, can by by the antisense oligonucleotides or contain the antisense oligonucleotides The carrier (for example, the drug for containing the antisense oligonucleotides) of acid is added directly into the target cell that culture has expression miR-183 Matrix in contacted, and to the expression miR- for being imported with the antisense oligonucleotides under conventional cell culture condition 183 target cell is cultivated.

3) RNAi reagent

In a representative embodiment, precursor molecule (the precursor of of RNAi reagent targeting miR-183 MicroRNA, pre-microRNA (sequence of people), as shown in SEQ ID No:2, CCGCAGAGUGUGACUCCUGUUCUGUGU AUGGCACUGGUAGAAUUCACUGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAU CCACGA), the expression of miR-183 is adjusted by the mechanism of RNA interference, that is, inhibiting the function of miR-183 indirectly.

It is well known in the art that RNA interference (RNA interference, RNAi) is by double-stranded RNA (double- Stranded RNA, dsRNA) induce, homologous mRNA efficient selective degradation the phenomenon that.Due to using RNAi technology special The expression of specific gene is rejected or closed to the opposite sex, thus the technology have been widely used for exploring gene function and communicable disease and The therapy field of malignant tumour.And specific to the application, the application by using the precursor molecule of miR-183 RNA interfering, it is right The precursor molecule of miR-183 causes gene silencing, to reduce the level of the precursor molecule of miR-183, reduce as a result, by The level for the mature miR-183 that the precursor molecule of miR-183 is changed into, namely, it is suppressed that the function of miR-183, to increase The expression of miR-183 target gene.

RNAi reagent can be small RNA molecule, and usually one can theoretically form bobby pin (small Hairpin) the single-stranded deoxy-oligonucleotide (shRNA) of structure, length do not exceed 100 nucleotide generally, typically not It can be more than 75 nucleotide；The either double-strand deoxy-oligonucleotide (siRNA) of a 15-30bp, most typically 20- 23bp, the siRNA as described in the embodiment 5 in the present invention (antisense strand as shown in SEQ ID No:7 and such as SEQ ID No: Positive-sense strand shown in 8).

In some applications, RNAi reagent is also possible to encode the template DNA of shRNA or siRNA.These template DNAs It is likely to be present in carrier, such as the carriers such as plasmid vector or viral vectors；It can also only be compiled for one section there is no with carrier The template DNA of code shRNA or siRNA adds the common promoter sequence segment for controlling its transcription.

Wherein, the RNAi reagent with the contact of the target cell of expression miR-183 may be internal contact or external Contact.The medication of the RNAi reagent is referred to as above carry out the description of antisense oligonucleotides, in order to avoid need not The repetition wanted, in this not go into detail by the present invention.

MiR-183 inhibitor

The present invention also provides miR-183 inhibitor, the concrete type of the miR-183 inhibitor can be as described above At least one of small molecule compound, antisense oligonucleotides and RNAi reagent, in order to avoid unnecessary repetition, the present invention In this not go into detail.

Pharmaceutical composition

The present invention also provides a kind of pharmaceutical compositions, wherein the pharmaceutical composition contains miR-183 suppression as described above Preparation and pharmaceutically acceptable carrier.

It in the present compositions, can be as the content of the miR-183 inhibitor as described above of active constituent Variation in larger range, for example, can be 0.01-99 weight %, it is preferred that can be 1-70 weight %, it is furthermore preferred that can Think 5-30 weight %.

According to the present invention, described pharmaceutical composition can be prepared as the various dosage forms of this field routine, the present invention to this simultaneously It is not particularly limited, for example, solid can be configured to, semisolid, liquid or gas form, for example, tablet, capsule, the wine made of broomcorn millet Agent, suspension, syrup, powder, particle, ointment, suppository, injection, inhalant, aerosol etc., the present invention be not another herein One enumerates.

Therefore, the administrations of diversified forms can also be carried out according to the difference of pharmaceutical dosage form, such as, but not limited to, take orally to Medicine, buccal administration, rectally, parenteral, Intraperitoneal medication, respiratory tract inhalation, intradermal administration, percutaneous dosing.

Wherein, the pharmaceutically acceptable carrier can carry out different selections according to the difference of dosage form, these are It is known in those skilled in the art.Such as, but not limited to, the pharmaceutically acceptable carrier can for starch, colloid, Lactose, glucose, sucrose, microcrystalline cellulose, kaolin, mannitol, calcium monohydrogen phosphate, sodium chloride, alginic acid etc..

Furthermore it is also possible to which conventional additive such as solubilizer, isotonic agent, suspending agent, emulsifier, stabilizer and anti-corrosion is added Agent.

In addition, the pharmaceutically acceptable carrier can also be specific including can be improved the antisense oligonucleotides targeting The targeting agent of organ or tissue or cell, the targeting agent for example can be targeting peptides, can also include that can carry institute Antisense oligonucleotides is stated to be easier to wear membrane reagent, such as cell-penetrating peptide, liposome, micro-capsule into the target cell of expression miR-183 Bubble and membrane lipoprotein etc..

According to the present invention, flavoring agent can also be added in described pharmaceutical composition, for example, peppermint, wintergreen etc..Separately Outside, colorant can also be added in described pharmaceutical composition so that prepared dosage form has certain attraction in appearance Power, or distinguished with other products.

According to the present invention, the conventional medicine that the antisense oligonucleotides can also can play similar effect with other carries out Combine to be prepared into combined medicinal composition.

Kit

The present invention provides a kind of kits, wherein the kit includes antisense oligonucleotides as described above, optional , the kit further includes additional reagent, for example, pharmaceutically acceptable carrier as described above, flavoring agent and/or Toner, solubilizer, isotonic agent, suspending agent, emulsifier, stabilizer, preservative, targeting agent wear membrane reagent.

According to the present invention, the additional reagent can be combined together with the antisense oligonucleotides is present in the examination It in agent box, or independent can also deposit in the kit, be mixed again when to be used.

It can also include operation instructions in kit of the invention, the existence form of the specification is not by special Limitation can be the form of CD, or be the form of network address for example, can be the paper-based form of printing, and when use passes through interconnection Net obtains application method.

Using

The present invention provides inhibit miR-183 (appetite and functions of intestines and stomach marker) function prevent and/or treat with Application in lower at least one disease and/or symptom, and/or the application in skin care, enhancing skin elasticity and gloss.

The disease and/or symptom include: that syntexis, anorexia, indigestion, functions of intestines and stomach be weak or subcutaneous fat is few and with The similar symptom of the symptom of these diseases.

Particularly, the application includes the medicine prepared for preventing and/or treating a kind of disease of any of the above and/or symptom Object and/or food or cosmetics and skincare product.Wherein, the food includes health care product.

The present invention also provides miR-183 inhibitor as described above, pharmaceutical composition as described above, reagents as above The application of box and/or method as described above in the function of inhibiting miR-183.

It is further preferred that the application includes preventing and/or treating a kind of disease of any of the above and/or symptom.

In addition, the present invention also provides miR-183 inhibitor as described above, pharmaceutical compositions as described above to prepare For reducing the application in the drug of miR-183 amount.

Preferably, the drug includes the drug for preventing and/or treating a kind of disease of any of the above and/or symptom And/or food.Wherein, the food includes health care product.

According to the present invention, the treatment refers to subject's symptom relevant to the disease as caused by miR-183 or state Improve or completely disappear, wherein the improvement on wide significance, which refers to, reduces at least one parameter.Specific to the application, for example, It can be weight, appetite, digestion function of stomach and intestine and improvement of body fat etc..

The individual for the treatment of can be by any individual perplexed by symptom as described above, preferably mammal.

The form of administration and ingredient of the drug are referred to description as above, and in this not go into detail by the present invention.

The present invention will be described in detail by way of examples below.In following embodiment,

MiR-183 over-express vector

By (people's) miR-183 gene (CCGCAGAGTGTGACTCCTGTTCTGTG shown in SEQ ID No:3TATGGC ACTGGTAGAATTCACTGTGAACAGTCTCAGTCAGTGAATTACCGAAGGGCCATAAACAGAGCAGAGACAGATCCACG A it) is cloned into pCAG-GFP carrier, obtains the overexpression plasmid pCAG-miR-183-GFP of miR-183 gene.Wherein, SEQ The synthesis of miR-183 gene shown in ID No:3 and clone are carried out by Jin Sirui company.

MiR-183 experiences carrier (miR-183sensor vector)

It is by the target as shown in SEQ ID No:11 that two miR-183 are combined and are adjusted that miR-183, which experiences carrier, Point sequence (TGGAAATGAGATCTTGTGCCATAGCTACGGTAAGGATTTTCAGTGCCATT) is cloned into pGL3-SV40 carrier The downstream fiery luciferase (Fire luciferase) gene 3' the site xbaI on obtained from, thus miR-183 impression carry The expression of body moderate heat luciferase is just by the adjusting of miR-183.

Embodiment 1

The present embodiment is used to illustrate the difference with miR-183 expression quantity in 12 monthly age mouse at 2 monthly ages

(1) extraction and reverse transcription of total serum IgE

It is each three 2 monthly age of wild type C57/Bl6 male mice and 12 monthly ages, after cervical dislocation is put to death, respectively take 500 μ l Blood, dissection is rounded liver, muscle and the epididymal adipose of a hypothalamus and half of stomach and 200mg.Add 1ml's Trizol reagent (invitrogen) is mixed into blood.Be separately added into again the Trizol reagent of 200 μ l to hypothalamus, stomach, Then liver, muscle and adipose tissue shred hypothalamus, stomach, liver, muscle and adipose tissue with scissors, then with electric homogenizer handle These tissue grinders later come out the Total RNAs extraction in entire tissue by the specification of Trizol at powder.Use nuclease free Water dissolve RNA, then use 2000 Instrument measuring RNA of Nanodrop 260 and 280 ratio, take ratio greater than 1.8 sample This continuation subsequent experimental.Later with after the concentration of Qubit measurement RNA, detect RNA's with biological analyser (bioanalyzer) Integrality, RNA Perfection Index RIN are greater than 0.9.Wherein, in order to ensure every kind of tissue or organ can carry out subsequent reality It tests, can be set and multiple repeat Total RNAs extraction.

The total serum IgE that 1 μ g is taken from each sample utilizes the 10- in flashPAGE pulp classifier (Ambion) separation total serum IgE Then the short rna of 40nt prepares the cDNA library of microRNA with the kit reverse transcription of Illumina, then in second generation sequenator The expression of microRNA in upper measurement sample.

As the result is shown in the hypothalamus, stomach of 12 monthly age mouse and liver the expression quantity of miR-183 than the table in 2 monthly age mouse Up to wanting high, that is, show the increasing that the expression quantity of miR-183 increases with advancing age and in hypothalamus, stomach and liver, with weight Long and obesity is positively correlated.

(2) expression quantity of quantitative PCR detection miR-183

In order to confirm expression quantity of the miR-183 in hypothalamus, stomach and liver be it is raised with advancing age, with fixed Measure the expression quantity of PCR detection miR-183.The total serum IgE that 1 μ g is taken from each sample, with Catch AllTM miRNA&mRNA The cDNA of RT-PCR kit (Pengekiphen, Kunshan) reverse transcription microRNA and mRNA.Primer for detection has: such as MiR-183 forward primer (5'-TATGGCACTGGTAGAATTCACT-3') shown in SEQ ID No:12；Such as SEQ ID No: U6 forward primer (5'-CGCAAGGATGACACGCAAATTCG-3') shown in 13；Reverse primer provides general for kit Primer.The instrument of detection is the iQ5 system of Bio-Rad company, and reagent is the SYBR Green Mix of TaKaRa company.Each sample Product detect three multiple holes simultaneously, using U6 as internal reference, calculate expression water of the miR-183 in each sample with 2- Δ Δ ct method It is flat.Then the expression of the miR-183 of the 2 each internal organs of monthly age mouse is set to 1, and calculates the miR- in 12 monthly age mouse 183 relative expression levels, the result is shown in Figure 1.

As shown in Figure 1, the expression quantity of the hypothalamus of master control appetite-stomach central axis miR-183 is in 12 monthly age mouse It obviously raises, and expression of the miR-183 in liver is also significantly to raise.Quantitative PCR confirms the inferior colliculus of 12 monthly age mouse The expression quantity of miR-183 is 1.8,1.6 and 2.4 times higher than the expression difference in 2 monthly age mouse in brain, liver stomach function regulating.It is possible thereby to demonstrate,prove Bright, the upper reconciliation weight gain and the formation of fatty liver of miR-183 is relevant.Wherein, in Fig. 1, * * P < 0.01, * p < 0.05。

Embodiment 2

The present embodiment is for illustrating antisense oligonucleotides to the external adjustment effect of miR-183

By human embryonic kidney cells HEK-293T culture in the DMEM culture medium containing 10% fetal calf serum.Cell incubator is permanent Surely the CO of 37 DEG C and 5% is kept₂.With the inoculum concentration of every 100,000 cells in hole by HEK-293T cell inoculation to 24 hole cell culture In plate, volume of culture is 500 μ l.Second day with liposome 2000 (Invitrogen) to specifications by the setting of such as the following table 2 In cotransfection KEK-293 cell, is measured with dual-luciferase assay instrument (Promega) from miR-183 after 36 hours and experience carrier The vigor of the luciferase of middle expression.Three repeating holes of setting every time, experiment is in triplicate.

Wherein, in each group, miR-183 experiences the amount of being transferred to of carrier in terms of every hole: miR-183 experiences carrier 500ng, PCAG-GFP empty vectors 20ng, miR-183 over-express vector 500ng, oligonucleotides are configured to 50 μM of solution.In addition, working as When the oligonucleotides being transferred to is miR-183ASO, 50 μM of the oligonucleotide solution of 0.5 μ l and 1 μ l are taken respectively, is added to cell Its final concentration is respectively 0.05 μM and 0.1 μM after culture solution.To measure the vigor of luciferase, and using it as ordinate, miR- 183ASO concentration is abscissa, draws curve.As a result see Fig. 2.

As seen from Figure 2, miR-183ASO can inhibit the function of miR-183.

Cotransfection miR-183 experiences carrier, miR-183 over-express vector and various concentration it can be seen from Fig. 2A MiR-183ASO, luciferase vitality testing result shows that miR-183ASO can inhibit the function of miR-183, and has dosage effect It answers.

Expression (left 1 column and a left side 2 that miR-183 can inhibit miR-183 to experience carrier are overexpressed it can be seen from Fig. 2 B Column)；MiR-183ASO and miR-183 mispairing ASO can inhibit the function (left 4 columns and left 5 columns) of miR-183, miR-183ASO's Inhibitory effect is better than miR-183 mispairing ASO's, and random controls nucleotide cannot inhibit the function (left 3 columns) of miR-183, Data=average value ± SEM；N=3；P < 0.01 * * P < 0.001, * *.Also, miR-183 energy is overexpressed in HEK293 cell MiR-9 is inhibited to experience horizontal 46% of the expression of reporter gene luciferase in carrier to control group, and when corotation is whole When the miR-183ASO that 0.1 μM of concentration, miR-183 can be made to experience reporter gene luciferase expression in carrier and restored to control group Horizontal 76%, i.e. miR-183ASO is able to suppress the 56% of miR-183 function.

Table 2

Embodiment 3

The present embodiment is for illustrating that the antisense oligonucleotides of miR-183 adjusts miR-183 target gene and its subsequent in vivo Influence the effect of appetite, functions of intestines and stomach and lipid metaboli

(it is real that tonneau China is tieed up in Beijing to 10 wild type C57/Bl6 male mices by the weight differences of 12 week old less than 10% Test zoo technical Co., Ltd) two groups are randomly divided into, raise (high lipid food of feeding 20%) after two weeks, experimental mice stomach-filling The miR-183ASO (being dissolved in PBS kind) of 8mg/kg weight, the isometric solvent PBS of control group mice stomach-filling.Stomach-filling is primary weekly And weigh the weight and food consumption quantity of mouse.Changes of weight and body weight increase rate are shown in Fig. 3 A and Fig. 3 B respectively.Stomach-filling The thickness of the subcutaneous fat of miR-183ASO mouse is also thicker than control group.

As seen from Figure 3, compared with the control group, the antisense oligonucleotides (miR-183ASO) of stomach-filling miR-183 can promote Into the body weight increase (Fig. 3 A) of mouse and the rate of rise (Fig. 3 B) of weight.Data=average value ± SD；N=5；*P<0.05.

As seen from Figure 4, compared with the control group, stomach-filling miR-183ASO can increase appetite, P < 0.01 * *.

As seen from Figure 5, compared with the control group, stomach-filling miR-183ASO can increase the weight (figure of stomach and abdominal cavity fat 4)；But kidney weight is not influenced.* P < 0.01 P < 0.05, * *.

The hypothalamus stomach function regulating of comparative experiments group and miR-183ASO stomach-filling group mouse is extracted according to the method in embodiment 1 Total serum IgE is sequenced and analyzes through two generations and learns: compared with comparative experiments group, miR-183ASO stomach-filling group has raised participation glycolipid generation It thanks or type-II diabetes or the relevant PI3K-Akt signal path of hepatopathy, MAPK signal path, TGF-beta signal path, GnRH Many genes (table 3) in signal path.Gastric acid secretion, salivary secretion, phosphatidylinositols signal path, pancreas are additionally raised Many genes (table 3) in island element signal path and type-II diabetes signal path.

Table 3

In conclusion inhibiting the function of miR-183 that can promote the growth of appetite, stomach weight and weight, and increase subcutaneous rouge The content of fat and abdominal cavity.And molecule experiments of the invention demonstrate miR-183 and have adjusted control appetite, digestion suction in vivo It receives, many genes in fat metabolism signal path, this illustrate miR-183 GEM 132s can promote appetite, enhancing stomach Function, the molecular mechanism put on weight with fat content.

Embodiment 4

The present embodiment is for illustrating siRNA (siRNA) to the external adjustment effect of miR-183

By human embryonic kidney cells HEK-293T culture in the DMEM culture medium containing 10% fetal calf serum.Cell incubator is permanent Surely the CO of 37 DEG C and 5% is kept₂, volume of culture is 500 μ l.Second day with liposome 2000 (Invitrogen) to specifications By miR-183siRNA (antisense strand SEQ ID No:7:5 ' AGACUGUUCACAGUGAAUUCU ' 3, positive-sense strand SEQ ID No:8: 5 ' AGAAUUCACUGUGAACAGUCU ' 3, the synthesis of Shanghai Ji Ma, wherein at the 3 ' ends of SEQ ID No:7 and SEQ ID No:8 All have the structure of dTdT) and random controls RNA (antisense strand SEQ ID No:9:5 ' CGUGACACGUUCGGAGAA ' 3；Justice Chain SEQ ID No:10:5 ' UUCUCCGAACGUGUCACGU ' 3, Shanghai Ji Ma synthesis, wherein in SEQ ID No:9 and SEQ 3 ' the ends of ID No:10 all have the structure of dTdT) transfection KEK-293 is into cell respectively, after 36 hours carefully with Trizol cracking Born of the same parents and extracted total RNA, are subsequently used for the expression quantity of 1 identical quantitative PCR kit and primer detection miR-183 of embodiment.Often Three repeating holes of secondary setting are tested in triplicate, as a result as shown in fig. 6, P < 0.01 * * *.

The 72% of miR-183 expression quantity can be lowered with miR-183siRNA as the result is shown, it follows that with miR-183's The amount for the miR-183 that target gene combines also has lowered 72%, to improve the expression of target gene.As it can be seen that dry by RNA The mode for disturbing miR-183 precursor also can successfully inhibit the function of miR-183.

It summarizes

The present invention passes through by miR-183 inhibitor (including antisense oligonucleotides and RNA interfering) and in vivo or in vitro The target cell of expression miR-183 is contacted, and can sufficiently inhibit the function of expressing miR-183 in the target cell of miR-183 (anti- Oligonucleotide inhibits the combination of miR-183 and its target gene, and RNA interfering can reduce the expression quantity of miR-183, to inhibit The function of miR-183), when for individual administration, appetite can be promoted, enhancing functions of intestines and stomach, put on weight and fat content, That is, miR-183 inhibitor (including antisense oligonucleotides and RNA interfering) provided by the invention can effectively prevent And/or treatment miR-183 amount increases caused disease, for example, syntexis, anorexia, functions of intestines and stomach be weak or the diseases such as subcutaneous fat lacks Disease or symptom, and can be used for skin care, enhancing skin elasticity and gloss.

The preferred embodiment of the present invention has been described above in detail, still, during present invention is not limited to the embodiments described above Detail within the scope of the technical concept of the present invention can be with various simple variants of the technical solution of the present invention are made, this A little simple variants all belong to the scope of protection of the present invention.

It is further to note that specific technical features described in the above specific embodiments, in not lance In the case where shield, it can be combined in any appropriate way.In order to avoid unnecessary repetition, the present invention to it is various can No further explanation will be given for the combination of energy.

In addition, various embodiments of the present invention can be combined randomly, as long as it is without prejudice to originally The thought of invention, it should also be regarded as the disclosure of the present invention.

Bibliography

1.Buhmann,H.,C.W.le Roux,and M.Bueter,The gut-brain axis in obesity.Best Pract Res Clin Gastroenterol,2014.28(4):p.559-71.

2.Wang,P.Y.,et al.,Upper intestinal lipids trigger a gut-brain-liver axis to regulate glucose production.Nature,2008.452(7190):p.1012-6.

3.Beraza,N.and C.Trautwein,The gut-brain-liver axis:a new option to Treat obesity and diabetes? Hepatology, 2008.48 (3): p.1011-3.

4.Schneeberger,M.,et al.,Hypothalamic miRNAs:emerging roles in energy balance control.Front Neurosci,2015.9:p.41.

5. bring up roc, Zhan Li apricot, the progress .Chinese Journal of of Adipocyte Differentiation and its regulation Cell Biology 2010,32(5):690-695.

6.Gehart,H.,et al.,MAPK signalling in cellular metabolism:stress or Wellness? EMBO Rep, 2010.11 (11): p.834-40.

7.Maiuri,T.,J.Ho,and V.Stambolic,Regulation of adipocyte differentiation by distinct subcellular pools of protein kinase B(PKB/Akt).J Biol Chem,2010.285(20):p.15038-47.

8.Dooley,S.and P.ten Dijke,TGF-beta in progression of liver disease.Cell Tissue Res,2012.347(1):p.245-56.

9.Goldfarb,S.and F.N.Ziyadeh,TGF-beta:a crucial component of the pathogenesis of diabetic nephropathy.Trans Am Clin Climatol Assoc,2001.112: p.27-32；discussion 33.

10.Zhang,Q.,et al.,Berberine moderates glucose metabolism through the GnRH-GLP-1and MAPK pathways in the intestine.BMC Complement Altern Med, 2014.14:p.188.

SEQUENCE LISTING

<110>Kunshan Peng Ji Kai Feng Biotechnology Co., Ltd

<120>method and drug of a kind of modulation of appetite and weight and their application

<130> I45281PCG

<160> 13

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> RNA

<213> human

<400> 1

uauggcacug guagaauuca cu 22

<210> 2

<211> 110

<212> RNA

<213> human

<400> 2

ccgcagagug ugacuccugu ucuguguaug gcacugguag aauucacugu gaacagucuc 60

agucagugaa uuaccgaagg gccauaaaca gagcagagac agauccacga 110

<210> 3

<211> 110

<212> DNA

<213> human

<400> 3

ccgcagagtg tgactcctgt tctgtgtatg gcactggtag aattcactgt gaacagtctc 60

agtcagtgaa ttaccgaagg gccataaaca gagcagagac agatccacga 110

<210> 4

<211> 22

<212> DNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 4

agtgaattct accagtgcca ta 22

<210> 5

<211> 22

<212> DNA

<213> Artificial

<220>

<223> The sequence is synthesized

<400> 5

agtgagctct accagtggca ta 22

<210> 6

<211> 22

<212> DNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 6

attgcttctc aagcatcctt gc 22

<210> 7

<211> 21

<212> RNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 7

agacuguuca cagugaauuc u 21

<210> 8

<211> 21

<212> RNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 8

agaauucacu gugaacaguc u 21

<210> 9

<211> 18

<212> RNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 9

cgugacacgu ucggagaa 18

<210> 10

<211> 19

<212> RNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 10

uucuccgaac gugucacgu 19

<210> 11

<211> 50

<212> DNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 11

tggaaatgag atcttgtgcc atagctacgg taaggatttt cagtgccatt 50

<210> 12

<211> 22

<212> DNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 12

tatggcactg gtagaattca ct 22

<210> 13

<211> 23

<212> DNA

<213> Artificial

<220>

<223> The sequence is synthesized.

<400> 13

cgcaaggatg acacgcaaat tcg 23

Claims

1. inhibiting application of the function of miR-183 in putting on weight, especially in preparation for preventing and/or treating syntexis Application in drug and/or food.

2. inhibit miR-183 function whetting the appetite and the application in functions of intestines and stomach, especially preparation for prevent and/or Treat the application in anorexia, indigestion or the weak drug and/or food of functions of intestines and stomach.

3. inhibiting application of the function of miR-183 in increasing subcutaneous fat and Skin Cell in fat content, especially making The application being ready for use in the cosmetics and skincare product of skin care, enhancing skin elasticity and gloss.

4. application described in any one of -3 according to claim 1, wherein miR-183 has core shown in SEQ ID No:1 Nucleotide sequence.

5. a kind of method for the function of inhibiting miR-183, which is characterized in that this method comprises: by miR-183 inhibitor and expression The target cell of miR-183 contacts.

6. according to the method described in claim 5, wherein, the miR-183 inhibitor is antisense oligonucleotides, including antisense DNA and antisense RNA, the antisense oligonucleotides is complementary with miR-183, and the length with 8-40 nucleotide, and has The sequence complementary with the 2-8 of miR-183 position nucleotide；

Preferably, the antisense oligonucleotides has following nucleotide sequence:

A) nucleotide sequence shown in SEQ ID No:4；

B) in the nucleotide sequence shown in SEQ ID No:4 through missing, substitution or one or several nucleotide of addition and with The nucleotide sequence of miR-183 complementation；Preferably, in the nucleotide sequence shown in SEQ ID No:4 through missing, replace or add One or several nucleotide and at least there is 60% complementary nucleotide sequence with miR-183；It is furthermore preferred that with miR-183's 2-8 nucleotide at most have the nucleotide sequence of the mispairing of 3 nucleotide；Most preferably, nucleosides shown in SEQ ID No:5 Acid sequence.

7. method according to claim 5 or 6, wherein the miR-183 inhibitor is the small interference of miR-183 precursor RNA；

Preferably, the miR-183 precursor has the sequence as described in SEQ ID No:2；

Preferably, the siRNA length of the miR-183 precursor is 15-30bp；

Preferably, the siRNA of the miR-183 precursor has the antisense strand as shown in SEQ ID No:7 and such as SEQ ID Positive-sense strand shown in No:8.

8. a kind of miR-183 inhibitor, which is characterized in that the miR-183 inhibitor is antisense widow core as claimed in claim 6 The siRNA of thuja acid and/or miR-183 precursor as claimed in claim 7.

9. a kind of pharmaceutical composition, which is characterized in that the pharmaceutical composition contains miR-183 inhibitor according to any one of claims 8 And pharmaceutically acceptable carrier.

10. a kind of kit, which is characterized in that the kit includes miR-183 inhibitor according to any one of claims 8, optional , the kit further includes pharmaceutically acceptable carrier.

11. method described in any one of claim 5-7, miR-183 inhibitor according to any one of claims 8, claim 9 The application of the pharmaceutical composition and/or kit described in any one of claim 10 in the function of inhibiting miR-183；It is preferred that It puts on weight, whet the appetite and the application in functions of intestines and stomach, increase subcutaneous fat and Skin Cell in fat content；More preferably exist Prevention and/or treatment syntexis, anorexia, indigestion, functions of intestines and stomach are weak, skin care, enhance in skin elasticity and gloss extremely Application in few one kind.

12. miR-183 inhibitor according to any one of claims 8, pharmaceutical composition as claimed in claim 9 are in preparation for inhibiting Application in the drug of the function of miR-183；It is preferred that in preparation for preventing and/or treating syntexis, anorexia, indigestion, intestines Stomach function weak drug and/or food, or for answering in the cosmetics and skincare product of skin care, enhancing skin elasticity and gloss With.