CN116376966A - Flax cellulose synthetase gene knockout vector, construction method and application thereof - Google Patents

Abstract

The invention discloses a flax cellulose synthase gene knockout vector, a construction method and application thereof, and belongs to the technical field of genetic engineering. According to the invention, flax cellulose synthase genes LusCESA4 and LusCESA8 are used as target genes, a CRISPR/Cas9 editing system is utilized to respectively construct single knockout vectors of the LusCESA4 and the LusCESA8, and a CESA8 gene editing transgenic plant is successfully obtained through genetic transformation. The CRISPR/Cas9 gene editing technology is utilized for the first time, the CESA4 and CESA8 genes of the flax are subjected to gene editing, and CESA8 gene editing transgenic plants are successfully obtained, and the CRISPR/Cas9 gene editing technology is successfully applied to molecular breeding of the flax, so that a foundation is laid for further researching cellulose synthesis mechanism of the flax, and important guiding significance is provided for flax breeding and variety improvement.

Description

Flax cellulose synthetase gene knockout vector, construction method and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a construction method and application of a flax CESA4 and CESA8 gene knockout vector.

Background

Gene editing refers to a technique (Ding Liping, etc., 2019) for realizing protein insertion, deletion and substitution at a specific site of a target gene by a specific method, and is widely used in research of animal and plant gene functions and genetic improvement of crops. Gene editing is one of the important ways of improving flax varieties (Zhang Yu et al, 2019). The CRISPR-Cas technology is a novel gene editing technology and has the advantages of simple target sequence design, simple skeleton carrier construction process, low cost, high mutation rate and the like (Li Linfang and the like, 2020). Currently, CRISPR/Cas9 technology is widely used in crops such as arabidopsis (QI et al, 2017), rice (ZHOU et al, 2016), poplar (YUAN et al, 2017), and the like, and has achieved representative results in various fields. Zhang Yu et al (2019) constructed knockout vectors for the `Delta12-desaturase (FAD 2) gene of `ridged sub-10` by applying CRISPR/Cas9 gene editing technology for the first time in flax. However, no studies of transgenic applications of the lyscesa gene using CRISPR/Cas9 gene editing techniques have been seen.

According to the invention, 2 CESA4/CESA8 genes which are mutated in the evolution process from wild species to cultivated species are selected as target genes, a CRISPR/Cas9 gene editing technology is applied to flax for the first time, and knockout vectors for flax CESA4 and CESA8 genes are constructed, so that reference is provided for further realizing high-efficiency fixed-point editing of genes in flax plants and application of a CRISPR/Cas9 system in flax genome editing.

Disclosure of Invention

The invention aims to solve the technical problem of constructing a knockout vector for CESA4 and CESA8 genes of flax and providing an operable technical model for gene editing of high-quality fiber flax varieties.

In order to solve the technical problems, the technical scheme of the invention is to utilize a CRISPR-Cas system to carry out gene editing on CESA4 and CESA8 and construct knockout vectors for flax CESA4 and CESA8 genes.

Furthermore, the single-target knockout vector used in the invention is a plasmid with the code JRH0996, and the structure is shown in figure 1.

The invention also provides a construction method of the vector, which comprises the following steps: the single knockout vectors of the LusCESA4 and the LusCESA8 are respectively constructed by taking the flax cellulose synthase genes LusCESA4 and LusCESA8 as target genes and utilizing a CRISPR/Cas9 editing system, and PCR results show that the recombinant plasmid contains target band fragments. Sequencing results showed that the target site sequence had been successfully recombined into the knockout vector.

As a general technical concept, the invention also provides application of the gene knockout vector in flax genetic transformation: the flax seed is transformed by using a 'ZhongLin No. 1' as a test material through agrobacterium-mediated knockout vectors (JRH 0996-CESA4 and JRH0996-CESA 8), regenerated flax seedlings are obtained through tissue culture, and the PCR result preliminarily determines that the knockout vectors are integrated into the genome of the flax, so that 7 positive transgenic seedlings are obtained, and the transformation rate is about 43.75%. Sequencing analysis was performed on the LusCESA4 and LusCESA8 in the positive seedlings, and the LusCESA8 of 3 transgenic seedlings was successfully edited, and the editing efficiency was 42.86%.

The invention successfully obtains CESA8 gene editing transgenic plants by using the CRISPR/Cas9 gene editing technology for the first time to carry out gene editing on CESA4 and CESA8 genes of flax, and successfully applies the CRISPR/Cas9 gene editing technology to molecular breeding of flax, lays a foundation for further researching cellulose synthesis mechanism of flax, and has important significance for improving flax fiber quality and flax planting and processing industry.

Drawings

FIG. 1 is a block diagram of a single-target knockout vector JRH0996 plasmid. In the figure, CESA4/CESA8 is a single target sequence.

FIG. 2 shows the positive detection results of E.coli containing the knockout vector. In the figure, (a) is the colony PCR verification of a single knockout carrier escherichia coli (DH 5 alpha), M is Mark,1 is the colony containing a JRH0996-CESA8 carrier, 2 is the positive control of the JRH0996-CESA8 carrier, 3 is a blank control, 4 is the colony containing a JRH0996-CESA4 carrier, and 5 is the positive control of the JRH0996-CESA4 carrier.

FIG. 3 shows the sequencing results of positive E.coli. In the figure, (a) shows the sequencing result of positive E.coli 4-1, and contains the T1 target site sequence (LusCESA 8 gene). (b) The sequencing result of positive E.coli 5-2 contained the T2 target site sequence (LusCESA 4 gene). (c) The sequencing result of positive E.coli 3-4 contained the T2 target site sequence (LusCESA 4 gene).

FIG. 4 is a PCR identification of Agrobacterium containing the knockout vector. In the figure, (a) is the agrobacterium (EHA 105) colony PCR verification of the single knockout vector, M is Mark,1 is the JRH0996-CESA8 vector-containing colony, 2 is the JRH0996-CESA8 vector positive control, 3 is the JRH0996-CESA4 vector-containing colony, 4 is the JRH0996-CESA4 vector positive control, and 5 is the blank control.

Fig. 5 is a flax regeneration system establishment procedure. In the figure, a is a seed of 'ZhongLin No. 1', b is a sterile seedling, c is a hypocotyl of the sterile seedling in infection, d is a callus culture stage, e is a callus bud differentiation stage, and g is a transgenic plant seedling important stage.

Fig. 6 is a PCR detection of flax callus Cas protein. M in the electrophoresis diagram is Mark,1-3 is calli of LusCESA8 gene single-knockout target spot, and 4-6 is calli of LusCESA4 gene single-knockout target spot.

Fig. 7 is a PCR detection of Cas protein in flax regeneration plants. In the A diagram, 7 is plant 3-5,8 is plant 3-8; in the diagram B, 1 is plant 8-4-1,3 is plant 8-4-3,4 is plant 4-5-1,5 is plant 4-5-7, and 6 is plant 4-5-8.

FIG. 8 is a flax transgenic positive seedling plant. In the figure, positive seedlings of the LusCESA8 gene knocked out by flax T0 are injected with the injection (1) and (2); (3) And (4) knockout of the LusCESA4 gene and the LusCESA8 gene positive plant seedlings for flax T0 generation; (6) And (7) is flax T0 generation knockout LusCESA4 gene positive plant seedling.

FIG. 9 shows the sequencing results of the T0 generation transgenic flax LusCESA8 gene and the LusCESA4 gene. The sequencing result of the T0 generation transgenic flax LusCESA8 gene is shown in the figure (4-5 a); FIG. 4-5b shows the sequencing result of the T0-generation transgenic flax LusCESA4 gene. In the figure, the control group is the corresponding gene of flax No. 1 in flax which is not transformed by the knockout vector, 8-4-3 and 8-4-1 represent plants containing the single-target knockout vector of the LusCESA8 gene, and 3-5 and 3-8 represent plants containing the LusCESA8 gene and the double-target knockout vector of the LusCESA4 gene. 4-5-1, 4-5-7 and 4-5-8 are transgenic plants of the LusCESA4 gene single-target knockout vector.

FIG. 10 shows the apparent trait differences of T0-generation flax LusCESA8 transgenic plants. In the figure, A is the apparent difference of the stems of China flax No. 1; b is apparent difference of China flax No. 1 seeds.

Detailed Description

The invention is further described below in connection with the drawings and the specific preferred embodiments, but the scope of protection of the invention is not limited thereby. The materials and instruments used in the examples below are all commercially available.

Example 1 target site selection and adapter primer design

According to the sequences of the flax CESA4 and CESA8 genes published by the website, wherein the CDS sequence length of the LusCESA4 gene is 2171bp and the CDS sequence length of the LusCESA8 gene is 3786bp. Target sequences were designed using the online software kit CRISPR-GE for construction of sgRNA expression cassettes. A DNA fragment of about 20bp was selected as the target sequence, the target sequence of LusCESA4 was GTTCCCCGTTCTTTCAACGC TGG (5 '-3'), and the target sequence of LusCESA8 was CCC GGGGCTCCCGTGTGCAATAC (5 '-3').

According to JRH0996 vector plasmid as a template, designing a corresponding primer of a target knockout vector, wherein specific information is shown in table 1.

TABLE 1 Single target primer sequence information

Example 2 acquisition of sgRNA expression cassettes

Using JRH0996 carrier as template, using high-fidelity KOD enzyme (DNA polymerase), using designed specific primer, PCR to make 35 cycles; 95℃10s,60℃15s,68℃90s; the first round of PCR amplification yielded a gRNA fragment of the AtU6 promoter and target sequence, respectively. The second round of PCR amplification yielded a AtU6-gRNA expression cassette.

First, atU promoter and the corresponding gRNA fragment of the LusCESA gene were synthesized using JRH0996 vector as a template. The synthesized promoter and the gRNA fragment are mixed and added into an enzyme-digested JRH0996 vector, the promoter and the gRNA fragment are connected to the JRH0996 vector through PCR amplification to form a complete sgRNA expression cassette, and the sgRNA expression cassettes of the single-target knockout vectors of the two LusCESA genes are named as JRH0996-sgRNA4 and JRH0996-sgRNA8 respectively.

EXAMPLE 3 construction of Single target recombinant vector

The circular JRH0996 plasmid is cleaved with restriction endonucleases MIu I and Bcu I recognition sites, the plasmid structure is shown in FIG. 1, and the CESA4/CESA8 is a single target sequence. Mixing the vector after enzyme digestion with the sgRNA expression cassette of CESA4/8 gene, heating in water bath at 37 ℃ for 30min, and cooling in ice bath for 5min to obtain recombinant connection product. And (3) taking a small amount of connection products, and transforming the recombinant target vector into escherichia coli competent cells (DH 5 alpha) by a thermal shock method.

And (3) enzyme cutting the empty plasmid JRH0996, cloning the PCR product of sgRNA to enzyme cutting sites of the JRH0996 vector, and successfully constructing a recombinant vector which is named as JRH0996-CESA4 and JRH0996-CESA8. The verification gene of the recombinant vector is CRISPR/Cas9 system specific protein-Cas protein gene, the screening marker gene is hygromycin gene, and the promoter is optimized AtU promoter.

EXAMPLE 4 Single target Positive clone screening

E.coli containing recombinant plasmid is coated on LB culture medium containing kanamycin, cultured for 16h at 37 ℃, a plurality of single colonies are selected, streaked culture is carried out, colony PCR verification is carried out, and the primers are single-target universal primers JRH0996-JC-F and JRH0996-CX-R. 20. Mu.L reaction system, PCR 35 cycle: 94 ℃ for 30s,58 ℃ for 30s and 72 ℃ for 1min;72 ℃ for 5min; and screening positive clone strains according to gel electrophoresis results.

Single colonies of E.coli (DH 5 alpha) on the petri dishes were picked for colony PCR amplification verification, and 1.5% gel showed amplification results, as shown in FIG. 4. The single colony contains a target band with the length of about 800bp, preliminary determination shows that the recombinant vectors of the JRH0996-CESA4 and the JRH0996-CESA8 are successfully transformed into the escherichia coli, and a large number of recombinant plasmids of the JRH0996-CESA4 and the JRH0996-CESA8 can be obtained through the propagation of the escherichia coli (DH 5 alpha), so that preparation is provided for a later test.

EXAMPLE 5 sequencing identification of Positive colonies

The recombinant plasmid of the positive clone strain was extracted and sent to biosystems for sequencing. The CESA4/CESA8 gene knockout vector has the same sequencing primer, the upstream primer is JRH0996-JC-F, and the downstream primer is JRH0996-CX-R, so that whether the recombinant vector is successfully constructed or not is further verified. The sequencing result is shown in fig. 5, and shows that the target site target sequence of the LusCESA4 and LusCESA8 genes is contained in the sequencing gene of escherichia coli (DH 5 alpha), the target sites of the CESA4 and CESA8 genes are combined on a JRH0996 plasmid, the JRH0996-CESA4 and JRH0996-CESA8 single-knockout recombinant vectors are successfully constructed, and the JRH0996-CESA4 and JRH0996-CESA8 recombinant vectors are successfully transformed into escherichia coli.

Example 6 transformation stability detection of Agrobacterium

The constructed recombinant knockout vector is transformed into competent cells of agrobacterium tumefaciens (EHA 105) by an electric shock method, and agrobacterium containing the recombinant plasmid is spread on YEP medium containing kanamycin and rifampicin, and cultured for 48h at 28 ℃. Several single colonies were picked for streak culture and colony PCR verification, 1.5% of the gel was shown in FIG. 6, the fragment size was expected, and the results of the sequencing of the recombinant vector-containing Agrobacterium from the biological company after the bacterial detection were consistent with the E.coli sequencing results, indicating that the constructed JRH0996-CESA4 and JRH0996-CESA8 knockout vectors had been successfully transformed into Agrobacterium.

And extracting recombinant plasmids according to the verification result, and sending the recombinant plasmids to a biological company again for sequencing to ensure accurate results. The obtained agrobacterium strain containing the recombinant vector is stored in a refrigerator at the temperature of minus 80 ℃ in the form of glycerinum and is used for the genetic transformation test of the flax at the later stage.

EXAMPLE 7 use of Agrobacterium containing recombinant vector in flax genetic transformation

The method comprises the following specific steps:

1. preparation of aseptic seedlings

Mature, full flax seeds are selected. The seeds are soaked in 70% ethanol for 5min, and the ethanol is continuously stirred in the soaking process to completely soak the seeds. After the soaked seeds are washed twice by sterilized water, the seeds are soaked by 50 percent PPM for 5 minutes, and stirring is continuously carried out in the soaking process, so that the seeds are completely soaked. Washing with sterilized water for 3-4 times, and continuously stirring the seeds during washing to completely remove the sterilizing agent remained on the surfaces of the seeds.

And placing the seeds after the sterilization on filter paper, and wiping off the water on the surfaces of the seeds. After the seed surface is dried, the seed is inoculated on MS solid culture medium (containing PPM) for culture. And (3) spreading 25 seeds on each bottle of MS solid culture medium, and carrying out 7d dark culture and 3d illumination culture in a tissue culture chamber at the room temperature of 22 ℃ to obtain the aseptic seedlings with the seedling age of 10d.

Taking out the aseptic seedlings in the tissue culture chamber, processing on an ultra-clean workbench to obtain the hypocotyls of the aseptic seedlings, cutting the hypocotyls into 1cm long, and marking 3-5 wounds on the surfaces of the hypocotyls for the next transformation.

2. Culturing Agrobacterium

Activating the strain. 10ul of Agrobacterium containing the knockdown vector was streaked on solid YEP plates (containing Kana 50ug/ml and Rif50 ug/ml) using a three-way streak. The plate containing the agrobacterium is placed in a constant temperature incubator and is subjected to dark culture at 28 ℃ for 36 hours, so that activated single colony agrobacterium is obtained.

Single colonies were picked and inoculated into 50ml of YEP (containing Kana 50ug/ml and Rif50 ug/ml) liquid medium, shake-cultured at 28℃in a shaker at 220rpm in the absence of light for 24 hours until the YEP liquid medium containing single colonies became turbid.

3. Hypocotyl co-culture

Placing 10ml of MS (PPM-free) liquid culture medium into the sterilized culture dish, placing the hypocotyl treated in the previous step into M liquid culture medium, adding 100ul of agrobacterium liquid into each 10ml of culture medium, and fully mixing the bacterial liquid and the scratched hypocotyl.

The hypocotyl containing the agrobacterium is placed in a tissue culture chamber at 22 ℃ for dark culture for 48 hours, and the transformed explant is obtained.

4. Tissue culture of flax

The explants subjected to co-culture are collected in conical flasks which are subjected to sterilization treatment, 150ml of sterilized water containing PPM is added for 2 times, and the surface of the explants is cleaned by continuous stirring during the washing process. The washed explants were collected in a new sterilized Erlenmeyer flask, and washed twice with 150ml of sterilized water, with shaking to thoroughly wash the explants. Collecting the completely cleaned explant on sterilized filter paper, and wiping the surface of the explant with water.

Explants were selected and placed on callus induction medium and cultured in the 22℃tissue culture chamber with light for 10d. The obtained callus was transferred to a shoot induction medium with a photoperiod of 16h of light and 8h of darkness, and the temperature of the tissue culture chamber was 22 ℃. The sprout induction medium was changed every 7d until sprouts were grown.

Transferring the regenerated buds growing to 3cm into a glass culture flask containing rooting culture medium, illuminating for 16 hours, darkening for 8 hours, and culturing for 7-10 days at 22 ℃ to obtain rooted regenerated plant seedlings.

The flax regeneration system is established as shown in figure 5.

Example 8 detection and transplantation of transgenic flax

1. Knocking out the PCR detection of the specific Cas protein gene of the vector:

early stage to verify the transformation rate of callus, callus DNA was extracted. And carrying out PCR amplification of specific Cas proteins on the callus DNA transformed with different knockout vectors, wherein the amplification product is 605bp. The result of electrophoresis was performed on 1.5% agarose gel and detected by an ultraviolet imaging system, and the result is shown in FIG. 6. The result shows that the PCR amplified product of the detected flax callus is 605bp, and the PCR amplified product is completely matched with the target sequence size of the specific Cas protein. This indicates that the conversion of flax calli was 100%.

Rooting and transplanting the differentiated buds of the callus to obtain 16 flax transgenic plants. And extracting flax transgenic plant leaf DNA as a template, and carrying out PCR amplification by using primers of Cas protein genes, wherein the amplification product is 605bp. The results of 1.5% agarose gel electrophoresis are shown in FIG. 7, 7 and 8 in panel A, and 1,3, 4, 5 and 6 in panel B, amplified about 605bp bands, consistent with the expectations of the assay. 7 of the obtained 16 transgenic plants are amplified to a specific band, fragments conforming to the target band are not found in the rest transgenic plant seedlings, namely, the PCR detection result preliminarily proves that the Cas protein is integrated into the genome of the 7 flax transgenic plants, the 7 positive transgenic plant leaf DNA is used as a template, the specific primers are used for PCR amplification, the amplification products of the LusCESA4 and the LusCESA8 genes are 518bp/639bp respectively, and the transgenic plant seedlings are shown in figure 8. The transformation rate of 16 transgenic plant seedlings is 43.75%.

2. PCR detection of gene editing target site:

according to the LusCESA4 gene and the LusCESA8 gene of the 'Zhongya No. 1', a target site is respectively arranged on the LusCESA4 gene and the LusCESA8 gene in the experiment, and corresponding primers are respectively designed at 300bp above and below the two target sites by using an online software tool kit CRISPR-GE. The length of the LusCESA4 gene fragment is 518bp, the upstream primer is 4F, the downstream primer is 4R, and the table 4 is shown; the fragment length of the LusCESA8 gene is 639bp, the upstream primer 8F and the downstream primer 8R, as shown in Table 4.

TABLE 2 PCR primers for target genes

PCR was performed using the DNA of the transgenic plants as template and ddH2O as blank. PCR reaction conditions: 95 ℃ for 5min;34 cycles: 95℃30s,58℃30s,72℃1min,72℃5min;4 ℃ is infinity. The reaction system is shown in Table 2, and the gel electrophoresis is carried out to judge whether the product meets the expectations according to the fragment size.

The transgenic gene fragment with positive PCR result and a group of blank fragments without gene editing "Zhongya No. 1" were sent together for sequencing, and the sequencing result is shown in FIG. 9. From the sequencing results, it can be seen that the 135 th base of the 8-4-3 plant is mutated from C to G, the 141 th base is mutated from T to G, the 143 th base is mutated from T to G, the 154 th base is mutated from T to G, and the 158 th egg base G is mutated to A. The 8-4-3 plants had a base mutation at 3 at the target site and a simultaneous mutation at 2 at 4 and 8 after the target site, indicating that the knockout vector successfully edited the LusCESA8 gene of the 8-4-3 plants. The 135 th base of the 8-4-1 plant is mutated from C to T, the 141 th base is mutated from T to G, the 143 th base is mutated from T to G, and the total of 3 base mutations occur at the target site, which indicates that the knockout vector successfully edits the LusCESA8 gene of the 8-4-1 plant. 8-3-8 plants were not edited, indicating that the transgenic plants were false positive plants and that the knockout vector did not function within the plant. 8-3-5 plants were mutated from G to A at base 158 and from T to C at base 171. Two mutations were located at positions 8 and 21, respectively, after the target site. Sequencing results of the LusCESA4 gene showed that no editing of the genes occurred in the 5 transgenic plants. The results prove that the experiment successfully introduces the LusCESA8 single-target knockout vector into the genome of the 'ZhongLin No. 1', successfully edits the gene of the target fragment, ensures that the gene of the target site generates base substitution, finally obtains a positive material which is successfully transformed, and ensures that the editing efficiency of the transgenic plant is 42.86%. The transgenic seedling withers in the later growth process, and the survival rate is only 33.33%. At the same time, no editing occurred at the genomic target site of the lus cesa4 gene.

Example 9 transplanting and apparent Property Observation of transgenic flax

And (3) hardening seedlings in the tissue culture room for 7 days to prepare for transfer. And when transferring the transgenic plant subjected to seedling hardening, cleaning a rooting culture medium substrate on the root system surface of the plant.

The cleaned transgenic plants are supported by sponge and put into conical flasks containing plant nutrient solution prepared in advance. The light source for indoor culture is from a plant growth lamp, the light period is 16h illumination and 8h darkness. After the plants grow stably in the nutrient solution, transferring the plants into sterilized nutrient soil, and culturing the transgenic plants indoors under the same illumination condition until the plants bloom and bear fruits, and harvesting the seeds of the transgenic flax. The apparent character differences of T0-generation flax LusCESA8 transgenic plants are shown in figure 10. Compared with a normal China flax No. 1 plant, the apparent characters of the stems and seeds of the T0-generation LusCESA8 transgenic plant are different, the stems of the T0-generation LusCESA8 transgenic plant are oblate, and the seeds of the T0-generation transgenic plant are relatively not full.

Claims (5)

1. The flax cellulose synthase gene knockout recombinant vector is characterized in that the vector is constructed by taking plasmid JRH0996 as an original vector and utilizing a CRISPR/Cas9 editing system, and target genes are flax cellulose synthase genes LusCESA4 and LusCESA8 respectively.

2. The recombinant vector according to claim 1, wherein the nucleotide sequence of the recombinant vector with LusCESA4 as target gene is as follows: SEQ ID:1, designated JRH0996-CESA4.

3. The recombinant vector according to claim 1, wherein the nucleotide sequence of the recombinant vector with LusCESA8 as a target gene is as follows: SEQ ID:2, designated JRH0996-CESA8.

4. The method for constructing a flax cellulose synthase gene knockout recombinant vector according to claim 1, characterized by comprising the steps of:

A.sgRNA target site selection and primer design

Analyzing the LusCESA4 and LusCESA8 genes according to target positions, specificity and GC base content, and designing two fragments with strong specificity as target sequences by using a CRISPR-GE online software kit to construct an sgRNA expression cassette, wherein the target sequence information of the LusCESA4 gene is GTTCCCCGTTCTTTCAACGC TGG, lusCESA and CCC GGGGCTCCCGTGTGCAATAC;

B. construction of recombinant vectors

And (3) enzyme-cutting the empty plasmid JRH0996, cloning a PCR product of sgRNA to an enzyme-cutting site of a JRH0996 vector, wherein a verification gene of the recombinant vector is a CRISPR/Cas9 system specific protein Cas protein gene, a screening marker gene is a hygromycin gene, and a promoter is an optimized AtU promoter.

5. The use of the flax cellulose synthase gene knockout recombinant vector JRH0996-CESA8 according to claim 3 in flax gene editing.

Images