CN111778275A

CN111778275A - Application and method of fast-cycle rape in rape functional gene research field

Info

Publication number: CN111778275A
Application number: CN202010634394.1A
Authority: CN
Inventors: 杨梅; 杨铭浩; 邓扬菲; 杨峻辉; 孟冬林; 杨峻烨; 莫从古; 许兴旺; 钱汇海
Original assignee: Zhuhai Nongtengle Oil Plant Technology Co ltd
Current assignee: Zhuhai Nongtengle Oil Plant Technology Co ltd
Priority date: 2020-07-02
Filing date: 2020-07-02
Publication date: 2020-10-16

Abstract

The invention belongs to the field of plant genetic engineering, particularly relates to application of fast-cycle rape in the field of rape functional genomics research, and further discloses a method for carrying out rape functional gene editing based on fast-cycle cabbage type rape and a method for preparing mutants by chemical mutagenesis. The scheme of the invention is based on the fast-cycle rape to carry out the related research of rape functional gene mutation, particularly comprises the editing of rape gene and/or the preparation of rape gene mutant, and can replace arabidopsis thaliana to realize the research of rape gene in short cycle based on the advantages of short growth period and small plant.

Description

Application and method of fast-cycle rape in rape functional gene research field

Technical Field

The invention belongs to the field of plant genetic engineering, particularly relates to application of fast-cycle rape in the field of functional genomics research, and further discloses a method for performing functional gene editing based on the fast-cycle cabbage type rape and a method for preparing a functional gene mutant through chemical mutagenesis.

Background

Cabbage type rape (Brassica napus L.) is an important oil crop widely planted in China, large-area planting is carried out in Yangtze river basin, Yunobu plateau and northwest climate cold areas in China, and the total annual planting area is about 1 hundred million mu. The genome is AACC, 19 pairs of chromosomes, the size is about 1200-1280Mb (Song Jia-Ming et al, 2020), the structure is complex, and more homologous fragments exist. Rape likes cold and requires a certain time of low-temperature treatment to bloom (usually 4-10 ℃), the growth period of south autumn sowing reaches more than 200 days, northwest summer sowing also reaches about 120 days, and the plant type is high. These biological characteristics determine that high-throughput culture (i.e., large-scale planting in limited time and space) of rape is difficult to realize in the researches of tissue culture, gene mutagenesis, gene localization, omics, particularly functional genomics and the like. Therefore, under the prior art conditions, when researchers verify the functions of rape genes, if a transgenic method is adopted, the results can be obtained only from the T0 generation to the T2 generation in 2-3 years; even with gene editing techniques, phenotypic validation was obtained from the T0 generation to T1, which was 1-2 years old. Therefore, in order to save time, researchers often have to use arabidopsis thaliana, which is also a brassicaceae species, as a model plant instead of brassica napus for gene cloning or functional verification. This is mainly because arabidopsis thaliana has a short growth period under long-day conditions, short plants are favorable for high-throughput culture (6 generations can be grown every year in a large scale in a laboratory), and the simple genome structure is also favorable for gene cloning, as compared with brassica napus.

However, with the development of rape breeding and basic research, the limitation of using Arabidopsis as a substitute is more and more obvious because (1) the Arabidopsis genome is small, and a plurality of genes which are not available in Arabidopsis exist in the rape, especially the genes related to yield or heterosis utilization, such as rape dominant genic male sterile gene MS5(Xin Qiang et al 2016), can be cloned or verified only when the rape is used as a donor; (2) the flower bud of arabidopsis is smaller than that of rape, and the hybridization test has certain difficulty; (3) more importantly, the arabidopsis thaliana is a weed, has no direct utilization value in field production practice, and a positive test product cannot be put into production practice. However, when rape is used as a receptor for researches such as gene mutation, transgenosis or gene editing, the positive product may have direct field popularization value.

Therefore, the development of a high-throughput method for directly utilizing rape to research gene functions has positive significance for the development of the field of rape genetic engineering.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to provide the application of the fast-cycle cabbage type rape serving as a donor in the aspects of functional genomics gene editing and functional gene mutagenesis of the rape;

the first technical problem to be solved by the invention is to provide a method for rape gene editing based on fast-cycle rape;

the second technical problem to be solved by the present invention is to provide a method for preparing functional gene mutants based on fast cycle oilseed rape.

In order to solve the technical problems, the application of the fast-cycle rape in the field of functional gene research is as follows:

the fast-cycle rape is a cabbage type rape (Brassica napus) which has a short life cycle and only has a period from emergence to maturation of about 60 days under the conditions of 22 ℃ and 16 hours of light/8 hours of dark culture;

the functional gene research comprises gene editing and/or preparation of gene mutants.

The invention discloses a method for carrying out rape gene editing based on fast-cycle rape, which adopts the fast-cycle rape as a donor to carry out directional editing of a target gene, and can harvest gene editing filial generation about 80 days after explant inoculation, and specifically comprises the following steps

(1) Taking the seeds of the fast-cycle rape, performing surface disinfection, and then sowing to prepare an explant for later use;

(2) constructing a gene editing carrier according to the sequence structure of a target gene, and converting escherichia coli competent cells;

(3) fusing the obtained escherichia coli competent cells with agrobacterium by electric shock, and impregnating the explant obtained in the step (1) with the obtained agrobacterium liquid;

(4) transferring the explants soaked with the agrobacterium liquid into an M1 culture medium, and co-culturing for 36-48h in a dark room at 22 ℃;

(5) transferring the explant cultured in the step (4) from the M1 medium to the M2 medium, and performing illumination culture at 22 ℃ for 2 weeks;

(6) transferring the cultured explants into an M3 culture medium, and forming plantlets through conventional culture;

(7) sequencing the selected editing sites, transplanting the plantlets determined to be positive single plants into a greenhouse for culturing, and managing the plantlets according to the conventional method after survival.

Specifically, in the step (4), the M1 medium comprises the following components in parts by weight: 4.4g of MS finished product powder, 30g of cane sugar, 18g of D-mannitol, 1mg of 2,4-dichlorophenoxyacetic acid, 0.3mg of kinetin, 5.5g of Phytagel and ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.88; sterilizing at high temperature, adding 100 μmol acetosyringone, and mixing.

Specifically, in the step (5), the M2 cultureThe nutrient comprises the following components in percentage by weight: m S finished product powder 4.4g, sucrose 30g, D-mannitol 18g, 2,4-dichlorophenoxyacetic acid 1mg, kinetin 0.3mg, Phytagel5.5g, ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.86; after high temperature sterilization, 150. mu.l of silver thiosulfate, 300mg of timentin and 25mg of kanamycin sulfate are added.

Specifically, in the step (5), in the light culture, the light condition is controlled to be 16 hours of light/8 hours of dark.

Specifically, in the step (6), the M3 medium comprises the following components in parts by weight: 4.4g of MS finished product powder, 30g of cane sugar, 5.5g of Phytagel and ddH₂O is metered to 1L, and the pH value is adjusted to 5.84-5.88; after high temperature sterilization, 300mg of timentin is added.

Specifically, in the step (6), the culture time is controlled to be 2 weeks, namely the test-tube plantlet is in the 2-leaf stage, otherwise, the plantlet flowers in the test tube for more than 24 days.

Specifically, in the step (7), the culture conditions in the cultivation step are 22 ℃ and 16 hours of light/8 hours of darkness, the flowering can be performed without season limitation and low-temperature vernalization, and only about 40 days are required from the transplanting survival to the harvest of the T1 seeds.

The invention also discloses a method for preparing a functional gene mutant based on the fast-cycle rape, which adopts the fast-cycle rape as a donor to carry out mutagenesis treatment and specifically comprises the following steps:

(1) taking the seeds M0 of the fast-cycle rape for immersion and imbibition pretreatment for later use;

(2) carrying out mutagenesis treatment on the fast-period rape to obtain fast-period M1 seeds for later use;

(3) sowing the obtained fast-cycle M1 seeds in a culture room, screening mutant phenotype, and selfing to obtain fast-cycle M2 seeds for later use;

(4) continuously sowing the fast-period M2 seeds in a culture room, verifying whether the mutant phenotype is heritable or not, collecting mutant strains, and continuously selfing to obtain an M3 mutant strain;

(5) and (3) breeding the M3 mutant strain into an inbred line, and continuously selfing the mutation strain without separation to obtain the homozygous M4 mutant.

Specifically, in the step (2), the mutagenesis step includes chemical mutagenesis and physical mutagenesis.

Specifically, in the steps (3), (4) and (5), the culture conditions are controlled as follows: the temperature is 22 ℃, the illumination is 16 hours, the illumination is dark per 8 hours, the method is not limited by seasons, and the flowers can bloom without low-temperature vernalization, thereby realizing large-scale indoor culture.

The scheme of the invention is based on the fast-cycle rape to perform related research of functional genomics, particularly, but not limited to the editing of rape genes and/or the preparation of rape gene mutants, and based on the advantages of short growth period and smaller individual of the fast-cycle rape, the fast-cycle rape can replace arabidopsis thaliana to realize the research of the rape genes in a short cycle.

The method for gene editing based on the fast-cycle cabbage type rape as the donor uses the fast-cycle rape to replace arabidopsis thaliana or traditional rape as the donor for tests such as functional verification and the like to edit the target gene, so that the gene functional verification result can be quickly obtained. Although the gene editing method is similar to the common rape gene editing technology, the whole process from inoculation of the fast-period explant to harvest of the T1 positive seedling seeds is only about 80 days, and the short and small plants occupy little space and are not limited by seasons any more; and the common rape can only obtain test-tube seedlings in 80 days at the fastest, and can bloom only after being transplanted and low-temperature vernalization treatment is needed. Therefore, the use of fast-cycle rape as a donor can save research time and culture space, realize high-throughput research, thereby accelerating the basic research process of rape, and the experimental product has the potential of being directly used for field production.

According to the method for preparing the functional gene mutant based on the fast-cycle rape, the fast-cycle rape is adopted to replace arabidopsis thaliana or traditional rape as a donor and is used as a tool for basic research and breeding practice to carry out mutagenesis treatment, the mutant can be rapidly identified indoors on a large scale, and the new fast-cycle rape strain obtained by mutagenesis of important character related genes can meet high-throughput experiment requirements such as gene positioning and Tilling, and an experiment product has the potential of being directly applied to breeding practice.

Drawings

In order that the present disclosure may be more readily and clearly understood, the following detailed description of the present disclosure is provided in connection with specific embodiments thereof and the accompanying drawings, in which,

FIG. 1 is a structural schematic diagram of a double-target CRISPR/Cas9 binary vector in example 1 of the invention;

FIG. 2 is a test result of Cas9 element in fast cycle rape horizontal gel detection Fad2 gene editing seedlings as described in example 1 of the present invention.

Detailed Description

In the following examples, the fast cycle brassica napus is obtained according to the method described in chinese patent CN110100723A (a method for cross breeding fast cycle brassica napus and the application thereof), and a "perceival AR-41L" type artificial incubator manufactured by perceival Scientific company is selected, the variety flowers 27 days after sowing (22 ℃, 16h light/8 h dark) in the artificial incubator, and does not need to vernalize at low temperature, the plant height is only about 50 cm, the fruit setting is normal, and the whole growth period is as short as 60 days.

Example 1

In this example, the fast cycle rape was used as a donor for Fad2 gene editing to create a new high oleic acid fast cycle rape. Oleic acid is one of the main components of rapeseed oil fatty acid, and has the functions of reducing three highs (hyperlipidemia, hyperglycemia and hypertension) and preventing tumors (Piccinin et al, 2019), so that the breeding with high oleic acid (the content of oleic acid is more than 75%) is one of the important targets of the quality breeding of the rapeseed oil in recent years. The synthesis of oleic acid in canola is controlled by the Fad2 gene (Yang et al, 2012), and when wild-type Fad2 is mutated to Fad2, a high oleic acid phenotype is exhibited. In this embodiment, taking the fast cycle rape Fad2 gene editing process as an example, the Fad2 gene on the fast cycle rape a genome is directionally mutated into Fad2, so as to obtain the high oleic acid new fast cycle rape.

The method for obtaining the high-oleic acid new fast-cycle rape by gene editing comprises the following steps:

(1) target site selection

According to the previous QTL positioning results, the main QTL controlling the oleic acid content in Brassica napus is located on the A5 linkage group, which explains 89% of phenotypic variation of the oleic acid content (Yang et al, 2012), so the Fad2 gene on the A5 linkage group is selected, and on-line software http:// cbi. hzau. edu. cn/criprpr/two specific target sites are designed for each copy respectively (Table 1).

TABLE 1 fast cycle Brassica napus A5 linkage group Fad2 Gene target site sequences

Note: the base in bold is marked by PAM recognition sequence

(2) Construction of Gene editing vector and preparation of competent cells of Escherichia coli

The CRISPR/gRNA vector is obtained by modifying a Kan-resistant pKSE401 vector as a framework, and has the size of about 626bp, as shown in figure 1. To facilitate ligation of the gRNA expression cassette, the gRNA vector was digested with Bsa i. In order to reduce the occurrence of false positive clones, the gRNA region is arranged at the upstream of the U3/U6 promoter region during vector design, the middle is separated by a vector framework, and the vector framework sequences close to the U3/U6 promoter region and the gRNA region are selected during primer design to design upstream and downstream primers, so that the vector which is not digested is not amplified by PCR due to the limitation of extension time (refer to Xing et al 2014).

During operation, a 100-fold diluted gRNA target expression cassette template plasmid pCBC-DT1T2(100ng/l, provided by aged military teacher of China agricultural university) is used as a template to carry out four-joint primer (the sequence of the joint primer is shown in Table 2, and the reaction system is shown in Table 3) PCR amplification (the program is 94 ℃ for 3min, 1 reaction, 94 ℃ for 30s, 59 ℃ for 30s, 72 ℃ for 40s, 35 circulation reactions, 72 ℃ for 5min, 4 ℃ for 20min, 1 reaction), and a PCR product is purified and recovered; meanwhile, Bsa I is used for carrying out single enzyme digestion on the amplified product, a CRISPR/Cas9 vector and a T4 ligase to assemble the vector (the reaction system is shown in Table 4, and the reaction program is that the temperature is 37 ℃ for 5 hours, the temperature is 50 ℃ for 5 minutes and the temperature is 80 ℃ for 10 minutes). 5ul of ligation reaction product is taken to directly transform the competence of escherichia coli, and screening is carried out on a Kan resistant plate. The U626-IDF and U629-IDR primer pairs amplify the monoclonals growing on the plate, wherein the amplification product is 726bp colony culture, and then the colony culture is sent to a company for sequencing to identify whether the sequence of the sgRNAs is correct, and the sequencing primers U626-IDF and U629-IDF have the following specific primer sequences:

U626-IDF:TGTCCCAGGATTAGAATGATTAGGC；

U629-IDF:TTAATCCAAACTACTGCAGCCTGAC；

U629-IDR:AGCCCTCTTCTTTCGATCCATCAAC

(rc:GTTGATGGATCGAAAGAAGAGGGCT)

TABLE 2 CRISPR/Cas9 vector target linker primers

Joint	Direction of rotation	Primer sequences
			BsF	Forward direction	ATATATGGTCTCGATTGACCGCTACGCTGCTGTCCAGTT
F0	Forward direction	TGACCGCTACGCTGCTGTCCAGTTTTAGAGCTAGAAATAGC
			R0	Reverse direction	AACCTACGCTGCTGTCCAAGGACAATCTCTTAGTCGACTCTAC
BsR	Reverse direction	ATTATTGGTCTCGAAACCTACGCTGCTGTCCAAGGACAA

TABLE 3 four-joint primer amplification reaction system with plasmid pCBC-DT1T2 as template

TABLE 4 enzyme digestion-ligation reaction System assembled by vectors

Component (A)	Volume ul
		PCR fragment (626-bp)	2
pHSE401	2
		10xNEB T4 Buffer	1.5
10xBSA	1.5
		BsaI(NEB)	1
T4 Ligase (NEB)/high concentration	1
		ddH2O	6
Total	15

(3) Gene editing vector transformation of agrobacterium

Agrobacterium GV3101 competent cells were transformed with the PKSE401-A5Fad2 gene editing vector (5 ng/. mu.l) containing the correct sgRNA sequence as a result of sequencing in step (2), and the resulting bacterial suspension was plated on LB solid medium containing 50mg/L Kanamycin (Kanamycin, Kan +), 25mg/L rifampin (Rifamicin, Rif +) and 50mg/L gentamicin sulfate (Gentamycinfult, Gen +) and cultured at 28 ℃ for 36 hours.

Selecting the grown monoclonal for PCR identification, dipping the monoclonal by a sterilizing gun head, and placing the monoclonal in a 10-microliter PCR reaction system:

2XTaq Master Mix 5μl；

primer 545Cas 9-F: GGGACCTACCACGATCTCCT (10. mu. mol/L) 0.25. mu.l;

primer 545Cas 9-R: CCCTTCTGCGTGGTCTGATT (10. mu. mol/L) 0.25. mu.l;

ddH₂O 4.5μl。

reaction procedure: 1 reaction at 95 ℃ for 3 min; 35 circulating reactions at 95 ℃ for 30s, 60 ℃ for 30s and 72 ℃ for 30 s; 5min at 72 ℃ and 20min at 4 ℃, and 1 reaction.

Selecting a corresponding monoclonal with the amplified product fragment length of 500bp, culturing in LB liquid culture medium containing 50mg/L Kanamycin (Kanamycin, Kan +), 25mg/L rifampin (Rifamicin, Rif +) and 50mg/L gentamicin sulfate (Gentamycinfurate, Gen +), culturing at 28 ℃ for 24-36 hours by using a constant temperature shaking table to reach the OD600 value of 0.4-0.6, and controlling the rotating speed to be 220 rpm.

And (3) sending the culture solution to a sequencing company for sequencing, sequencing primers U626-IDF and U629-IDR, and judging whether the sequence of the target sgRNAs is correct according to a sequencing result. 500 mul of a culture solution after agrobacterium is transformed by selecting a PKSE401-A5Fad2 vector with correct sequencing is added with 50% of sterilized glycerol with the same volume (the sterilized glycerol is added with ultrapure water with the same volume), the mixture is evenly mixed by reversing the upper part and the lower part, and then the mixture is stored in an ultra-low temperature refrigerator at minus 80 ℃ for use in genetic transformation experiments.

(4) Fast-cycle sterile germination and agrobacterium activation of rape seeds

A2 ml centrifuge tube is filled with 40 grains of fast-cycle rape seeds at most, 75% alcohol is added, the cover is turned upside down, and the seeds are soaked for 1 min. Sucking off alcohol with a pipette, adding appropriate amount of 50% 84 disinfectant (commercially available, distilled water: 84 disinfectant volume 1: 1), covering, turning upside down, and soaking seeds for 3 min. Absorbing the disinfectant, adding a proper amount of sterile water, washing for 3-5 times, covering the centrifugal tube to turn over up and down each time, and keeping the centrifugal tube in a sterile environment. Sterile seeds were sown into M0 medium with sterile forceps, 10-12 per dish. The culture dish is placed in a sterile culture box and is placed in a dark light at 24 ℃ for 6 days (the culture dish can be placed in a paper box and cultured in a light culture room).

5 days after the fast-cycle rape is sowed, the agrobacterium activation is prepared. A50 ml sterilized glass flask was prepared, 10. mu.L of Agrobacterium solution containing the correct vector obtained above was pipetted into 5ml of LB liquid medium containing 50mg/L Kanamycin (Kanamycin, Kan +), 25mg/L Rifampicin (Rifamicin, Rif +) and 50mg/L gentamicin sulfate (Gentamycin sulfate, Gen +), cultured on a shaker at 28 ℃ for 14-18 hours, and OD600 was measured to be 0.4 by using a spectrophotometer NanoDrop One.

(5) Fast cycle rape explant genetic transformation

And (3) sucking 2ml of the activated agrobacterium liquid obtained in the step (4) into a sterile centrifuge tube, centrifuging at 3000rpm for 3min, removing supernatant, adding 1.5ml of DM culture medium suspended bacteria liquid, and placing at 4 ℃. Shearing the hypocotyl (cotyledon can also be used) of the germinated seedling on the 6 th day in the step (4) by using sterile scissors into a sterile culture dish, wherein each explant is 0.8-1.0cm in length, and placing about 150-200 explants in each dish. Pouring the prepared 1.5ml of suspended bacterial liquid of the DM culture medium, supplementing 20ml of DM liquid culture medium, dip-dyeing for 10-15min, and lightly blowing the dip-dyed culture medium by a liquid shifter every 5min to ensure that the incisions at the two ends of each explant are fully contacted with the agrobacterium liquid. And when the explant is subjected to dip dyeing for 8min, sucking out DM bacterial liquid by using a liquid suction device, transferring the explant to sterile filter paper by using a sterile forceps, placing for a moment, and sucking away redundant bacterial liquid on the explant. The explants infected with the inoculum were transferred to M1 medium for co-cultivation (24 ℃ in the dark, 36-48 hours).

The DM medium (1L) comprises the following components in percentage by weight: MS finished product powder (Murashige)&Skoog media cloning vitamins, Duchefa Biochemie company)4.4g, sucrose 3g, ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.86; the high temperature sterilization temperature is reduced to 37 ℃, 1ml of AS (4 ' -hydroxy-3 ', 5 ' -dimethoxyacetophenone, acetosyringone, Sigma-Aldrich, mother liquor 100 mu mol/ml) is added, and the mixture is uniformly mixed and then placed in a display cabinet at 4 ℃ for storage.

The components and the concentrations of the M1 culture medium (1L) are as follows: MS finished product powder (Murashige)&Skoog media cloning vitamins, Duchefa Biochemie company)4.4g, sucrose 30g, D-Mannitol (D-Mannitol, Sigma-Aldrich)18g, 2,4-Dichlorophenoxyacetic acid (2,4-Dichlorophenoxy acetic acid, Sigma-Aldrich, mother liquor 1mg/ml)1ml, Kinetin (Kinetin, Sigma-Aldrich, mother liquor 0.3mg/ml)1ml, Phytagel (BioReagent, plant cell culture, Sigma-Aldrich)5.5g, ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.88; after high temperature sterilization, 1ml of AS (4 ' -hydroxy-3 ', 5 ' -dimethoxyacetophenone, acetosyringone, Sigma-Aldrich, mother liquor 100. mu. mol/ml) is added when the temperature of the culture medium is reduced to 50 ℃, and the mixture is uniformly mixed and then subpackaged into glass culture dishes with the diameter of 90 cm.

(6) Fast cycle rape explant induced bud

Explants after 36-48 hours of co-cultivation in step (5) were transferred from M1 medium to M2 medium and cultured in a light chamber for 2 weeks (22 ℃, 16h light/8 h dark). Because the fast-period rape explant is very easy to differentiate into seedlings, the sprouts can be formed 2 weeks after inoculation, and the step of repeated subculture of common rape is omitted.

The M2 culture medium (1L) comprises the following components in percentage by weight: MS finished product powder (Murashige)&Skoogmedia partitioning vitamins, Duchefa biochemice company)4.4g, sucrose 30g, D-mannitol (DMannitol, Sigma-Aldrich)18g, 2,4-Dichlorophenoxyacetic acid (2,4-Dichlorophenoxyacetic acid, Sigma-Aldrich, mother liquor 1mg/ml)1ml, Kinetin (Kinetin, Sigma-Aldrich, mother liquor 0.3mg/ml)1ml, Phytagel (BioReagent, plant cell culture, Sigma-Aldrich)5.5g, ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.86; STS (silver thiosulfate, [ Ag (SO3) ]is added after high-temperature sterilization until the temperature of the medium is lowered to 50 ℃₂]^2-) 150. mu.l of Timentin, a novel gram-negative antibiotic, Timentin, Acmec, mother liquor 200mg/ml)1.5ml of Kanamycin sulfate (Kanamycin sulfate, Shanghai Biotech, mother liquor 50mg/ml) 500. mu.l. Wherein, the STS preparation method comprises the following steps: sodium thiosulfate pentahydrate 0.1mol/L and silver nitrate 0.1mol/L in accordance with 4: 1 volume ratio, pouring the silver nitrate solution into the sodium thiosulfate pentahydrate solution very slowly, and stirring quickly while paying attention to pouring.

(7) Fast cycle regeneration of oilseed rape explants

Transferring the green buds with the complete growing points obtained in the step (6) into an M3 culture medium to root and grow seedlings until the two-leaf stage (22 ℃, 16h of light/8 h of dark). Because the rape in the fast period can bloom without low-temperature vernalization, and the young buds can be seen by naked eyes at the 2-leaf stage, the young seedlings are recommended to grow on the culture medium and cannot exceed the 3-leaf stage, namely, the culture time is not more than 14 days, otherwise, the young seedlings are slightly old and can bloom in the culture bottle, and the flowering plants cannot fruit in the bottle.

The composition and concentration of the M3 medium (1L volume) were: MS finished product powder (Murashige)&Skoog media packaging vitamins, brand Duchefa Biochemie company)4.4g, sucrose 30g, Phytagel (BioReagent, plant cell culture, brand Sigma-Aldrich)5.5g, ddH₂O is metered to 1L, and the pH value is adjusted to 5.84-5.88; the high temperature sterilization temperature is reduced to 50 ℃, and 1.5ml of Timentin (novel gram negative bacteria antibiotic, Timentin, brand Acmec, mother liquor 200mg/ml) is added.

(8) Test-tube seedling transplanting management, positive seedling identification and target site detection

Transplanting the seedlings obtained in the step (7) into a plug tray, planting in a greenhouse for about 2 weeks after survival, and then blooming (22 ℃, 16h of light/8 h of dark, and supplementing light by using a growth lamp when natural light is insufficient). Clamping leaves by using a 1.5ml centrifuge tube, extracting DNA (deoxyribonucleic acid) as a template, detecting by using a carrier specific Cas9 primer (the same as the Cas9 primer in the step (3)) through agarose gel electrophoresis after amplification, detecting a positive seedling Cas9 element by using a plant horizontal gel obtained by transforming the fast cycle rape by the pKSE401-A5Fad2 vector, and obtaining a detection result shown in an attached figure 2. Wherein, the transformed fast-cycle plants are named as FF, and the total number of lanes is 24, and FF3 and FF21 are positive; ne CK 1: negative fast cycle plants; ne CK 2: negative control variety Westar; plasmid: pKSE401-A5Fad 2.

Pulling out negative seedlings, keeping positive seedlings, sleeving a transparent small sodium sulfate paper bag after blooming, selfing, and harvesting seeds after maturation to obtain the T1 generation fast-cycle rape. Because the rape in the fast period can bloom without low temperature, the low temperature vernalization procedure is saved during greenhouse cultivation, and the season limitation is not needed to be considered. The temperature of the greenhouse is kept at 22 ℃ all the time, the illumination is kept for 16 hours/8 hours, and light can be supplemented on the basis of natural light. Transplanting from the 3-leaf stage to survive to mature for about 40 days.

The genomic DNA of the positive individual was used as a template, and the first PCR amplification was performed using the primer combination HY267 and HY268, and the amplification products were sent to the company for sequencing (sequencing primer A5Fad2 CE).

PCR reaction procedure: 3min at 94 ℃ and 1 reaction; 30s at 94 ℃, 30s at 59 ℃ and 40s at 72 ℃, and 35 reactions are circulated in the step; 10min at 72 ℃ and 20min at 4 ℃, and 1 reaction.

And (4) detecting whether a hetero-peak exists near the target site or not through primary product sequencing. The PCR products corresponding to the individual strains with the presence of the hetero-peak were subjected to T-A cloning mutexperiments (pMD)^TM18-T vector, manufactured by takara corporation, operating with reference to kit instructions) and resequenced, the primer sets for TA cloning at the target site of A5Fad2 were A5Fad2-TA-F and A5Fad2-TA-R, and the sequence information of the primers involved is shown in Table 5.

TABLE 5 primers for amplification of target sites

Primers	Direction	Sequences of primers(5’-3’)
			HY267	forward	CAGGATCCATGGGCGCAGGTGGAAGAAT
HY268	reverse	CAGAGCTCTCATAACTTATTGTTGTACCAG
			A5Fad2CE	forward	TTCAGTTCACTCTCGGCAGC
A5Fad2-TA-F	forward	TTCAGTTCACTCTCGGCAGC
			A5Fad2-TA-R	reverse	GCGTGTCCGTGATATTGTGG

The sequencing result is compared with the A5Fad2 sequence of the wild type fast cycle rape (T0 generation, namely the wild type fast cycle rape without gene editing), and the editing type of the target site can be determined.

Therefore, the scheme of the invention takes the rapid-cycle rape as a donor, can replace arabidopsis thaliana to realize rapid gene editing and modification research, and can represent the gene function of the rape more accurately.

Example 2

This example uses fast-cycle rape as donor for EMS chemical mutagenesis to obtain rape gene mutants. In the research or breeding of rape functional genomics, various mutants often need to be created, and physical mutagenesis (such as⁶⁰Co-gamma rays, etc.) or chemical mutagenesis (e.g., EMS, etc.) are common treatment modalities. Although the mutagenesis is simpler by adopting the traditional rape, the treatment of the mutagenized offspring is very numbThe method is troublesome, needs to consume more land resources for field planting, is limited by seasons, and is difficult to judge whether the phenotypic difference among the single plants is caused by genetic variation or environmental difference. However, if the fast-cycle rape is used as a donor, because the single plant is miniaturized and does not need vernalization, and a generation can be harvested in 60 days, the large-scale planting (namely high-flux planting) can be realized under the controllable condition of a laboratory, the season limitation is avoided, the environmental influence can be eliminated to the maximum extent, and the mutant phenotype can be found conveniently.

In the embodiment, the culture soil components used in the culture disc related to each step comprise No. 1 planting media imported from Canada (volume ratio of peat: vermiculite: perlite: 214: 70: 100), and the special fertilizer for horticulture (1g/L) of the ' hongyue ' brand 20-20-20 ' type is used as base fertilizer to soak.

In this embodiment, taking EMS (ethyl methane sulfonate) treatment of a fast-cycle rape seed as an example, a treatment process of mutagenesis and progeny is clarified, which specifically includes the following steps:

(1) the method comprises the steps of putting the rape seeds with the fast period (marked as M0 generation) into a gauze bag, placing the gauze bag into a beaker filled with distilled water, and soaking the rape seeds for 8 hours at room temperature (20 ℃), wherein the soaking aims to improve the permeability of cell membranes and accelerate the absorption speed of the seeds on mutagens for later use.

(2) Draining M0 seed, soaking in 3 ‰ EMS solution prepared with pH7.0 Phosphate Buffer Solution (PBS) for 12 hr, and stirring to make the treatment solution contact with seed thoroughly; immediately after 12 hours, M1 seeds were rinsed with running water for 12 hours to remove residual drug from the seeds (the treated seeds were designated as M1); it should be noted that the preparation and use of EMS solutions should be performed in a fume hood and the operator must wear a gas mask.

(3) The seeds of M1 were dried slightly and were not adhered to each other, and one hole was sowed on the nutrition dish every 3 grains. M0 seeds were sown on a nutrition dish at 1 point per hole, and 10 plants were planted as a Control (CK). The row spacing is 3cm during sowing, the plant spacing is 3cm, the culture conditions are 16 hours of light/8 hours of darkness and the temperature is 22 ℃. Sowing, placing on a culture shelf of a laboratory culture room, after seedling emergence, cutting off excessive seedlings by scissors, wherein the seedling emergence of each hole exceeds 1 plant. Before harvest, the phenotype was observed frequently and compared with the control. M1 individual plants with phenotypic variation were labeled, numbered, sowed for 27 days, and covered with a transparent small sodium sulfate paper bag to prevent powder cross-pollination after flowering. The row spacing is 3cm during sowing, the plant spacing is 3cm, the culture conditions are 16 hours of light/8 hours of darkness and the temperature is 22 ℃. Fixing the phenotype variation single plant by using disposable bamboo chopsticks to prevent lodging, and harvesting seeds formed by M1 after the phenotype variation single plant is mature, namely M2 generation; it should be noted that, since EMS mutagenesis may cause the reduction of seed vigor, 3 seeds per hole were put to ensure no seedling loss.

(4) One seed in each hole of M2 and M0 is respectively dibbled on a nutrition disc, M2 is dibbled to ensure a certain population scale, and M0 is used as 10 CK seeds; the row spacing is 3cm during sowing, the plant spacing is 3cm, the culture conditions are 16 hours of light/8 hours of darkness and the temperature is 22 ℃. Compared with CK, according to the record of M1 generation mutation phenotype, whether the single strain with the same mutation phenotype appears in the M2 population is observed. If so, this mutation is indicated to be heritable, and the M2 population wild type is investigated: determining the genetic rule of the mutant separation ratio, further covering small transparent sodium sulfate paper bags with the mutant according to single plants for selfing and purification, and harvesting M3 when the mutant is mature; if no same variation appears, M1 is physiological variation and cannot be inherited, and is eliminated.

(5) One seed in each hole of M3 and M0 is respectively dibbled on a nutrition disc, and M0 is used as 10 CK seeds. The row spacing is 3cm during sowing, the plant spacing is 3cm, the culture conditions are 16 hours of light/8 hours of darkness and the temperature is 22 ℃. Compared with CK, M3 family is selected, no wild type single plant is separated, and homozygous M4 new mutant type fast-cycle rape can be obtained by selfing. Theoretically, the mutant is highly consistent with the genetic background of M0 wild type and is excellent genetic material for verifying the correlation between gene function and phenotype.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.

Claims

1. An application of fast-cycle rape in the research field of rape functional genomics is characterized in that:

2. A method for carrying out rape gene editing based on fast-cycle rape is characterized in that the fast-cycle rape is adopted as a donor to carry out target gene editing, and gene editing filial generation can be harvested about 80 days after explant inoculation, and the method specifically comprises the following steps

(3) after the obtained escherichia coli competent cells are fused with agrobacterium by electric shock, the explant obtained in the step (1) is impregnated by the obtained agrobacterium liquid;

3. The method for gene editing in oilseed rape of claim 2, wherein the gene editing is performed in a single step,in the step (4), the M1 culture medium comprises the following components in percentage by weight: 4.4g of MS finished product powder, 30g of cane sugar, 18g of D-mannitol, 1mg of 2,4-dichlorophenoxyacetic acid, 0.3mg of kinetin, 5.5g of Phytagel and ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.88; sterilizing at high temperature, adding 100 μmol acetosyringone, and mixing.

4. The method for rape gene editing based on fast cycle rape as claimed in claim 2 or 3, wherein in the step (5), the M2 culture medium comprises the following components: 4.4g of MS finished product powder, 30g of cane sugar, 18g of D-mannitol, 1mg of 2,4-dichlorophenoxyacetic acid, 0.3mg of kinetin, 5.5g of Phytagel and ddH₂O is subjected to constant volume to 1L, and the pH value is adjusted to 5.86; after high temperature sterilization, 150. mu.l of silver thiosulfate, 300mg of timentin and 25mg of kanamycin sulfate are added.

5. The method for gene editing in rape of fast cycle duration as claimed in claim 4, wherein in the step (5), the light culture is performed under the control of 16 hours light/8 hours dark.

6. The method for gene editing in rape of fast cycle duration as claimed in any one of claims 2 to 5, wherein in step (6), the M3 medium comprises the following components: 4.4g of MS finished product powder, 30g of cane sugar, 5.5g of Phytagel and ddH₂O is metered to 1L, and the pH value is adjusted to 5.84-5.88; after high temperature sterilization, 300mg of timentin is added.

7. The method for gene editing in oilseed rape (Brassica napus) as claimed in any one of claims 2 to 6, wherein in step (7), the cultivation step is carried out under the conditions of 22 ℃ and 16 hours light/8 hours dark.

8. A method for preparing functional gene mutants based on fast-cycle rape is characterized in that the method adopts the fast-cycle rape as a donor to carry out mutagenesis treatment, and specifically comprises the following steps:

9. The method for preparing functional gene mutants based on fast cycle rape as claimed in claim 8, wherein the mutagenesis step in the step (2) comprises chemical mutagenesis and/or physical mutagenesis.

10. The method for preparing rape gene mutants based on fast cycle rape as claimed in claim 8, wherein the culture conditions in the steps (3), (4) and (5) are controlled as follows: the temperature was 22 ℃ and the light was 16 hours light/8 hours dark.