CN116376725A

CN116376725A - Mutant Aspergillus niger strains and uses thereof

Info

Publication number: CN116376725A
Application number: CN202111598184.2A
Authority: CN
Inventors: 吴伟; 孙佳楠; 戴小军; 牛其文
Original assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Current assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Priority date: 2021-12-24
Filing date: 2021-12-24
Publication date: 2023-07-04

Abstract

The present invention relates to mutant Aspergillus niger strains and uses thereof. In particular, the invention relates to mutant Aspergillus nigerAspergillus niger) A strain which is an auxotrophic strain for orotate phosphoribosyl transferase and which has an increased productivity of endogenous enzymes, preferably lysophospholipase, relative to an unmutated strain. The invention also relates to various applications of the strain.

Description

Mutant Aspergillus niger strains and uses thereof

Technical Field

The invention relates to the field of microorganisms, in particular to a mutant aspergillus niger strain, a recombinant strain obtained by adopting the strain, a biocatalyst and the like, and a method for producing exogenous proteins by using the strain.

Background

Aspergillus nigerAspergillus niger ) The fungus belongs to the common species of ascomycotina, costules and aspergillus, is also the most common filamentous fungus in nature, and is widely distributed in plant products, grains and soil. The conidiophore is black brown and radial, the spherical top sac has different lengths, developed hyphae and multiple branches. Aspergillus niger can grow rapidly by degrading organic matter in nature and absorbing nutrients therein. Aspergillus niger is listed as grade GRAS (Generally Regards As Safe) by the U.S. Food and Drug Administration (FDA) and is approved by the world health organization as a very popular species for use in filamentous fungi. Aspergillus niger is an important industrial strain for its ability to produce enzyme preparations and organic acids.

Aspergillus niger has high protein secretion and expression capacity. The Aspergillus niger expressed exogenous protein has the characteristics of large expression quantity, high extracellular secretion rate, close to higher eukaryotic cells of a protein molecular folding and modifying system and the like, and the expressed exogenous protein has natural activity. In addition, aspergillus niger can undergo various post-translational processes such as cleavage by glycosylation modified proteases, disulfide bond formation, etc. Thus, the use of Aspergillus niger as an expression strain for the expression of both homologous and heterologous proteins is increasingly gaining importance. Commercial enzyme preparations currently produced using Aspergillus niger include amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, etc., which are used in the industries of food, washing, textile, paper making, etc., and the heterologous proteins expressed by the enzyme preparations include lysozyme, interleukin-6, human lactoferrin, chymosin, thaumatin, lipase, etc.

The enzyme preparation applied to food in China must meet the national standard GB2760 of the people's republic of China-national standard of food\food additive use standard, wherein the lysophospholipase (of Aspergillus niger origin) for the heterologous expression of food meeting the regulations can only be expressed by Aspergillus niger in a heterologous way.

Thus, there remains a need in the art for Aspergillus niger strains capable of efficiently expressing various proteins, in particular lysophospholipase for food use.

Disclosure of Invention

The invention uses Aspergillus niger CICC2243 as an original strain to construct a whey acid phosphoribosyl transferase auxotroph strain (pyrE) ^- ) The strain is screened by ARTP mutagenesis, and the enzyme activity of the self lysophospholipase (LPL) is improved by 10.8 times on a lysophospholipase screening plate added with uracil, wherein the precipitation circle of the strain is obviously enlarged compared with that of the strain from which the strain is mutagenized. Recombinant expression of lysophospholipase LPL shows that the expression capacity is obviously improved by 112% compared with the original strain. The strain can be used for high-efficiency heterologous expression of various proteins, in particular to lysophospholipase for food.

In particular, the present invention relates to the following aspects.

In one aspect, the invention relates to a mutant Aspergillus nigerAspergillus niger ) A strain which is an auxotrophic strain for orotate phosphoribosyl transferase and which has increased productivity of an endogenous enzyme, such as lysophospholipase, relative to an unmutated strain. For example, it can be increased by a factor of 10 to 15, for example by a factor of 10 to 12, in particular by a factor of 10.8.

In the present invention, the term "endogenous enzyme" refers to a mutated Aspergillus niger @Aspergillus niger ) Enzymes expressed by the strain itself, for example, include, but are not limited to, mutant lysophospholipase expressed by the A.niger strain itself.

In one embodiment, the mutant A.niger orotate phosphoribosyl transferase of the invention lacks nucleotide TT at positions 64 and 65 of the pyrE gene.

In one embodiment, the mutant Aspergillus niger strain of the invention has a collection number of CGMCC No.40011.

In addition to its own endogenous enzymes, the mutant A.niger strains of the invention are capable of high-efficiency expression of heterologous proteins. The mutant Aspergillus niger strains of the invention may be used for expressing a wide range of heterologous proteins, such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc. In particular, the mutant Aspergillus niger strains of the invention may have an increased protein expression level of more than 100%, such as 100% to 150%, in particular 100% to 120%, more in particular 100% to 112% compared to the starting strain when recombinant lysophospholipase LPL is expressed. Therefore, the strain has obvious practicability of efficiently expressing the heterologous protein.

In another aspect, the present invention relates to a recombinant A.niger strain obtained by introducing a gene encoding a foreign protein into the above-mentioned mutated A.niger strain. In one embodiment, the exogenous protein is an enzyme and other proteins, such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, and the like, in particular lysophospholipase.

In another aspect, the present invention relates to a method for producing a protein of interest, comprising introducing a gene encoding said protein of interest into a mutant A.niger strain as described above, and culturing said strain to produce the protein of interest. Alternatively, it comprises culturing the recombinant A.niger strain described above to produce the protein of interest. In one embodiment, the exogenous protein is an enzyme and other proteins, such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, and the like, in particular lysophospholipase.

In another aspect, the invention relates to a biocatalyst comprising the mutated A.niger strain described above, into which a gene encoding a foreign protein, such as an enzyme and other proteins, e.g.amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, chymosin, thaumatin, lipase etc., in particular lysophospholipase, is introduced.

In another aspect, the invention relates to a foreign protein produced by the strain described above. The exogenous proteins are enzymes and other proteins such as amylase, glucose oxidase, catalase, cellulase, pectinase, protease, phytase, xylanase, lysozyme, interleukin-6, human lactoferrin, bovine chymosin, thaumatin, lipase, etc., in particular lysophospholipase. The exogenous protein can be used in food, preferably an enzyme for food, more preferably a lysophospholipase for food. The invention also relates to recombinant microbial cells into which the intracellular components derived from the mutated A.niger strains described above have been introduced. After the strain of the present invention is obtained, its intracellular components may be isolated by conventional techniques and introduced into other microorganisms. Recombinant microbial cells incorporating the components have excellent properties of the strains of the invention. In the present invention, the term "intra-bacterial component" refers to the sum of all genetic material of an organism, including, in particular, but not limited to: coding DNA and non-coding DNA, mitochondrial DNA.

In particular, the mutant A.niger strains of the invention can be used to express exogenous proteins. After the mutant Aspergillus niger of the present invention is obtained, a conventional expression vector may be introduced therein for expressing a foreign protein. For example, the expression vector may include a promoter and a terminator, and a gene encoding a foreign protein may be inserted between the promoter and the terminator with multiple cloning sites. One or more copies of the enhancer may be included in the promoter. A number of commercial vectors can be used for expression of the foreign proteins in the mutant A.niger strains of the invention.

When expressing foreign proteins that are not of Aspergillus niger origin, the codons of certain species may be rare codons in Aspergillus niger. Therefore, when the expression vector is introduced, the codon optimization of the Aspergillus niger suitable for the invention can be performed on the gene encoding the exogenous protein, thereby increasing the expression quantity.

The Aspergillus niger of the present invention can express a variety of foreign proteins, including food enzymes such as food lipases, pharmaceutical proteins, various enzymes derived from plants, animals and bacteria, membrane receptor proteins, prosthetic group-containing proteins, proteins useful for studying crystal structures, and the like. The aspergillus niger expressing the exogenous enzyme component of the present invention can also use whole cells as biocatalysts.

Drawings

FIG. 1 is a schematic diagram of an LPL gene expression vector constructed in accordance with the present invention.

FIG. 2 is AN AN19E back-filling transformation plate.

FIG. 3 is a plate diagram of AN 19E-complemented transformant lysophospholipase LPL activity screening.

FIG. 4 is a colony chart of the mutant strain AN19E-13 in LPL selection medium.

FIG. 5 is a comparison of the enzyme activities of mutant strain AN19E-13 of the invention and endogenous lysophospholipase LPL expressed by the starting strain AN19E.

FIG. 6 is a comparison of the enzymatic activities of mutant strain AN19E-13 of the invention and lysophospholipase LPL expressed recombinantly by starting strains CICC2243 and AN19E.

FIG. 7 is a protein electrophoresis pattern of lysophospholipase LPL recombinantly expressed by mutant strain AN19E-13 of the invention with starting strains CICC2243 and AN19E.

Description of the preservation

The strain AN19E-13 of the invention is preserved in China general microbiological culture collection center (CGMCC) for 12 months and 20 days in 2021, and is classified and named as Aspergillus niger at the national institute of microbiology, national academy of sciences 3, national institute of sciences 1, chaog-1, beijing, and ChaoyangAspergillus niger )。

Detailed Description

The initial strain Aspergillus niger of the invention is purchased from China industry microbiological culture collection center (CICC for short), and the strain deposit number is CICC2243. The initial strain is coated on a MM solid culture medium plate to culture spores, after the spores are eluted, ultraviolet mutagenesis is carried out, and finally, 5-fluoroorotic acid and uracil are added on a screening plate to carry out screening, so that the orotic acid phosphoribosyl transferase auxotroph strain AN19E is obtained.

Then screening a strain AN19E-13 by utilizing AN ARTP mutagenesis mode. In the method, the precipitation circle of AN19E-13 is obviously enlarged compared with that of a mutagenesis starting strain AN19E on a lysophospholipase screening plate added with uracil. The detection shows that the AN19E-13 has AN enzyme activity of self lysophospholipase (LPL) 10.8 times higher than that of the AN19E of the original strain.

Heterologous recombinant expression of lysophospholipase (LPL) was attempted in A.niger strain AN19E-13, which was found to have AN increased capacity for LPL expression of 112%. Thus proving that the recombinant protein has obvious advantages as a protein expression system, in particular as an expression system of lysophospholipase for food.

In the present invention, the term "ARTP" is an abbreviation for atmospheric pressure room temperature plasma (Atmospheric and Room Temperature Plasma), specifically, a plasma jet having a high concentration of active particles (including helium atoms, oxygen atoms, nitrogen atoms, OH radicals, etc. in an excited state) capable of generating a temperature between 25 to 40 ℃ at atmospheric pressure. The term ARTP mutagenesis, namely strain mutagenesis by utilizing the normal pressure room temperature plasma technology, specifically, a normal pressure room temperature plasma source adopting helium as working gas contains various chemical active particle components such as OH, nitrogen molecule di-positive system, nitrogen molecule-negative system, excited helium atom, hydrogen atom, oxygen atom and the like. The active energy particles enriched in ARTP cause damage to genetic material of strains/plants/cells, etc., and induce biological cells to initiate SOS repair mechanisms. SOS repair is a repair with high fault tolerance, so that various mismatch sites can be generated in the repair process, and finally stable inheritance is realized to form mutant strains. The intensity of SOS repair is strongly related to the extent to which DNA is damaged.

Example 1: acquisition of orotate phosphoribosyl transferase auxotroph Aspergillus niger Strain

Spores of Aspergillus niger CICC2243 strain were inoculated and spread onto MM solid medium (1% glucose, 0.15% KH) ₂ PO ₄ ，0.6% NaNO ₃ ，0.05% KCl，0.05% MgSO ₄ 2% agar powder), at 28 ℃, and standing for 5 days to obtain aspergillus niger spores. Fresh Aspergillus niger CICC2243 spores were eluted with spore wash (0.9% NaCl,0.05% Tween 80), by Miracloth (Calbiochem, cat#475885 Filtering to obtain spore suspension, washing thallus with sterile water for 2 times and adjusting to 1×10 ⁷ And each mL. 2mL of spore suspension is evenly dispersed on the surface layer of a culture dish, the culture dish is placed under an ultra-clean workbench ultraviolet lamp to be irradiated for 90s, 100 mu L of the spore suspension is coated on an MM solid culture medium added with 0.3% Uracil (Uracil) and 1mg/mL 5-fluoroorotic acid (5-FOA), and the spore suspension is cultivated at 28 ℃ in a dark place (the whole process is operated under red light to prevent reverse mutation) for 7 days. Transferring the single colony growing on the MM solid culture medium in the previous step to the MM solid culture medium and the MM-Uracil solid culture medium, and picking the strain which can only grow on the MM-Uracil solid culture medium, thereby obtaining the orotate phosphoribosyl transferase (pyrE) auxotroph Aspergillus niger AN19E strain. By sequencing the pyrE gene of A.niger AN19E strain it was found that the deletion of nucleotides 64 and 65 from TT resulted in the inactivation of the pyrE gene.

Example 2: construction of LPL expression vectors

The exogenous Aspergillus niger lysophospholipase (LPL) gene sequence is as follows:

nucleic acid sequence:

gctcccgcacctgctccgatgcagcgtagaggtaagacacacttaccaatttgcagaacacccgctaacctactcagacatctcctctaccgtcttggacaatatcgacctcttcgcccaatacagtgcagcagcttactgctcctcgaacatcgagtccaccggcacgactctgacctgcgacgtaggcaattgccctctcgtcgaggcagccggtgccacgaccatcgatgagtttgacgagtaagccaatccaaccccaacatcttcccccacttggcatccagctcacacccccatagcaccagcagctacggcgacccgactgggttcatcgccgttgacccaacgaacgagttaattgttctgtctttccggggtagttccgacctctcgaactggattgccgacctagacttcggcctcacctccgtaagcagcatctgtgatggctgtgagatgcacaagggcttctacgaggcctgggaagtcatcgcggacaccatcactagcaaggtggaggctgctgtctccagctatccggactacaccctcgtgttcactggacacagctacggcgctgcattggcggctgtcgcggccaccgtgctccgcaacgccggatacactcttgacctggtaagttcctactcttttatccttgtaacgttcccccatcattcggatggtctactaacacaatcaacagtacaacttcggccagccccgtattggcaacctcgccttagccgactatatcaccggccaaaatatgggcagcaactaccgcgtcacgcacaccgatgacatcgtgcctaagctgcctccggagctgctgggctaccaccacttcagcccggagtactggatcaccagcggtaatgatgtgacggtgactacgtcggacgtgaccgaggtcgtgggggtggattcgacggctgggaatgacggcacgctgcttgacagtacgactgcccatcggtggtacacgatctacattagtgaatgctcgtag (SEQ ID NO:1)。

amino acid sequence:

APAPAPMQRRDISSTVLDNIDLFAQYSAAAYCSSNIESTGTTLTCDVGNCPLVEAAGATTIDEFDDTSSYGDPTGFIAVDPTNELIVLSFRGSSDLSNWIADLDFGLTSVSSICDGCEMHKGFYEAWEVIADTITSKVEAAVSSYPDYTLVFTGHSYGAALAAVAATVLRNAGYTLDLYNFGQPRIGNLALADYITGQNMGSNYRVTHTDDIVPKLPPELLGYHHFSPEYWITSGNDVTVTTSDVTEVVGVDSTAGNDGTLLDSTTAHRWYTIYISECS(SEQ ID NO:2)。

for specific procedures, reference is made to the method of molecular cloning Experimental guidelines (third edition, new York, cold spring harbor laboratory Press, new York: cold Spring Harbor Laboratory Press, 1989), to construct the LPL gene expression vector pANE-LPL, as shown in FIG. 1, by the following procedure:

the LPL gene (SEQ ID NO:1, with the Aspergillus oryzae alpha-amylase signal peptide (NCBI sequence number: XM_001821384.2,1-63 bp)) obtained from the total gene synthesis of the biological engineering (Shanghai) Co., ltd was inserted into an expression cassette containing the Aspergillus oryzae enolase promoter (NCBI sequence number: D63941.1, 215-734bp; containing 12 copies of the enhancer sequence (gtcgtgtcgggcatttatcgggggatggaccaatcagcgtagg, SEQ ID NO: 3) and the Aspergillus niger glucoamylase terminator (NCBI sequence number: AF214480.1, wherein the terminator sequence portion) with SphI and HindIII cleavage sites, the entire expression cassette was inserted into the multiple cloning site of cloning vector pSP72 with BglII and XhoI, and finally the Aspergillus niger-derived pyrE expression gene (NCBI sequence number: AY 840014.1) was inserted into the vector with XhoI cleavage sites, thereby constructing the LPL gene expression vector pANE-LPL.

Example 3: aspergillus niger AN19E anaplerosis experiment

Fresh A.niger AN19E spores were eluted with spore wash, prepared as spore suspension by Miracloth filtration and adjusted to 1X 10 ⁷ And each mL. 1mL of spore suspension was inoculated into mycelium culture medium (2% tryptone, 1% yeast extract, 2% glucose, 0.3% uracil), cultured at 28℃and 180rpm for 40 hours, and the grown mycelium was collected by filtration with a sterile Miracloth.

The collected mycelia were stabilized with sterilized osmotically stabilized agent (0.6M MgSO) ₄ ，10mM NaH ₂ PO ₄ Ph=5.8) was washed three times and pressed dry. The mycelia were transferred to a 100mL Erlenmeyer flask, and each 0.8g of mycelia was resuspended in 20mL of an enzymatic hydrolysate (1% lyase, 1% cellulase, 0.1% snail enzyme in an osmotically stable formulation, and sterilized by filtration with a 0.22 μm microporous filter), and subjected to enzymatic hydrolysis at 30℃and 90 rpm for 60-90min. The hydrolyzed protoplast mixture was filtered with Miracloth, the filtrate was collected, centrifuged at 4℃for 10min at 1000g, the protoplast pellet was resuspended in 5mL of pre-chilled 1.0mol/L sorbitol solution, centrifuged at 800g at 4℃for 10min and the supernatant was discarded. Re-use of pre-chilled STC solution (1.0M sorbitol, 50mM CaCl) ₂ 50mM Tris-HCl, pH=7.5) protoplasts were adjusted to 1X 10 ⁷ And (3) each mL, and carrying out ice bath for later use.

To 200. Mu.L of the protoplast suspension, 10. Mu.L of the LPL expression vector pANE-LPL was added at a concentration of 1. Mu.g/. Mu.L, and 50. Mu.L of PTC solution (40% PEG4000, 50mM CaCl) was further added ₂ 50mM Tris-HCl, pH=7.5), and ice-bath for 30min after mixing. Adding 0.2mL of PTC solution, uniformly mixing, adding 0.8mL of PTC solution, uniformly mixing, and keeping at room temperature for 30min.

Spreading the above mixture on regeneration medium (1% glucose, 0.6% NaNO) ₃ ，0.15% KH ₂ PO ₄ ，0.05% KCl，0.05% MgSO ₄ ，0.001% FeSO ₄ 1M sucrose, 2% agar powder), at 28℃for 7 days, until colonies grow out.

Colonies grown on the plates were transferred to lysophospholipase LPL screening medium and incubated at 28℃for 3 days.

The LPL screening medium composition was as follows:

and (3) solution A: 2% maltose, 1.34% YNB, citric acid 6.88g/500 mL, sodium citrate 5.07g/500mL,5mM CaCl2 was added to 200 mL.

And (2) liquid B: adding 1% lecithin into water, emulsifying 2% agarose with 200ml homogenizer, adding 0.02% Triton-x-100 into water to 300ml

After sterilization, A, B solution was mixed and poured into a plate.

Transformation shows that Aspergillus niger AN19E can well realize pyrE gene back-filling experiments, and transformants show the activity of lysophospholipase LPL in a lysophospholipase LPL screening medium, see FIG. 2 and FIG. 3, and further prove that AN Aspergillus niger expression system using orotate phosphoribosyl transferase auxotroph Aspergillus niger AN19E as a host is successfully established.

Example 4: aspergillus niger AN19E ARTP mutagenesis experiment

Fresh A.niger AN19E spores were eluted with spore wash, prepared as spore suspension by Miracloth filtration and adjusted to 2X 10 ⁷ And each mL. After mixing the spore suspension with 10% glycerol 1:1, 10. Mu.L of the mixture was applied to an iron sheet and treated with an ARTP instrument (model: ARTP-M, instrument model: qingshan Biotechnology Co., ltd.) for 100s, instrument parameters were set: the radio frequency power range is 120W, the helium quantity is 10 SLM (99.999 percent of high purity helium), and the irradiation distance is 2mm.

After the treatment, the iron sheet is taken down and put into a centrifuge tube filled with 1mL of sterile water, and then repeatedly sucked by a gun head, so that thalli on the iron sheet are washed down, diluted to about 100 colony/screening plate, finally coated on a lysophospholipase screening plate added with uracil, and placed in a 30 ℃ incubator for 3d culture.

Example 5: screening of mutagenized Strain

The spores obtained by mutagenesis in example 4 were spread on a lysophospholipase screening plate to which uracil was added for screening, and a strain having a significantly enlarged strain precipitation circle was found, see FIG. 4, designated AN19E-13.

The strain AN19E-13 with obviously enlarged precipitation ring and the original strain AN19E are subjected to shaking flask fermentation, and the fermentation medium (2% maltose, 1.34% YNB,1.38% citric acid, 1% sodium citrate, 5mM CaCl) ₂ 1% lecithin), 115 ℃, and autoclaving for 15min under fermentation conditions of 28 ℃,200rpm,5d, inoculum size of 1×10 ⁷ The lysophospholipase LPL activity was determined from individual spores/50 mL.

Lysophospholipase LPL activity assay is as follows:

9mL of substrate: 5mL of 1% soybean phospholipid, 1mL of 20% Triton X-100,2.5mL 0.1M pH4.0 citrate-sodium citrate buffer.

10uL of a properly diluted enzyme solution and 90uL of a substrate are reacted for 10min at 50 ℃, inactivated for 5min at 95 ℃, centrifuged at 7000rpm for 5min, 1uL of supernatant is taken and added with reagent A80 uL in NEFA kit (Wako: 294-63601), reacted for 10min at 37 ℃, and added with reagent B160 uL for 10min. The absorbance at 550nm was measured.

The results of the enzyme activity measurement are shown in FIG. 5.

The results showed that the lysophospholipase LPL activity expressed by the strain AN19E-13 itself, which had a significantly larger precipitation circle, was increased by 10.8 times as compared with that of the starting strain AN19E (98U/mL) by 1058U/mL.

The strain AN19E-13 is preserved in China general microbiological culture collection center (CGMCC) for 12 months and 20 days in 2021, and the collection number is CGMCC No.40011, and is classified as Aspergillus niger @ 4Aspergillus niger ) 。

Example 6: investigation of the expression Capacity of Aspergillus niger AN19E-13

Transformation procedure of A.niger AN19E-13 was the same as in example 3, and the LPL expression vector pANE-LPL was transformed into the strain for recombinant expression.

Using the A.niger AN19E transformant of example 3 as a control, and pANE-LPL was transformed into A.niger CICC2243, transformation selection was performed using p3SR2 (BCCM/LMBP: accession number: 2363) containing the acetamidase (amdS) gene, since pANE-LPL could not use pyrE as a selection marker. Regeneration medium requires removal of sodium nitrate and addition of 15mM acetamide and 20mM cesium chloride.

40 transformants were selected for each of the three transformants and subjected to shaking fermentation in a fermentation medium (2% glucose, 15% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% TSB,0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, trace elements), at 115℃under high pressure for 15min at 28℃at 200rpm for 8d at an inoculum size of 1X 10) ⁷ The lysophospholipase LPL activity was determined from individual spores/50 mL.

Lysophospholipase LPL activity assay see example 5.

The results of the enzyme activity measurement are shown in FIG. 6.

The results showed that the recombinant expressed lysophospholipase LPL of AN19E-13 had AN enzymatic activity of 25920U/mL, which was increased by 112% and 100% compared to the starting strains CICC2243 (12230U/mL) and AN19E (12990U/mL), respectively.

Polyacrylamide gel electrophoresis analysis: the supernatant was filtered through a 0.22 μm filter membrane, and an equal amount of the supernatant was concentrated to the same volume using a Millipore 10kDa ultrafiltration concentration tank, and then the same volume of concentrated enzyme solution was taken for polyacrylamide gel electrophoresis analysis. The result of electrophoresis is shown in FIG. 7.

The results of the protein electrophoretogram showed that the LPL protein band concentration of AN19E-13 transformants was significantly higher than that of the control.

Sequence listing

<110> Feng Yi (Shanghai) Biotechnology research and development center Co., ltd

<120> mutant Aspergillus niger strain and use thereof

<130> CPCH2162862N

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 1015

<212> DNA

<213> Aspergillus niger (Aspergillus niger)

<400> 1

gctcccgcac ctgctccgat gcagcgtaga ggtaagacac acttaccaat ttgcagaaca 60

cccgctaacc tactcagaca tctcctctac cgtcttggac aatatcgacc tcttcgccca 120

atacagtgca gcagcttact gctcctcgaa catcgagtcc accggcacga ctctgacctg 180

cgacgtaggc aattgccctc tcgtcgaggc agccggtgcc acgaccatcg atgagtttga 240

cgagtaagcc aatccaaccc caacatcttc ccccacttgg catccagctc acacccccat 300

agcaccagca gctacggcga cccgactggg ttcatcgccg ttgacccaac gaacgagtta 360

attgttctgt ctttccgggg tagttccgac ctctcgaact ggattgccga cctagacttc 420

ggcctcacct ccgtaagcag catctgtgat ggctgtgaga tgcacaaggg cttctacgag 480

gcctgggaag tcatcgcgga caccatcact agcaaggtgg aggctgctgt ctccagctat 540

ccggactaca ccctcgtgtt cactggacac agctacggcg ctgcattggc ggctgtcgcg 600

gccaccgtgc tccgcaacgc cggatacact cttgacctgg taagttccta ctcttttatc 660

cttgtaacgt tcccccatca ttcggatggt ctactaacac aatcaacagt acaacttcgg 720

ccagccccgt attggcaacc tcgccttagc cgactatatc accggccaaa atatgggcag 780

caactaccgc gtcacgcaca ccgatgacat cgtgcctaag ctgcctccgg agctgctggg 840

ctaccaccac ttcagcccgg agtactggat caccagcggt aatgatgtga cggtgactac 900

gtcggacgtg accgaggtcg tgggggtgga ttcgacggct gggaatgacg gcacgctgct 960

tgacagtacg actgcccatc ggtggtacac gatctacatt agtgaatgct cgtag 1015

<210> 2

<211> 279

<212> PRT

<213> Aspergillus niger

<400> 2

Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser Ser Thr Val

1 5 10 15

Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala Ala Tyr Cys

20 25 30

Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys Asp Val Gly

35 40 45

Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile Asp Glu Phe

50 55 60

Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile Ala Val Asp

65 70 75 80

Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser Ser Asp Leu

85 90 95

Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser Val Ser Ser

100 105 110

Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu Ala Trp Glu

115 120 125

Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala Val Ser Ser

130 135 140

Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr Gly Ala Ala

145 150 155 160

Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly Tyr Thr Leu

165 170 175

Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu Ala Leu Ala

180 185 190

Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser Asn Tyr Arg Val Thr His

195 200 205

Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu Gly Tyr His

210 215 220

His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp Val Thr Val

225 230 235 240

Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser Thr Ala Gly

245 250 255

Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg Trp Tyr Thr

260 265 270

Ile Tyr Ile Ser Glu Cys Ser

275

<210> 3

<211> 43

<212> DNA

<213> artificial sequence

<220>

<223> enhancer

<400> 3

gtcgtgtcgg gcatttatcg ggggatggac caatcagcgt agg 43

Claims

1. Aspergillus niger useful for expressing mutations in lysophospholipase for foodAspergillus niger ) A strain which is an auxotrophic strain for orotate phosphoribosyl transferase and which has an increased productivity of endogenous enzymes, preferably lysophospholipase, relative to an unmutated strain.

2. The mutant Aspergillus niger of claim 1Aspergillus niger ) A strain having a deletion of nucleotide TT at positions 64 and 65 of the orotate phosphoribosyl transferase pyrE gene.

3. The collection number of the mutant Aspergillus niger strain is CGMCC NO.40011.

4. Recombinant aspergillus niger strain obtained by introducing a gene encoding a foreign protein into the strain according to any of claims 1-3.

5. The recombinant aspergillus niger strain according to claim 4, wherein the exogenous protein is an enzyme, preferably lysophospholipase.

6. A method for producing a protein of interest, comprising introducing a gene encoding the protein of interest into the strain of any one of claims 1 to 3, and culturing the strain to produce the protein of interest, or culturing the recombinant aspergillus niger strain of any one of claims 4 to 5 to produce the protein of interest.

7. The method of claim 6, wherein the protein of interest is an enzyme, preferably lysophospholipase.

8. A biocatalyst comprising the mutated aspergillus niger strain according to any of claims 1-3, into which strain a gene encoding an enzyme, preferably lysophospholipase, has been introduced.

9. An exogenous protein produced by the strain of any one of claims 1-5, preferably an enzyme, more preferably lysophospholipase; and/or the foreign protein is preferably useful in food, preferably a food enzyme, more preferably a food lysophospholipase.

10. A recombinant microbial cell into which an intra-bacterial component derived from the strain of any one of claims 1-3 has been introduced.