CN116370602A - Application of small molecular peptide in preparation of anti-skin-aging or anti-dermatitis composition product - Google Patents

Abstract

The invention provides application of small molecular peptide NSM or a derivative thereof in preparing a composition product for resisting skin aging and/or dermatitis, and an external preparation containing the small molecular peptide NSM or the derivative thereof. The invention discovers for the first time that the small molecular peptide NSM or the derivative thereof can be used for resisting skin aging signs, can be used for treating dermatitis, especially senile sterile dermatitis, and has a great application prospect in the field of pharmacy or cosmetics.

Description

Application of small molecular peptide in preparation of anti-skin-aging or anti-dermatitis composition product

Technical Field

The invention relates to the technical field of daily cosmetics, in particular to application of a small molecular peptide or a derivative thereof in preparing a composition product for resisting skin aging or dermatitis and an external preparation containing the small molecular peptide or the derivative thereof.

Background

Human skin is divided into two parts, epidermis and dermis. The epidermis is on the skin surface and can be divided into a horny layer and a hair growing layer; the keratinized cells form horny layer, and become dander after falling off; the germinal layer cells are continuously divided, and can supplement the exfoliated horny layer. The dermis provides firm support for the epidermis, which is also a nourishing element of the epidermis; the dermis is mainly composed of fibroblasts and extracellular matrix composed mainly of five substances of collagen, non-collagen, elastin, proteoglycan and aminoglycan, which are synthesized by fibroblasts, among which elastin is a protein that plays an important role in the elasticity and softness of the skin.

The aging mechanism of the skin is complex and is a result of various factors such as oxidative stress, ultraviolet injury, glycosylation, and disruption of the balance of the matrix metalloproteinase system.

The skin aging is also characterized in various ways, mainly by the destruction of the skin structure and function, which is manifested by degradation of collagen and elastin and by abnormalities in the epidermal structure. Aging of the skin causes a series of problems such as dryness, wrinkles, sagging, color spots, etc.

Matrix metalloproteinases are a family of endopeptidases with the ability to degrade the extracellular matrix (ECM), including collagenases and elastases, etc., whose biological activity depends on zinc ions; wherein, elastase MMP-3 can degrade II, III, IV, IX and X type collagen, proteoglycan, fibronectin, laminin and elastin, and activate the activities of other matrix metalloproteinases such as MMP-1, MMP-7 and MMP-9; therefore, by inhibiting the activity of elastase, the degradation of structural proteins in the skin can be effectively reduced, and the anoikis of fibroblasts is relieved, so that the purpose of skin aging resistance is achieved.

Skin aging is classified into endogenous aging (cellular programmed aging initiated by telomere shortening, etc.) and exogenous aging (such as extreme conditions of extreme cold, dryness, etc. and skin aging caused by ultraviolet injury, etc.). Modern medicine holds that excessive oxygen radicals in the body are one of the important factors that lead to skin aging; oxygen radicals are particularly chemically reactive and are prone to losing or gaining electrons, stabilizing themselves and turning other molecules into active radicals. The mechanism of oxygen radical generation in skin mainly includes the following two aspects: 1. the covalent bond is broken due to external high temperature, radiation, illumination and the like, so that exogenous free radicals are generated; 2. endogenous oxygen radicals produced during in vivo metabolism, such as chronic diseases, nutritional imbalance, endocrine dyscrasia, etc. The damage to the skin by oxygen radicals includes: under the action of oxygen free radicals, protein cells are fibrillated, so that skin loses elasticity and wrinkles are generated; the fat cells undergo peroxidation reaction to make the skin become dark and gradually form color spots; etc.

Aging resistance has been a long-standing focus of attention in the cosmetic industry, and delaying skin aging is one of the pursuit goals of most people. Therefore, the development of substances with anti-aging activity has great practical significance.

Senile dermatitis is generally senile skin itch, and most patients are middle-aged and elderly people, and the symptoms of senile dermatitis are mainly severe itching feeling of the whole body, can influence the sleep of the patients, and are particularly good for winter. Skin itch often occurs in the elderly due to combined actions of subcutaneous fat reduction, skin thinning, sebaceous gland secretion reduction and the like. Patients are particularly prone to induce this symptom after feeling cold and hot changes, and most of them first attack the lower limbs and gradually spread to the whole body. The disease has no skin symptoms just after onset, but the scratching feeling is more severe, so the patient is often accompanied with scratching secondary skin damage such as lichenification, scratch, eczema and the like. The severity of the disease and the degree of pruritus are subject to individual differences, most of the disease is paroxysmal pruritus, and partial severe patients can have persistent severe itching feeling and cannot tolerate the severe itching.

However, there is currently a lack of effective treatments for senile dermatitis.

Disclosure of Invention

Object of the Invention

The invention aims at providing the application of a small molecular peptide or a derivative thereof in preparing a composition product for resisting skin aging and/or dermatitis, and an external preparation based on the small molecular peptide or the derivative thereof.

Solution scheme

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides the use of a small molecule peptide or derivative thereof comprising or consisting of the amino acid sequence: asn-Ser-Met (hereinafter abbreviated as "NSM").

In one possible embodiment, the derivative of the small molecule peptide is a palmitoylated small molecule peptide.

In another possible embodiment, the derivative of the small molecule peptide is a small molecule peptide having polyarginine at its carboxy terminus, preferably having 5-8 arginines, more preferably having 6-7 arginines, for example, a small molecule peptide having 7 arginines at its carboxy terminus.

In particular embodiments, the composition product is manufactured for application to skin of a pharmaceutically or cosmeceutically effective amount of a small molecule peptide or derivative thereof;

preferably, the small molecule peptide or derivative thereof comprises 0.002% -0.006%, preferably 0.003% -0.005%, most preferably 0.004% of the total weight of the composition product. For example, the small molecule peptide or derivative thereof may comprise 0.002%, 0.0025%, 0.003%, 0.0035%, 0.004%, 0.0045%, 0.005%, 0.0055%, 0.006% of the total weight of the composition product.

The skin aging is, possibly, one or more selected from the group consisting of: skin aging caused by DNA damage, radiation skin premature senility, natural skin aging and skin photoaging.

The dermatitis is, possibly, senile dermatitis, preferably senile aseptic dermatitis.

Possibly, the anti-skin aging comprises at least one of the following:

1) Reducing or preventing the appearance of fine lines or wrinkles in the skin;

2) Enhancing skin elasticity;

3) Improving skin fineness and/or firmness.

The anti-dermatitis is, possibly, an elimination or alleviation of the symptoms of dermatitis.

In the above use, the mechanism by which the small molecule peptide or derivative thereof is used to combat skin aging includes one or more of the following:

1) Inhibiting expression of a senescence-associated secretion phenotype;

2) Increasing the collagen and/or elastin content in the skin; and

3) The arrangement of collagen fibers and/or elastic fibers in the skin is more compact and regular.

Senescence-associated secretory phenotypes (i.e., SASP), which refers to protein factors secreted by senescent cells, including inflammatory factors, chemokines, growth factors, matrix metalloproteinases, and the like; SASP is closely related to aging-related diseases, wherein elevated matrix metalloproteinase can cause increased degradation of collagen fibers and elastic fibers in dermis of skin, and allow the skin to lose elasticity and relax and collapse; in addition, chronic aseptic inflammation in elderly is also closely related to SASP, such as cytokines and chemokines IL-1β, IL-8, VEGF, IL-6, CXCL1, CCL2, etc., all involved in the formation of chronic dermatitis in elderly.

In the present invention, the small molecule peptide or its derivative can inhibit the expression of SASP, in particular, for example, matrix metalloproteinase MMP3, and cytokines and chemokines IL-1 beta, IL-6, IL-8, etc., thus improving skin elasticity to some extent and alleviating the symptoms of senile chronic dermatitis.

In particular embodiments, the composition product is a normal cosmetic, cosmeceutical or pharmaceutical product.

Preferably, the composition product is in a topical dosage form, including but not limited to the following topical dosage forms: aqueous solution, emulsion, ointment, cream, gel, powder and oil.

In a preferred embodiment, the composition product comprises:

1) The small molecule peptide or derivative thereof;

2) Pharmaceutically or cosmetically acceptable excipients, preferably selected from one or more of carriers, excipients, solvents and buffers; the method comprises the steps of,

optionally, 3) other active agents.

Further preferably, the other active agents include any one or more of antioxidants, cellular active agents, moisturizing agents, anti-aging agents, and anti-dermatitis agents.

In a second aspect, the present invention provides an external preparation comprising:

i) A small molecule peptide or derivative thereof, and

ii) a matrix;

wherein the small molecule peptide comprises or consists of the following amino acid sequence: asn-Ser-Met; and, the matrix comprises: squalane, an emulsifier, propylene glycol, low molecular hyaluronic acid or a salt thereof, high molecular hyaluronic acid or a salt thereof and water.

In a possible embodiment, the derivative of the small molecule peptide is a palmitoylated small molecule peptide, or a small molecule peptide having polyarginine at its carboxy terminus, preferably having 5-8 arginines, more preferably having 6-7 arginines;

in a possible embodiment, the molecular weight of the low molecular hyaluronic acid or salt thereof is between 10kDa and 500kDa, preferably between 100kDa and 200kDa;

in a possible embodiment, the molecular weight of the polymeric hyaluronic acid or salt thereof is between 2000kDa and 10000kDa, preferably between 5000kDa and 6000kDa.

In a possible embodiment, the emulsifier is a commercially available 305 emulsifier whose composition is polyacrylamide (and) fatty alcohol polyoxyethylene ether, for example, supplied by the company, new materials, inc., ganghi, guangzhou.

Preferably, the concentration of the small molecule peptide or derivative thereof in the external preparation is 20 to 60. Mu.g/mL, preferably 30 to 50. Mu.g/mL, and most preferably 40. Mu.g/mL; for example, the concentration of the small molecule peptide or derivative thereof in the external preparation may be 20, 25, 30, 35, 40, 45, 50, 55, 60 μg/mL.

Preferably, the matrix comprises, in weight percent: 10% -15% of squalane, 1% -3% of 305 emulsifying agent, 1% -3% of propylene glycol, 8% -12% of low molecular hyaluronic acid or salt thereof (molecular weight is 10 kDa-500 kDa, preferably 100 kDa-200 kDa), 8% -12% of high molecular hyaluronic acid or salt thereof (molecular weight is 2000 kDa-10000 kDa, preferably 5000 kDa-6000 kDa) and the balance of water;

further preferably, the matrix comprises: 13% squalane, 2% 305% emulsifier, 2% propylene glycol, 10% low molecular hyaluronic acid or its salt (molecular weight 10 kDa-500 kDa, preferably 100 kDa-200 kDa), 10% high molecular hyaluronic acid or its salt (molecular weight 2000 kDa-10000 kDa, preferably 5000 kDa-6000 kDa), and the balance water.

In a third aspect, the present invention provides a method of combating skin ageing or treating dermatitis (in particular senile sterile dermatitis), the method comprising: administering to a subject in need thereof an effective amount of a small molecule peptide or derivative thereof or administering the external preparation of the second aspect as described above, wherein the small molecule peptide comprises or consists of the amino acid sequence: asn-Ser-Met.

In a possible embodiment, the derivative of the small molecule peptide is a palmitoylated small molecule peptide, or a small molecule peptide having polyarginine at its carboxy terminus, preferably having 5-8 arginines, more preferably having 6-7 arginines.

The term "effective amount" refers to an amount or dose of an active ingredient that provides a desired effect to a subject via single or multiple administrations of the active ingredient to the subject; an "effective amount" can be determined by the subject himself or herself or by a physician as an observation by a person skilled in the art by means of known techniques and in similar cases.

Advantageous effects

The inventors of the present application have found for the first time that the small molecule peptide NSM or a derivative thereof is useful against the signs of skin aging and for the treatment of dermatitis, in particular senile sterile dermatitis.

Specifically, the inventors have confirmed that the small molecule peptide NSM or a derivative thereof can significantly inhibit the expression of the aging-associated secretory phenotype SASP of the HDF cells (and thus can be used to enhance skin elasticity, alleviate dermatitis symptoms) and increase the collagen content in the aging cells or culture supernatants thereof by performing experiments on a radiation-induced aging skin fibroblast (HDF) model; in addition, experiments are carried out on a D-galactose-induced mice premature senility model, and the fact that the small molecular peptide NSM or derivatives thereof can remarkably improve the content of collagen fibers and elastic fibers in the skin of the premature senility mice and enable the arrangement of the collagen fibers and the elastic fibers in the skin of the premature senility mice to be more compact and regular is proved; in addition, the inventor also verifies the anti-dermatitis efficacy of the small molecule peptide NSM or the derivatives thereof through animal experiments; these results show that the small molecule peptide NSM or the derivative thereof can be used for resisting skin aging signs (including reducing or preventing appearance of fine lines or wrinkles of skin, enhancing skin elasticity, improving skin fineness and/or firmness), eliminating or relieving dermatitis symptoms (thereby being used for treating senile dermatitis), and has great application prospect in the pharmaceutical or cosmetic fields.

Drawings

One or more embodiments are illustrated by way of example and not limitation in the figures of the accompanying drawings. The word "exemplary" is used herein to mean "serving as an example, embodiment, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.

FIG. 1 shows the effect of the small molecule peptides NSM and their derivatives palmitoylation NSM and NSM-R-R-R-R-R-R-R (referred to as peptide 1, peptide 2, peptide 3, respectively) on the relative expression levels of mRNA of SASP-related genes (IL 1 beta, IL6, IL8, MMP 3) of radiation-induced aged skin fibroblasts (HDF), as described in example 1 of the present invention; wherein "Y" represents young HDF cells, "O" represents radiation-induced senescent HDF cells, "O+ peptide 1" represents senescent HDF cells treated with small molecule peptide NSM, "O+ peptide 2" represents senescent HDF cells treated with palmitoylated NSM, and "O+ peptide 3" represents senescent HDF cells treated with peptide NSM-R-R-R-R-R-R.

FIG. 2 shows the effect of the small molecule peptides NSM and its derivatives palmitoylated NSM and NSM-R-R-R-R-R-R-R (referred to as peptide 1, peptide 2, peptide 3, respectively) on collagen content in radiation-induced aged skin fibroblasts (HDF) and their culture supernatants as described in example 2 of the present invention; wherein, GAPDH is an internal reference protein, type I collagen (cell supernatant) is type I collagen in the HDF cell culture supernatant, and type I collagen (cell) is type I collagen in the HDF cell; and wherein "Young" means Young HDF cells and "IR" means radiation-induced senescent HDF cells; further, where NC is a young HDF cell (as a control), peptide 1, peptide 2, and peptide 3 are small molecule peptide NSM, derivative palmitoylated NSM, and NSM-R treated cells, respectively.

FIG. 3 shows the effect of the small molecule peptides NSM and its derivatives palmitoylation NSM and NSM-R-R-R-R-R-R-R (referred to as peptide 1, peptide 2, peptide 3, respectively) on collagen fiber, elastin fiber content and morphology and collagen biochemical index in D-galactose-induced premature aging mouse skin; wherein:

FIG. 3A shows the results of a masson staining of D-galactose-induced premature senility mouse skin sections showing collagen fibers in mouse skin, wherein peptide 1-R, peptide 2-R and peptide 3-R are respectively a cream treatment group containing peptides 1, 2 and 3, and NC1-L, NC2-L, NC-L is a corresponding control cream treatment group;

FIG. 3B is a statistical plot of collagen fiber content in the dermis layer of the skin of a mouse, wherein peptide 1-R, peptide 2-R and peptide 3-R are respectively a cream treatment group containing peptides 1, 2 and 3, and NC1-L, NC2-L, NC3-L is a corresponding control cream treatment group; the significance of the differences between each peptide treatment group and its corresponding control group is shown above the statistical plot, where P <0.05 represents P <0.01 and P <0.001;

FIG. 3C is an EVG staining result of a D-galactose-induced premature senility mouse skin section showing elastic fibers in the skin, wherein peptide 1-R, peptide 2-R and peptide 3-R are respectively a cream treatment group containing peptides 1, 2 and 3, and NC1-L, NC2-L, NC3-L is a corresponding control cream treatment group;

FIG. 3D is a statistical plot of the elastic fiber content in the dermis layer of the skin of a mouse, wherein peptide 1-R, peptide 2-R and peptide 3-R are respectively a cream treatment group containing peptides 1, 2 and 3, and NC1-L, NC2-L, NC3-L is a corresponding control cream treatment group; the significance of the differences between each peptide treatment group and its corresponding control group is shown above the statistical plot, where P <0.05 represents P <0.01 and P <0.001.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions of the present invention will be clearly and completely described in the following examples. It will be apparent that the described embodiments are some, but not all, embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

In addition, numerous specific details are set forth in the following description in order to provide a better illustration of the invention. It will be understood by those skilled in the art that the present invention may be practiced without some of these specific details. In some embodiments, materials, elements, methods, means, etc. well known to those skilled in the art are not described in detail in order to highlight the gist of the present invention.

Throughout the specification and claims, unless explicitly stated otherwise, the term "comprise" or variations thereof such as "comprises" or "comprising", etc. will be understood to include the stated element or component without excluding other elements or components.

Example 1: effect of small peptides and their derivatives on SASP of radiation-induced aging model of HDF cells

In this example, a cell senescence model was constructed by radiation-induced skin fibroblast (HDF) senescence, and detecting the effect of the small molecule peptides NSM and its derivatives palmitoylation NSM and NSM-R-R-R-R-R-R-R (respectively referred to as peptide 1, peptide 2, peptide 3) on the senescence-associated secretory phenotype (i.e., SASP) on the cellular senescence model; among them, the radiation-induced HDF cell senescence model is a well-recognized and common cell senescence model in the art, and SASP is a protein factor secreted by senescent cells, including inflammatory factors, chemokines, growth factors, matrix metalloproteinases, etc.; in this example, classical SASP related genes including IL1 beta, IL6, IL8, MMP3 were selected for detection.

1. Preparation of cell senescence model:

skin fibroblast (HDF) senescence induced by radiation is a common model of cellular senescence constructed by the following method:

skin fibroblasts (HDF, available from Feng Hui organisms) of age 20 were cultured in DMEM complete medium at 37 ℃ under 5% co2, and irradiated with gamma rays at a dose of 10Gy when the cell density was around 70%; after 24 hours, the culture medium is changed into a common culture medium (namely, a DMEM complete culture medium), and after the culture is continued for 6 days, the aged cells are obtained, and the liquid is changed every 2 days during the culture period.

2. Experimental grouping and processing:

the experiments were divided into 5 groups, respectively:

1) Young HDF cells (corresponding to the "Y" group of fig. 1): HDF cells of 20 passages in age maintained in DMEM complete medium;

2) Radiation-induced senescent HDF cells (corresponding to the "O" group of fig. 1): refers to a model of radiation-induced aging cells prepared according to the procedure described above;

3) Peptide 1 treated young HDF cells (corresponding to the "o+peptide 1" group of fig. 1): specifically, HDF cells of the generation-age 20 were changed to DMEM complete medium containing 10 μg/ml peptide 1 (i.e., peptide NSM) after 24 hours of irradiation with 10Gy of gamma rays, and cells obtained by culturing for 6 days were maintained with this DMEM complete medium containing 10 μg/ml peptide 1, with a single change of fluid over 2 days;

4) Peptide 2 treated young HDF cells (corresponding to the "o+peptide 2" group of fig. 1): specifically, HDF cells of the generation-age 20 were changed to DMEM complete medium containing 10 μg/ml peptide 2 (i.e., palmitoylated NSM) after 24 hours of irradiation with 10Gy of gamma rays, and the cells obtained by culturing for 6 days were maintained with this DMEM complete medium containing 10 μg/ml peptide 2, with a single change over 2 days;

5) Peptide 3 treated young HDF cells (corresponding to the "o+peptide 3" group of fig. 1): specifically, HDF cells of the generation-age 20 were changed to DMEM complete medium containing 10. Mu.g/ml of peptide 3 (i.e., peptide NSM-R-R-R-R-R-R-R) after 24 hours of irradiation with 10Gy of gamma rays, and cells obtained by culturing for 6 days were maintained with this DMEM complete medium containing 10. Mu.g/ml of peptide 3, with a single change of fluid over 2 days.

3. The detection method comprises the following steps:

for each experimental group, after the treatment is finished, collecting cells, carrying out RNA extraction and reverse transcription, and detecting the mRNA relative expression quantity of SASP related genes of each group of cells by a qPCR method, wherein GAPDH is used as a control; the primers used for qPCR were as follows:

IL1β-F：ATGATGGCTTATTACAGTGGCAA(SEQ ID NO:1)；

IL1β-R：GTCGGAGATTCGTAGCTGGA(SEQ ID NO:2)；

IL6-F：ACTCACCTCTTCAGAACGAATTG(SEQ ID NO:3)；

IL6-R：CCATCTTTGGAAGGTTCAGGTTG(SEQ ID NO:4)；

IL8-F：ACTGAGAGTGATTGAGAGTGGAC(SEQ ID NO:5)；

IL8-R：AACCCTCTGCACCCAGTTTTC(SEQ ID NO:6)；

MMP3-F：CGGTTCCGCCTGTCTCAAG(SEQ ID NO:7)；

MMP3-R：CGCCAAAAGTGCCTGTCTT(SEQ ID NO:8)；

GAPDH-R：GTCCTTCCACGATACCAAAGTTGTCA(SEQ ID NO:9)；

GAPDH-F：ACAACAGCCTCAAGATCATCAGCAAT(SEQ ID NO:10)。

reverse transcription procedure and qPCR system and conditions were as follows:

1) Total cellular RNA was extracted using TRIzol reagent (purchased from Invitrogen) according to the instructions;

2) Reverse transcription of the total cellular RNA extracted in step 1) into cDNA using ReverTra Ace qPCR RT Master Mix (purchased from TOYOBO); the specific steps are briefly described as follows:

i) RNA denaturation: placing RNA at 65 ℃ for 5min, and then rapidly placing the RNA on ice for cooling; the secondary structure present in the RNA is opened at this step so that the subsequent transcription reaction forms the complete cDNA;

ii) reverse transcription reaction

Reverse transcription reaction system: mu.l of 5 XRT Master Mix, 2. Mu.g of RNA template, nuclease-free water was made up to 20. Mu.l;

reverse transcription reaction setup: incubation at 37℃for 30min and denaturation at 95℃for 5min (inactivation of reverse transcriptase); the obtained cDNA is generally stored at-20 ℃ for standby;

3) mu.L of the reverse transcription product was taken as qPCR template and 10. Mu.L was added

Green Realtime PCR Master Mix (available from TOYOBO), 1. Mu.L of upstream primer (10. Mu. Mol/L), 1. Mu.L of downstream primer (10. Mu. Mol/L) and 7. Mu.L of double distilled water were mixed well; setting 3 compound holes for each gene of each sample;

qPCR reaction set up: pre-denaturation at 95℃for 3min; denaturation at 95℃for 15s and annealing at 60℃for 60s, for a total of 40 cycles, during which fluorescence values were collected.

4. Detection results and conclusions:

the results are shown in FIG. 1; as can be seen from fig. 1, the radiation-induced senescent HDF cells showed significantly increased SASP (il1β, IL6, IL8, MMP 3) expression compared to the young HDF cells, and significantly decreased SASP (il1β, IL6, IL8, MMP 3) expression after treatment of senescent cells with peptides 1, 2, and 3, which was significantly lower than that of senescent cells; among them, peptide 2 and peptide 3 have the most remarkable inhibitory effect on SASP.

The above results indicate that the small molecule peptide NSM and its derivatives significantly inhibit the expression of skin fibroblast (HDF) SASP, resulting in effects including:

in one aspect, as previously described, high expression of SASP (particularly elevated matrix metalloproteinase) can result in increased degradation of collagen fibers and elastic fibers in dermis of skin, causing the skin to lose elasticity, relax and collapse, while small molecule peptide NSM and its derivatives can significantly inhibit expression of skin fibroblast (HDF) SASP, thus it can be determined that the small molecule peptide NSM and its derivatives can reduce degradation of collagen fibers and elastic fibers, thereby increasing its content, and further increasing skin elasticity, preventing skin from relaxing and collapsing;

on the other hand, senile aseptic inflammation is closely related to SASP (such as cytokines and chemokines il1β, IL8, VEGF, IL6, CXCL1, CCL2, etc. all participate in the formation of senile chronic dermatitis), whereas small molecular peptide NSM and its derivatives can inhibit the expression of skin fibroblast (HDF) SASP, in particular, can inhibit the expression of cytokines il1β, IL6, IL8 participating in inflammation, and thus it can be confirmed that the small molecular peptide NSM and its derivatives are useful for eliminating or alleviating the symptoms of senile chronic dermatitis.

Example 2: effect of the Small molecule peptide NSM and its derivatives on the collagen content in radiation-induced senescent HDF cells and their culture supernatants

In this example, HDF cell senescence was induced by radiation treatment, and a radiation-induced cell senescence model was constructed; then, the effect of the small molecule peptides NSM and its derivatives palmitoylated NSM and NSM-R-R-R-R-R-R-R (referred to as peptide 1, peptide 2, peptide 3, respectively) on collagen content in senescent cells and their culture supernatants was examined on this cell senescence model.

1. Preparation of cell senescence model:

the method of constructing the model of radiation induced HDF cell senescence was as described in example 1 above.

2. Experimental grouping and processing:

the experiments were divided into two main groups, respectively: a young HDF cell group (corresponding to "young" of fig. 2) and a radiation treatment group (corresponding to "IR" of fig. 2); these two groups, in turn, respectively involved three groups of cells, where NC represents young HDF cells (age of 20), and peptide 1, peptide 2, and peptide 3 represent groups of cells treated with 10. Mu.g/ml of peptide 1, peptide 2, and peptide 3, respectively, for radiation-induced aging HDF cells (treatment mode was the same as that of the peptide treatment group in example 1).

3. The detection method comprises the following steps:

for each experimental group, after radiation treatment for 7 days, collecting cell and cell culture supernatant, extracting total protein from cells by using RIPA lysate (purchased from Biyun) and adding protein loading buffer (purchased from Biyun) and heating at 95 ℃ for 5 minutes for later use; the cell culture supernatant was directly added to a protein loading buffer (from Biyun days) and heated at 95℃for 5 minutes for further use. The type I collagen content of each group of cells was detected by Western blot, wherein the primary antibodies used included: anti-GAPDH antibodies, available from Proteintech corporation; anti-Collagen I antibodies, available from protentech company; the secondary antibody used was an HRP-labeled rabbit secondary antibody, available from Santa Cruz.

4. Detection result:

the results are shown in FIG. 2; as can be seen from fig. 2, the radiation-induced senescent cells and the type I collagen content in the culture supernatant thereof were reduced (in particular, the collagen content in the cell culture supernatant was significantly reduced); after treatment with peptide 1, peptide 2, and peptide 3, the collagen content in the cells and their culture supernatants was significantly increased.

The above results indicate that the small molecule peptide NSM and its derivatives can increase collagen content in aged skin fibroblasts (HDF) and their culture supernatants, and thus can be expected to be useful for reversing or combating cellular aging.

Example 3: effect of small molecule peptide NSM and its derivatives on D-galactose induced premature senility mouse model skin

In the embodiment, the mice are aged by injecting D-galactose into the cervical and back parts of the mice in a subcutaneous injection manner, and a mice premature senility model which is a premature senility animal model recognized and common in the field is constructed; then, the influence of the small molecular peptide NSM and derivatives thereof on the content, the morphology and the collagen biochemical index of the collagen fibers and the elastic fibers of the skin of the mice is detected on the premature senility mouse model.

1. Preparation of mice model for premature senility

Preparation of the premature senility model was performed using 8-week-old female C57BL/6J wild-type mice (purchased from animal department of medical science, beijing university):

first, the skin preparation of the mouse neck and back was performed: using an electric shaver, reserving 0.5cm by taking the spine as an axis, starting skin preparation at the position 0.5cm below two ears, and removing hairs in the area of 1.5cm multiplied by 3.0cm on the left side and 1.5cm multiplied by 3.0cm on the right side; then, 10% aqueous solution of D-galactose in physiological saline (D-galactose was purchased from microphone, the same applies hereinafter) was injected subcutaneously in an amount of 200mg/kg/day at the nape of the neck for 12 weeks continuously to induce premature senility in the mice.

2. Experimental grouping and processing

1) Control group (5 per group): taking 8-week-old female C57BL/6J wild mice, injecting 10% D-galactose physiological saline solution daily during the early senescence induction according to the program, and smearing control face cream on the skin of the left neck and back of the mice, namely a control group;

2) Experimental group (5 per group): taking 8-week-old female C57BL/6J wild-type mice, injecting 10% D-galactose physiological saline solution daily during the early senescence induction according to the program, and smearing face cream containing peptide 1, peptide 2 and peptide 3 on the skin of the right neck and back of the mice, namely the experimental group.

The formula and preparation of the control face cream NC1-L, NC2-L, NC-L are the same as shown below:

the control face cream comprises the following components in percentage by mass: 13% squalane (from Japanese light), 2%305 emulsifier (from Guangzhou Tianci), 2% propylene glycol, 10% low molecular weight hyaluronic acid (200 kDa from Huaxi organism), 10% high molecular weight hyaluronic acid (5000 kDa from Huaxi organism) and 63% water; the components are mixed and stirred for 10 minutes according to the formula until the cream becomes semi-solid, and no obvious liquid component exists.

Formula and preparation of face cream containing small molecule peptide or derivative thereof:

adding peptide 1, peptide 2 and peptide 3 into the control cream to obtain final concentration of 40 μg/mL.

3. Morphological detection of skin collagen fibers and elastic fibers

The specific detection method comprises the following steps:

after 12 weeks of aging induction and face cream application, the mice are killed by cervical dislocation; separating left and right skins of the mice respectively, fixing, embedding and slicing the skins, then performing masson staining to detect skin collagen fibers, and performing EVG staining to detect skin elastic fibers; observing the morphology and distribution of the collagen fibers and the elastic fibers, and counting the content of the collagen fibers and the elastic fibers in the dermis layer by using QuPath software (https:// QuPath. Gitub. Io/, according to the teaching course of a website by a specific method);

4. detection result

The results are shown in FIG. 3, wherein FIG. 3A shows the results of masson staining of D-galactose-induced early senescence mouse skin sections, showing collagen fibers in the mouse skin; FIG. 3B is a statistical plot of collagen fiber content in the dermis layer of the skin of a mouse; FIG. 3C is the EVG staining results of D-galactose-induced premature senility mouse skin sections showing elastic fibers in the skin; fig. 3D is a statistical plot of the elastic fiber content in the dermis layer of the skin of a mouse.

As can be seen from fig. 3, in the skin of the mice with premature senility using the control cream, the collagen fibers and the elastic fibers are different in size and length and are loosely arranged; in contrast, in the skin of mice using the face cream containing peptide 1, peptide 2, peptide 3, the collagen fibers and elastic fibers thereof were closely and regularly arranged, and the content of both fibers was significantly increased (P < 0.001), which reflects a significant increase in the total collagen content thereof.

The above results fully demonstrate that the small molecule peptide NSM and its derivatives can enhance skin elasticity, improve skin fineness and/or firmness, and reduce or prevent appearance of fine lines or wrinkles of skin, so that the skin aging state is significantly improved.

Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims (10)

1. Use of a small molecule peptide or derivative thereof for the preparation of a composition product for use in anti-skin ageing and/or anti-dermatitis, wherein the small molecule peptide comprises or consists of the amino acid sequence: asn-Ser-Met.

2. Use according to claim 1, characterized in that the derivative of the small molecule peptide is a palmitoylated small molecule peptide or a small molecule peptide having polyarginine at its carboxy terminus, preferably having 5-8 arginines, more preferably having 6-7 arginines.

3. Use according to claim 1 or 2, characterized in that the composition product is manufactured for the application of a pharmaceutically or cosmeceutically effective amount of a small molecule peptide or derivative thereof on the skin;

preferably, the small molecule peptide or derivative thereof comprises 0.002% -0.006%, preferably 0.003% -0.005%, most preferably 0.004% of the total weight of the composition product.

4. A use according to any one of claims 1-3, wherein the skin aging is one or more selected from the group consisting of: skin aging, premature radiation skin aging, natural skin aging and photoaging caused by DNA damage;

and/or the dermatitis is senile dermatitis, preferably senile aseptic dermatitis.

5. The use according to any one of claims 1-4, wherein the anti-skin aging comprises at least one of:

1) Reducing or preventing the appearance of fine lines or wrinkles in the skin;

2) Enhancing skin elasticity;

3) Improving skin fineness and/or firmness;

and/or, the anti-dermatitis is to eliminate or alleviate dermatitis symptoms.

6. The use according to any one of claims 1-5, wherein the mechanism of anti-skin aging comprises one or more of the following:

1) Inhibiting expression of a senescence-associated secretion phenotype;

2) Increasing the collagen and/or elastin content in the skin; and

3) The arrangement of collagen fibers and/or elastic fibers in the skin is more compact and regular.

7. Use according to any one of claims 1 to 6, wherein the composition product is a normal cosmetic, cosmeceutical or pharmaceutical product;

preferably, the composition product is in a topical dosage form, preferably selected from the following topical dosage forms: aqueous solution, emulsion, ointment, cream, gel, powder and oil.

8. Use according to any one of claims 1-7, wherein the composition product comprises:

1) A small molecule peptide or derivative thereof;

2) One or more of a pharmaceutically or cosmetically acceptable carrier, excipient, solvent and buffer; the method comprises the steps of,

optionally, 3) other active agents;

preferably, the other active agents include any one or more of antioxidants, cellular active agents, moisturizing agents, anti-aging agents, and anti-dermatitis agents.

9. An external preparation, characterized in that the external preparation comprises:

i) A small molecule peptide or derivative thereof, and

ii) a matrix;

wherein the small molecule peptide comprises or consists of the following amino acid sequence: asn-Ser-Met; and, the matrix comprises: squalane, an emulsifier, propylene glycol, low molecular hyaluronic acid or a salt thereof, high molecular hyaluronic acid or a salt thereof and water.

10. External preparation according to claim 9, characterized in that the derivative of the small molecule peptide is a palmitoylated small molecule peptide or a small molecule peptide having polyarginine at its carboxy terminus, preferably having 5-8 arginines, more preferably having 6-7 arginines;

preferably, the concentration of the small molecule peptide or derivative thereof in the external preparation is 20 to 60. Mu.g/mL, preferably 30 to 50. Mu.g/mL, most preferably 40. Mu.g/mL;

preferably, the molecular weight of the low molecular hyaluronic acid or salt thereof is between 10kDa and 500kDa, preferably between 100kDa and 200kDa;

preferably, the molecular weight of the high molecular hyaluronic acid or salt thereof is 2000kDa to 10000kDa, preferably 5000kDa to 6000kDa;

preferably, the matrix comprises, in weight percent: 10-15% of squalane, 1-3% of 305 emulsifying agent, 1-3% of propylene glycol, 8-12% of low molecular hyaluronic acid or salt thereof, 8-12% of high molecular hyaluronic acid or salt thereof and the balance of water; preferably, the matrix comprises: 13% of squalane, 2% of 305 emulsifying agent, 2% of propylene glycol, 10% of low molecular hyaluronic acid or salt thereof, 10% of high molecular hyaluronic acid or salt thereof and the balance of water.

Images