CN116355074A - Long-acting cat omega interferon mutant and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biological genetic engineering, and particularly relates to a long-acting cat omega interferon mutant, and a preparation method and application thereof. The long-acting cat omega interferon mutant is obtained by carrying out site-directed mutagenesis on mature peptide cat omega interferon, amino acid sites of the site-directed mutagenesis comprise more than one site of 27 th phenylalanine amino acid (F), 67 th asparagine (N), 102 th leucine (L), 123 rd glycine (G) and 154 th leucine (L) of the mature peptide cat omega interferon, so that the cat omega interferon mutant with lysine sites can be efficiently modified by PEG, the cat omega interferon and mutant PEG modified protein thereof have long half-life, excellent biological activity and more uniform products, and the technical problem that the product heterogeneity can be increased by adopting PEG modification in the prior art is solved.

Description

Long-acting cat omega interferon mutant and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biological genetic engineering, and particularly relates to a long-acting cat omega interferon mutant, and a preparation method and application thereof.

Background

In 1985, interferon omega was first cloned from Namalwa cells induced by Sendai virus. In 1992, nakamura was first isolated to obtain feline interferon genes, and recombinant interferon drugs based on related studies were successfully developed and marketed in Japan, mainly for treatment of feline calicivirus and canine parvovirus diseases. Since IFN-omega was found, it has been a hotspot for research at home and abroad due to its species specificity and more efficient antiviral activity. IFN-omega is present in humans, felines, pigs, horses, rabbits, and bats, but not in dogs and mice.

The cat omega interferon is the earliest cat interferon preparation and is the cat interferon with the strongest antiviral activity. The feline omega interferon has broad-spectrum antiviral effect, binds with cell surface receptor, induces cells to produce various antiviral proteins, thereby inhibiting the replication of viruses in cells, and is effective on RNA and DNA viruses. The homology between FeIFN-alpha and FeIFN-omega is 94%, and although the homology between the two is high, there is a great difference in antiviral, antiproliferative and immunomodulatory activities between them. The antiviral activity of FeIFN-omega was also studied by the scholars against FeIFN-alpha and FeIFN-omega, and the antiviral activity of FeIFN-omega was 160-fold and 4-fold higher than that of FeIFN-alpha for both H9N2 subtype Avian Influenza Virus (AIV) and Canine Distemper Virus (CDV). Experiments prove that the recombinant feline omega interferon can also be used for treating Feline Calicivirus (FCV), feline herpesvirus-1 (FHV-1), feline Chronic Gingivitis Syndrome (FCGS) and feline infectious peritonitis (FIP: immune-mediated disease caused by feline coronavirus) to obtain better curative effect, and the curative effect is better than that of FeIFN-alpha which is currently used in clinic. Masato Kuwabara et al, in FeIFN-omega treatment of CPV infected dogs treatment test, can enhance the normal canine cell immunity, to CPV infected dogs has significant therapeutic effect. The cat omega interferon has the immunoregulation function, can regulate the expression of main histocompatibility antigens, enhance the activity of phagocytes, enhance the activity of natural killer cells and cytotoxic T cells and improve the antiviral capability of organisms. The cat omega interferon has the effects of accelerating and enhancing the immunity of the vaccine, and can shorten the time for producing antibodies and improve the antibody level of organisms when being used together with the vaccine. Rodolfo Oliveira Leal et al showed that rFelFN-omega compounds can stimulate innate immunity in cats infected with the native Feline Immunodeficiency Virus (FIV), reducing clinical symptoms and concomitant infections. In the related research of anti-tumor, when rFeIFN-omega is used for treating cat breast cancer cells, the dose dependency, species specificity and target cell specificity are presented, and the rFeIFN-omega can be combined with other conventional anti-cancer drugs to better exert the drug property. rFeIFN-omega has excellent anti-tumor activity and potential of being the first therapeutic drug for cat breast cancer. However, IFN- ω has poor pharmacokinetics, a short half-life, and a half-life of less than 2 hours. The short half-life limits the clinical use of IFN-omega.

PEG is also called PEGylation (PEGylation), and the PEG is covalently bonded to lysine, histidine, arginine or other amino acid residues on the surface of protein polypeptide drugs in an ester bond or amide bond mode by utilizing the advantages of non-toxicity, non-immunogenicity, non-antigenicity, good water solubility and the like of the PEG. Covalent coupling of activated polyethylene glycol to protein molecules, thereby affecting the spatial structure of the protein, ultimately leading to changes in various physicochemical properties of the protein: conformational changes, electrostatic binding changes, reduced hydrophobicity, increased chemical stability, increased resistance to proteolytic hydrolysis, reduced or no immunogenicity and toxicity, reduced plasma clearance, etc. Physical and chemical changes increase the in vivo retention time of the drug, increase the plasma half-life, prolong the absorption time, and also influence the binding affinity of the drug to cell receptors. The PEG modified medicine has reduced administration times, raised curative effect, improved tolerance, lowered severity and lowered adverse event rate. Meanwhile, the PEG can also increase the solubility and stability of the protein, and is also beneficial to the production and storage of medicines. PEG is therefore often used as a drug delivery and drug modification technology, either directly coupled to the drug or attached to the drug surface and encapsulated in nanomaterials.

Disclosure of Invention

Aiming at the problems, the invention aims to provide a long-acting omega interferon mutant of a cat, and a preparation method and application thereof.

The technical content of the invention is as follows:

the invention provides a long-acting cat omega interferon mutant, which comprises a mature peptide cat omega interferon mutant;

the mature peptide cat omega interferon mutant (mFeIFN-omega) is obtained by carrying out site-directed mutagenesis on mature peptide cat omega interferon, wherein the site-directed mutagenesis amino acid site comprises more than one site of 27 th phenylalanine amino acid (F), 67 th asparagine (N), 102 th leucine (L), 123 rd glycine (G) and 154 th leucine (L) of the mature peptide cat omega interferon;

the other amino acids include lysine, histidine, arginine or other amino acids;

the long-acting cat omega interferon mutant comprises amino acids shown in sequence tables SEQ ID NO. 1-SEQ ID NO.7, and histidine protein tags are connected, wherein the amino acids are as follows:

the 27 th phenylalanine amino acid (F) is mutated into lysine (K) and pPICZ alpha A-mFeIFN-omega-H-Mut 1, the amino acid sequence is shown as SEQ ID NO.1, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 8;

the 67 th asparagine (N) is mutated into lysine (K) and pPICZ alpha A-mFeIFN-omega-H-Mut 2, the amino acid sequence is shown as SEQ ID NO.2, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 9;

the 102 th leucine (L) is mutated into lysine (K) which is pPICZ alpha A-mFeIFN-omega-H-Mut 3, the amino acid sequence is shown as SEQ ID NO.3, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 10;

the 123 rd glycine (G) is mutated into lysine (K) and is pPICZ alpha A-mFeIFN-omega-H-Mut 4, the amino acid sequence of the mutant is shown as SEQ ID NO.4, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 11;

the 154 th leucine (L) is mutated into lysine (K) which is pPICZ alpha A-mFeIFN-omega-H-Mut 5, the amino acid sequence of the 154 th leucine (L) is shown as SEQ ID NO.5, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 12;

the 27 th phenylalanine amino acid (F) is mutated into lysine (K), the 154 th leucine (L) is mutated into lysine (K), the mutation is pPICZ alpha A-mFeIFN-omega-H-Mut 6, the amino acid sequence is shown as SEQ ID NO.6, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 13;

the 27 th phenylalanine amino acid (F) is mutated into lysine (K), the 123 rd glycine (G) is mutated into lysine (K), the 154 th leucine (L) is mutated into lysine (K), the mutation is pPICZ alpha A-mFeIFN-omega-H-Mut 7, the amino acid sequence is shown as SEQ ID NO.7, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 14;

the mature peptide cat omega interferon (mFeIFN-omega) is protein obtained by adopting RT-PCR and PCR methods after induced stimulation of cats, and the amino acid sequence of the mature peptide cat omega interferon is mFeIFN-omega shown as SEQ ID NO.7 in a sequence table in patent CN202011408856.4, a cat omega interferon mutant, a preparation method and application thereof.

The invention also provides a preparation method of the long-acting cat omega interferon mutant, which comprises the following steps:

1) Mature peptide cat omega interferon recombinant plasmid: connecting the mature peptide cat omega interferon mFeIFN-omega with a protein tag, a stop codon and an enzyme cutting site, synthesizing the mixture on a plasmid vector after codon optimization, cloning the mixture to a pichia pastoris expression vector after double enzyme cutting, and connecting and converting the mixture to obtain a recombinant plasmid mFeIFN-omega plasmid vector;

the pichia pastoris expression vector comprises one of pPICZ alpha A, pPICZ alpha B, pPICZ alpha C, pGAPZ alpha A, pGAPZ alpha B, pGAPZ alpha C, pPIC9K, pPIC9, pHIL-S1, pYAM75P, pPIC3, pPIC3K, pPIC3.5K, pHIL-D2, pACO815 and pPICZA, pPICZB, pPICZC, pGAPZA, pGAPZB, pGAPZC, pPink-hc;

2) Amino acid mutation: carrying out site-directed mutagenesis on the obtained mature peptide cat omega interferon with amino acid to obtain mFeIFN-omega-Mut with lysine site;

3) Mutant expression: designing corresponding complementary primers by taking an mFeIFN-omega-plasmid vector as a template, purifying a product obtained by loop PCR amplification, performing DpnI enzyme digestion, performing seamless cloning kit treatment on the purified digestion product, then converting DH5 alpha, identifying positive bacterial strains by bacterial liquid PCR, extracting plasmids, sequencing and identifying the positive plasmids, performing enzyme tangential digestion, introducing the positive plasmids into an expression host bacterium to obtain recombinant saccharomycetes, and performing induced expression and chromatographic purification to obtain a target protein, namely the recombinant protein of the cat omega interferon mutant;

the host bacteria comprise one of Pichia pastoris host bacteria X33, GS115, KM71, SMD1168, SMD1165, SMD1163, Y-11430 and M-G100-3, and the Pichia pastoris is matched, preferably X33, so that the formation of disulfide bonds is facilitated;

4) PEG modification: mixing the purified target protein with mPEG-SCM solution according to the following ratio of 1: (2-30) carrying out a molar mass ratio mixing reaction for modification, adding the modified mixture into a DEAE column balanced by ultrafiltration dialysate, flushing the column with the ultrafiltration dialysate with a volume of 2-6 times, and collecting a flow through peak to obtain a pure PEG modified long-acting cat omega interferon mutant solution;

the mPEG-SCM solution is prepared by using mPEG-SCM with molecular weight of 10-20kDa to pass through ddH ₂ O is dissolved to obtain a solution with the concentration of 50 mg/mL;

the condition of the mixing reaction is that stirring reaction is carried out for 1-20 hours at the temperature of 4-30 ℃; then adding 0.1-0.5M glycine, and stopping the reaction for 5-20 minutes.

The invention also provides a cat omega interferon mutant for preparing antiviral drugs.

The beneficial effects of the invention are as follows:

the long-acting felon omega interferon mutant forms the FeIFN-omega-Mut with lysine sites by mutating amino acid sites of the FeIFN-omega, utilizes the characteristics of proper glycosylation modification, disulfide bond formation, efficient induction expression and the like of a pichia pastoris methanol-induced secretion expression system, and the felon omega interferon and the mutant thereof are efficiently expressed in pichia pastoris, have high biological activity, high stability and proper glycosylation modification, and can be efficiently modified by PEG. The activity of FeIFN-omega-H-Mut 1, feIFN-omega-H-Mut 2, feIFN-omega-H-Mut 3, feIFN-omega-H-Mut 4, feIFN-omega-H-Mut 5, feIFN-omega-H-Mut 6 and FeIFN-omega-H-Mut 7 is higher than that of natural mFeIFN-omega-H, and the PEG modified FeIFN-alpha-Mut interferon can obviously prolong the half life, has excellent biological activity and more uniform products, and solves the technical problem that the non-uniformity of the products can be increased by adopting PEG modification in the prior art.

Drawings

FIG. 1 is a schematic diagram of the construction of a recombinant plasmid FeIFN- ω of the example;

FIG. 2 is a graph showing the results of colony PCR identification of mFeIFN- ω -Mut mutants;

FIG. 3 is a bacterial liquid PCR identification of recombinant yeast;

FIG. 4 is a diagram showing the SDS-PAGE detection result of the supernatant of the mFeIFN-omega-Mut 1-2 recombinant yeast induced expression;

FIG. 5 is a diagram showing the SDS-PAGE detection result of the supernatant of the mFeIFN-omega-Mut 3-4 recombinant yeast induced expression;

FIG. 6 is a diagram showing the SDS-PAGE detection result of the supernatant of the mFeIFN-omega-Mut 5-7 recombinant yeast induced expression;

FIG. 7 is a graph showing the results of protein activity of PEG-modified mFeIFN- ω -Mut mutants.

Detailed Description

The invention is described in further detail below with reference to specific embodiments and the accompanying drawings, it being understood that these embodiments are only for the purpose of illustrating the invention and not for the purpose of limiting the same, and that various modifications of the invention, which are equivalent to those skilled in the art, will fall within the scope of the appended claims after reading the present invention.

All materials and reagents of the invention are materials and reagents of the conventional market unless specified otherwise.

Examples

Preparation of long-acting omega interferon mutant of cat

1. Synthesis of whole gene fragment and construction of recombinant plasmid

The invention discloses a method for constructing a recombinant plasmid mFeIFN-omega-pPICZ alpha A, which comprises the steps of introducing a protein tag (histidine) and a stop codon (TAA) at the C end of a sequence, introducing an EcoRI enzyme cutting site at the upstream and introducing XbaI at the downstream, cloning the recombinant plasmid on pPICZ alpha A after codon optimization, wherein the mFeIFN-omega of the sequence table SEQ ID NO.7 in the patent CN202011408856.4 of the applicant of the invention is adopted as a basic sequence of the invention, and the construction schematic diagram of the obtained recombinant plasmid mFeIFN-omega-pPICZ alpha A is shown in figure 1.

Site directed mutagenesis of the amino acid position of mFeIFN-omega

According to the analysis of tertiary structure of mFeIFN-omega sequence, avoiding IFNAR1 and IFNAR2 receptor binding site, combining PEG to be easily covalently combined with lysine on the surface of protein polypeptide medicine in the form of ester bond or amido bond, making site-directed mutation of amino acid of mFeIFN-omega into mFeIFN-omega-Mut with lysine site (lysine, histidine, arginine or other amino acid), using pPICZ alpha AmFeIFN-omega-H as template, designing correspondent complementary primer (the introduction designed in this example is shown in table 1, the primer sequence is not limited);

TABLE 1 complementary primers

Performing DpnI enzyme digestion after the product is purified by adopting loop PCR amplification, and converting DH5 alpha after the purified digestion product is subjected to seamless cloning kit treatment;

the site of the mFeIFN-omega amino acid site-directed mutation comprises:

1) Mutating 27 th phenylalanine amino acid (F) into lysine (K) to obtain pPICZ alpha A-mFeIFN-omega-H-Mut 1, wherein the amino acid sequence is shown as SEQ ID NO.1, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 8;

2) Mutation of the 67 th asparagine (N) into lysine (K) is that pPICZ alpha A-mFeIFN-omega-H-Mut 2, the amino acid sequence is shown as SEQ ID NO.2, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 9;

3) The 102 th leucine (L) is mutated into lysine (K) to be pPICZ alpha A-mFeIFN-omega-H-Mut 3, the amino acid sequence is shown as SEQ ID NO.3, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 10;

4) Mutation of 123 rd glycine (G) into lysine (K) is pPICZ alpha A-mFeIFN-omega-H-Mut 4, the amino acid sequence is shown as SEQ ID NO.4, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 11;

5) The 154 th leucine (L) is mutated into lysine (K) which is pPICZ alpha A-mFeIFN-omega-H-Mut 5, the amino acid sequence is shown as SEQ ID NO.5, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 12;

6) Mutating 27 th phenylalanine amino acid (F) into lysine (K) and 154 th leucine (L) into lysine (K), and mutating the 27 th phenylalanine amino acid (F) into pPICZ alpha A-mFeIFN-omega-H-Mut 6, wherein the amino acid sequence is shown as SEQ ID NO.6, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 13;

7) Mutating 27 th phenylalanine amino acid (F) into lysine (K), 123 rd glycine (G) into lysine (K), 154 th leucine (L) into lysine (K), and pPICZ alpha A-mFeIFN-omega-H-Mut 7, wherein the amino acid sequence is shown as SEQ ID NO.7, and the nucleic acid sequence after codon optimization is shown as SEQ ID NO. 14;

as shown in FIG. 2, the electrophoretogram identified by PCR of pPICZ alpha A-mFeIFN-omega-Mut-DH 5 alpha bacterial liquid after DH5 alpha is transformed by the purified loop PCR amplification digestion product, and the pPICZ alpha A-mFeIFN-omega-Mut of each group is positive, which indicates that each mutant plasmid is successfully constructed.

3. PCR identification of recombinant positive transformants

The adopted identification primers are mFeIFN-omega-F and mFeIFN-omega-R respectively, and are synthesized by Guangzhou Jin Weizhi biotechnology Co., ltd;

mFeIFN-ω-F(SEQ ID NO.25):TGTGCTTTGCCAGGATCTGATGC；

mFeIFN-ω-R(SEQ ID NO.26):TTAAGAAGATCCCAAATCTCCATCTTT；

PCR identification systems and procedures are shown in the following Table, and PCR products were subjected to 1% agarose gel electrophoresis.

TABLE 2PCR identification System

TABLE 3PCR identification procedure

And selecting PCR identified positive bacteria to extract plasmids and sequencing and identifying. The identification system and the procedure are as in tables 2 and 3.

4. Restriction enzyme linearization and purification recovery of recombinant plasmid

Referring to TAKARA company enzyme cutting test manual, using Sac I single enzyme cutting each recombinant plasmid, and agarose gel electrophoresis detection of linearization complete. And (3) purifying and recycling the linearization product, wherein the purifying and recycling method refers to the instruction of the kit.

5. Preparation of Pichia X33 competent cells

1) Inoculating single colony of yeast receptor bacteria on YPD plate, and culturing at 30deg.C for 2 days;

2) Single colony on the plate is selected and inoculated in 10mLYPD liquid culture medium, and shaking is carried out on a shaking table at 30 ℃ for overnight;

3) After overnight culture, inoculating the strain into 100mLYPD culture medium according to the inoculum size of about 1% and shake-culturing until the OD value is 1.2-1.5;

4) Centrifuging at 5000rpm at 4 ℃ for 5min, collecting the precipitated thalli, and re-suspending the thalli with 100mL of pre-chilled sterile water;

5) Centrifuging at 5000rpm for 10min at 4 ℃ to collect precipitated thalli, and re-suspending the thalli with 100mL of pre-chilled sterile water;

6) Centrifuging at 5000rpm for 10min at 4 ℃ again, collecting the precipitated thalli, and re-suspending the thalli with 100mL of pre-cooled sterile water;

7) 20mL,1mol/L sorbitol wash 1 time;

8) The cells were dissolved in 1mL of 1M pre-chilled sorbitol without glycerol and left at-80℃for several hours for transformation.

6. Electric transformation of pichia X33 competent cells by using linearization expression plasmid

1) Mixing 80 μL yeast competence with 1-5 μg of linearized plasmid (precooled on ice for 15 min), and rapidly placing into 0.2cm electric shock cup (precooled on ice for sterilization); the electrical conversion parameter is Voltage:1500V; capacitance:25 μF; resistance:200 Ω; cuvette (mm): 2mm;

2) After the electric shock, 1mL of sorbitol (1M) is rapidly added, the mixture is kept stand on ice for 15min, then the mixture is kept stand and cultivated for 1h in a temperature box at 30 ℃, then 1mLYPD liquid medium is added, the mixture is cultivated for 1h at 30 ℃ under shaking at 200r/min, thalli are collected by centrifugation at 4000r/min at normal temperature, and the thalli are coated on a YPDS plate containing 100 mug/mug and cultivated for 3d at 30 ℃.

7. Identification of recombinant yeasts and high copy screening

Single colonies with Zeocin resistance grown on YPD plates were carefully picked with a sterile gun head and inoculated into 2mL of YPD liquid medium (containing 150. Mu.g/mL Zeocin) and shake-cultured at 30℃for 200r/min overnight;

the P.pastoris transformants are analyzed by bacterial liquid PCR, the PCR identification system is the same as that of table 1, the PCR identification program table 4, and the PCR products are subjected to 1% agarose gel electrophoresis to identify the clone of which the primers can amplify out the target bands as positive transformants;

TABLE 4 PCR identification procedure for recombinant yeast liquids

The screening of high copy number was performed by combining the stripe brightness and high resistance YPD plate (200. Mu.g/mLZeocin) test results in PCR assay, and the recombinant yeast liquid PCR assay is shown in FIG. 3, and each group of the identified strains are positive recombinant yeast strains, which indicates that the electric transformation of X33 was successful. The corresponding strain was selected for YPD (100. Mu.g/mLZeocin) plate streaking for subsequent inducible expression experiments.

8. Induction expression of high copy recombinant yeast

(1) A single colony with Zeocin resistance growing on a YPD plate is finely selected by a sterilizing gun head, and is selected in 20mL of BMGY liquid culture medium for activation culture, and is oscillated at 30 ℃ for overnight at 200r/min until the OD600 = 2-6, and the cells are in logarithmic growth phase;

(2) Centrifuging at 3000r/min at room temperature for 5min, collecting precipitate, re-suspending in 1mL BMMY, wrapping with four layers of clean gauze and two layers of newspaper, and shake culturing in 250mL triangular pyramid bottle;

(3) Adding 100% methanol to a final concentration of 1% every 24 hours, and performing induction culture;

(4) Samples were collected by culturing for 96 hours, and centrifuged, and the supernatant was immediately subjected to SDS-PAGE or stored at-80 ℃.

9. SDS-PAGE of recombinant yeast induced expression supernatant

And (3) carrying out SDS-PAGE protein electrophoresis on the supernatant of the recombinant saccharomycete induced expression 4d, setting a corresponding empty plasmid pPICZalpha A-X33 control group, simultaneously comparing with the mFeIFN-omega group, and observing the glycosylation modification condition of the target protein by the expression system, wherein the protein Loading Buffer is 5×loading Buffer, and the Loading amount is 12 mu L.

The results are shown in FIGS. 4, 5 and 6, and the FeIFN-omega-H, feIFN-omega-H-Mut 1, feIFN-omega-H-Mut 2, feIFN-omega-H-Mut 3, feIFN-omega-H-Mut 4, feIFN-omega-H-Mut 5, feIFN-omega-H-Mut 6 and FeIFN-omega-H-Mut 7 all realize high-efficiency expression in a Pichia pastoris expression system.

10. Purification recovery of expression products and PEG modification

In order to study the influence of pichia pastoris lysine mutation on the activity of the omega interferon of cats, purifying recombinant yeast induced expression supernatant, carrying out adsorption, elution and purification of proteins by combining His Tag and a nickel column affinity chromatography method, concentrating and dialyzing to 5-100 mM PB buffer with pH of 8.0-9.5 by using a 3-10 kD ultrafiltration membrane package, and finally concentrating to a protein solution with the concentration of 0.5-5 mg/mL;

the purified samples were added to a solution of dissolved mPEG-SCM at a molar mass ratio of 1 (2-30) (using mPEG-SCM having a molecular weight of 10-20kDa by ddH, respectively) ₂ O is dissolved to obtain the concentration of 50 mg/mL), and the mixture is stirred and reacted for 1 to 20 hours at the temperature of 4 to 30 ℃; then 0.1 to 0.5M glycine was added and the reaction was stopped for 5 to 20 minutes as shown in Table 5.

TABLE 5 reaction conditions for mPEG-SCM modification

And adding the obtained modified reaction solution into a DEAE column balanced by ultrafiltration dialysate, flushing the column with ultrafiltration dialysate with a volume of 2-6 times at a loading flow rate of 30-300 cm/h, and collecting a flow through peak to obtain the pure PEG-interferon solution.

The reaction solution was subjected to protein purification and determination of the screening activity, and the result of SDS-PAGE of the coupled product was shown in FIG. 7, and the PEG coupling reaction of mFeIFN-omega-H and mFeIFN-omega-H-Mut 1-7 was performed under the above conditions, whereby the coupling efficiency of mFeIFN-omega-H without lysine mutation was low, the SDS-PAGE analysis showed no visible PEG coupling product band, and the PEG coupling product was visible after PEG coupling of mFeIFN-omega-H-Mut 1-7 with lysine site mutation, mFeIFN-omega-H-Mut 1-5 was coupled to 1 mPEG-SCM of 20kDa, mFeIFN-omega-H-Mut 6 was coupled to 2 mPEG-SCM of 10kDa, and mFeIFN-omega-H-Mut 6 was coupled to 2 mPEG-SCM of 20 kDa.

11. Determination of biological Activity

Detecting the activity of target protein by CRFK-VSV trace lesion inhibition method, spreading the digested CRFK cells on 96-well cell culture plate, adding 100 μL of purified PEG-modified cat omega interferon and its mutant protein (mFeIFN-omega-H, mFeIFN-omega-H-Mut, PEG-mFeIFN-omega-H, PEG-mFeIFN-omega-H-Mut) before and after modification with 4-fold dilution per well after the cells are completely adhered, incubating at 37deg.C for 24H, and incubating with 100TCID per well ₅₀ VSV was challenged while setting a normal cell control group and a virus-only virus control group. After 48h cytopathic inhibition results were observed to inhibit 50% of cytopathic CPE50 at 1 activity unit of highest interferon dilution, as shown in the following table:

TABLE 6 biological Activity of purified samples

As can be seen from Table 6, the activities of the mFeIFN-omega-H-Mut 1 group, the mFeIFN-omega-H-Mut 5 group, the mFeIFN-omega-H-Mut 6 group and the mFeIFN-omega-H-Mut 7 group were higher than 3.0X10 ⁷ U/mg, significantly higher than the native mFeIFN-omega panel, tableMutation of the lysine locus under a certain condition is beneficial to improvement of the omega interferon activity of cats. The results of the protein activity measurement before and after PEG modification show that the PEG modification can properly reduce the activity of mFeIFN-omega-H and mFeIFN-omega-H-Mut thereof, but the activity is not obvious.

12. Determination of half-life of Cat omega interferon and its mutants

And (3) carrying out measurement of half-life of the cat omega interferon on purified samples of the cat omega interferon and the mutant thereof before and after PEG modification, wherein the measurement method adopts a cytopathic inhibition method to measure the relationship between the blood concentration and time of the cat omega interferon.

Taking 16 adult domestic cats with weight close to 4kg, injecting lyophilized mFeIFN-omega-H, mFeIFN-omega-H-Mut and PEG-mFeIFN-omega-H, PEG-mFeIFN-omega-H-Mut subcutaneously in a dose of 1mg/mL, taking blood from veins of 1H, 2H, 4H, 8H, 16H, 24H, 48H and 72H after injection, and centrifuging at 3000r/min for 5min after blood sample is coagulated at 4 ℃ and low temperature to obtain upper serum.

The concentration of the cat omega interferon in serum at different time points was determined by cytopathic inhibition, curve fitting was performed by using DAS pharmacokinetic software and relevant parameters were calculated, and the results were as follows:

TABLE 7 half-life of purified samples

As can be seen from Table 7, the half-lives of the mFeIFN-omega-H and mFeIFN-omega-H-Mut of each group are about 1.4H without PEG modification, the half-lives of the mFeIFN-omega-H-Mut are obviously improved compared with those of the deglycosylation treatment group, and the half-lives of the mFeIFN-omega-H-Mut 7 after PEG modification are improved by 16.9 times compared with those before modification. PEG modified felinine mutants with long half-lives can be efficiently provided using yeast expression systems and PEG modification processes.

In conclusion, the expression of the feline omega-interferon lysine mutant can have high expression quantity and high biological activity through the yeast expression, and the half-life of the PEG-feline omega-interferon lysine mutant can be obviously improved through the PEG modification process, so that the method has wide application prospect.

Claims (10)

1. A long-acting feline omega interferon mutant, characterized in that the long-acting feline omega interferon mutant comprises a mature peptide feline omega interferon mutant;

the mature peptide cat omega interferon mutant is obtained by performing site-directed mutagenesis on mature peptide cat omega interferon to obtain other amino acids;

the site-directed mutagenesis amino acid sites comprise more than one site of phenylalanine amino acid (F), asparagine (N) at position 67, leucine (L) at position 102, glycine (G) at position 123 and leucine (L) at position 154 of mature peptide cat omega interferon.

2. The long acting feline omega interferon mutant according to claim 1, wherein the additional amino acid comprises lysine, histidine, arginine, or an additional amino acid.

3. The long-acting feline omega interferon mutant according to claim 1, wherein the long-acting feline omega interferon mutant comprises the amino acids shown in sequence listing SEQ ID No.1 to SEQ ID No. 7.

4. A method for preparing a long-acting feline omega interferon mutant according to any one of claims 1 to 3, comprising the steps of:

1) Mature peptide cat omega interferon recombinant plasmid: connecting the mature peptide mao interferon mFeIFN omega with a protein tag, a stop codon and an enzyme cutting site, synthesizing the mixture on a plasmid vector after codon optimization, cloning the mixture to a pichia pastoris expression vector after double enzyme cutting, and connecting and converting the mixture to obtain a recombinant plasmid mFeIFN-omega-plasmid vector;

2) Amino acid mutation: carrying out site-directed mutagenesis on the obtained mature peptide cat omega interferon with amino acid to obtain mFeIFN-omega-Mut with lysine site;

3) Mutant expression: designing corresponding complementary primers by taking an mFeIFN-omega-plasmid vector as a template, purifying a product obtained by loop PCR amplification, performing DpnI enzyme digestion, performing seamless cloning kit treatment on the purified digestion product, then converting DH5 alpha, identifying positive bacterial strains by bacterial liquid PCR, extracting plasmids, sequencing and identifying positive plasmids, performing enzyme tangential digestion on the positive plasmids, introducing the positive plasmids into an expression host bacterium to obtain recombinant saccharomycetes, and performing induced expression, chromatographic purification and concentration to obtain a target protein, namely a cat omega interferon mutant recombinant protein;

4) PEG modification: the purified recombinant protein was combined with mPEG-SCM solution according to 1:

and (2-30) carrying out a molar mass ratio mixing reaction to modify, namely the pure PEG modified long-acting cat omega interferon mutant solution.

5. The method of claim 4, wherein the pichia pastoris expression vector of step 1) comprises one of ppiczα A, pPICZ α B, pPICZ α C, pGAPZ α A, pGAPZ α B, pGAPZ α C, pPIC9K, pPIC9, pHIL-S1, pYAM75P, pPIC3, pPIC3K, ppic3.5k, pHIL-D2, pACO815, pPICZA, pPICZB, pPICZC, pGAPZA, pGAPZB, pGAPZC, pPink-hc.

6. The method of claim 4, wherein the host bacteria in step 3) comprise Pichia pastoris host bacteria X33, GS115, KM71, SMD1168, SMD1165, SMD1163, Y-11430, M-G100-3, and Pichia pastoris.

7. The method of claim 4, wherein the mPEG-SCM solution of step 4) is prepared by passing ddH through mPEG-SCM having a molecular weight of 10-20kDa ₂ O was dissolved to give a 50mg/mL solution.

8. The method for producing a long-acting feline omega interferon mutant according to claim 4, wherein the condition of the mixing reaction in step 4) is stirring reaction at a temperature of 4 to 30 ℃ for 1 to 20 hours; then adding 0.1-0.5M glycine, and stopping the reaction for 5-20 minutes.

9. The method for preparing a long-acting interferon mutant of cat omega according to claim 4, wherein the modification method in step 4) is to add a mixed solution of recombinant protein and mPEG-SCM to a DEAE column equilibrated with ultrafiltration dialysate, load the sample at a flow rate of 30-300 cm/h, and collect the flow through peak after washing the column with 2-6 volumes of ultrafiltration dialysate.

10. A long acting feline omega interferon mutant of claim 1 for use in the preparation of an antiviral drug.

Images