CN108315344A

CN108315344A - VZV glycoprotein E genes expression vector and its restructuring yeast strains and application

Info

Publication number: CN108315344A
Application number: CN201810151764.9A
Authority: CN
Inventors: 肖杨; 王雨; 高媛; 刘昊智; 毛普加; 幕婷; 李津; 吴克
Original assignee: BRAVOVAX Co Ltd
Current assignee: BRAVOVAX Co Ltd
Priority date: 2018-02-14
Filing date: 2018-02-14
Publication date: 2018-07-24

Abstract

The invention discloses a kind of VZV (varicellazoster virus) glycoprotein E gene carrier for expression of eukaryon and its restructuring yeast strains and applications, the carrier is the connector of α gE fusions and pPink HC, and α gE fusions are the fusion of the gene complete sequence and alpha signal peptide of VZV glycoprotein Es.It is capable of the glycoprotein E of successful expression varicellazoster virus in the expression system of Pichia pastoris disclosed by the invention, lays a good foundation for follow-up protein immunogenic detection and the research and development of the high efficient expression in Pichia pastoris and varicella zoster vaccine.

Description

VZV glycoprotein E genes expression vector and its restructuring yeast strains and application

Technical field

The present invention relates to genetic engineering fields, are to be related to one kind can be used for expressing VZV (varicella-zoster diseases specifically Poison) glycoprotein E gene expression vector and its recombinant yeast and application.

Background technology

Varicella virus (varicella-zoster virus, VZV) is Herpesvirus (Herpesviridae) Alphaherpesvirinae member is a kind of DNA virus of 150~200nm of diameter, is by core on morphology The concentric circles structure that sour heart, protein coat and coating are constituted, symmetrical positive 20 face that surface is made of 162 each shell particles Body has the feature of thermophilic skin and nerve, and a kind of double-stranded DNA virus of frequently-occurring disease in child and elderly population, is a kind of morbidity Soon, the high disease of infectiousness.It can cause two kinds of common diseases of varicella and herpes zoster, can also cause encephalitis, pneumonia etc. serious simultaneously Send out disease；And the virus lays dormant of a small amount of remaining is in internal nerve cell after patient's recovery from illness, the meeting again when body hypoimmunity Mass propagation, so as to cause the disease herpes zoster (herpes zoster) of painful.In the individual of immunocompromised host, VZV senses The incidence and case fatality rate of dye are all very high.Disease caused by VZV and its associated sequelae have been increasingly becoming important public health Problem, and it is increasingly subject to the attention of people.

It is that one kind includes 72 openings to have one or more layers the coating containing lipoprotein, entire VZV genomes outside VZV shells Reading frame about encodes 67 kinds of albumen, can encode the sequence of 8 kinds of glycoprotein gE, gB, gH, gI, gC, gL, gK and gM, wherein sugar Albumen E (glycoprotein E, gE) is a kind of late structural proteins, and molecular weight is larger, by ORF68 gene codes, belongs to I type Memebrane protein, be generate infectious viral particle required glycoprotein be also virus in infection cell content highest, it is antigenic most Strong glycoprotein is widely present in the cell membrane and cytoplasm of the surface of VZV particles and host cell, containing on peplos Highest is measured, is first glycoprotein identified by immune system, can induce cellular immunity and humoral immunity.Virus it is different at The ripe stage exists in the form of different high sugar content peptides, is the important target spot of humoral immunity and cellullar immunologic response.Glycoprotein E includes 623 amino acid residues, including two antigenic determinant code area e1 and c1, in these antigenic determinants of the VZV intercolumniations of variation It is stable, therefore VZV glycoprotein Es have stable epitope, there is higher conservative, is that proper vaccine antigen is candidate Unit.Wherein gE and in the patients serum of varicella and herpes zoster on the cycle of recovery, VZV antibody it is most important be directed to gE, It induces body to generate humoral immunity and cellular immunity, to protect individual to resist the infection of virus.Under normal circumstances, it utilizes The albumen of prokaryotic expression often will appear due to lack disulfide bond formation, phosphorylation and it is glycosylation modified, plus Work is used so that finally expressed albumen exists with inactive or active lower inclusion bodies, this expression to albumen And subsequent purifying is all prodigious obstacle.KR100434023B1 is disclosed expresses a kind of big quantity with animal cell line A kind of varicella virus of glycoprotein (VZV).Particular by a kind of two-cistron expression vector, Plced4gpiis containing a kind of a kind of albumen gpiis of gene code is generated described by the hydrophobicity site of removing The glycoprotein of VZV of carboxyl-tenninus a kind of, II b of GP, by the 699th to the 868th amino acid and dihydro leaf Sour reductase (dhfr) gene in two gene is adjusted by a promoter.(the Chinese storehouses CHO of the animal cell line Mouse ovary)-gpiis#3 (KCTC~2A13abp) is to generate to carry with bicistronic mRNA expression by the CHO of the cell line of conversion Body plced4gpiis.And the method for expressing the surface antigen glycoprotein, specially：Cultivate zooblast line CHO Contain methotreaxate (MTX) in the culture medium of (Chinese hamster ovary)-gpiis#3 (KCTC~2A13abp)；Increasing should The MTX of concentration induces the expression DHFR genes and gpiis genes of the present invention in the medium by step；Expressed by separation Albumen gpiis from the culture medium cultivated.This method is mainly expressed by animal cell line, and the expression system price is high Expensive, production cost is high and the period is long.CN102517302A discloses a kind of recombinant expression varicella virus truncated-type sugar The method and its application of albumen E.This method is will to remove transmembrane region and intracellular region and add the varicella-zoster of His labels In the channel genes host cell of viral (VZV) truncated-type glycoprotein E (gpE), recombinant varicella-zoster disease is obtained through expression Malicious truncated-type glycoprotein E.The expression helps to improve the expression quantity of destination protein, simplifies the purification work in downstream, can Relatively easily realize albumen large-scale production, and batch between stable quality.It is available using recombinant protein of the present invention as capture antigen It is detected in the indirect ELISA of plasma sample moderate resistance varicella virus specific immunoglobulin, clinical diagnosis can be improved The accuracy of VZV infection, and for other fields for needing VZV specific immunoglobulins to carry out high-throughput detection.The method For prokaryotic expression and it is mainly used for VZV infection detections, and not applicable preparation VZV immune compositions.Li Fu people et al. disclose one Kind VZV glycoprotein E genes are expanded with PCR method, and is cloned into eukaryotic expression vector pcDNA3.1 and with double digestion and survey Sequence method is identified.As a result the target gene expanded includes the glycoprotein E gene of overall length, length about 1.9kb；And it successfully builds Glycoprotein E gene recombinant expression carrier (practical hospital clinical magazine, Practical Journal of Clinical Medicine, 02 phase in 2006, ISSN：1672-6170).Yi Xing rising suns et al. disclose a kind of build and contain VZV g E extracellular domains The eukaryon expression plasmid p CDNA3.1-g E of gene, liposome transfection COS-7 cells after sequencing filter out stable table through G418 Up to the cell strain of VZV gE.Using the mRNA of RT-PCR methods detection VZV gE, Western blot and indirect immunofluorescence inspection The immunoreactivity of gE is surveyed, expression product is coated with elisa plate after Ni2+-NTA column purifications, to 127 parts of 0~10 years old normal children VZV-Ig G antibody levels are detected in serum.As a result the expression extracellular domain genes of VZV gE can be stablized by successfully filtering out COS-7 cell strains, RT-PCR detect the mRNA of gE, are identified through Western blot and indirect immunofluorescence, and gE has apparent Immunoreactivity, it is about 0.632mg/mL to have gE fusion proteins, expression quantity in COS-7 cell strains and its culture supernatant, Purity is about 90%.ELISA experiments have detected VZV-Ig G antibody, total positives rate in 127 parts of 0~10 years old children serums and are 81.89%, specificity and sensitivity are respectively 93.75% and 88.24% (Medical University Of Anhui's journal, Acta Universitatis Medicinalis Anhui, 03 phase in 2015, ISSN：1000-1492).Li Chunming et al. discloses one Kind infects human diploid cells (2BS plants) with Oka plants of VZV (VZV-Oka), extracts genomic DNA, using it as template, PCR amplification GE537 target fragments are cloned into carrier pCI-neo, structure eukaryotic expression recombinant plasmid p CI-neo-g E537-His.Largely Plasmid is extracted after amplification, transfects 293FT cells, transient expression obtains destination protein gE537-His through ni-sepharose purification, Western blot and ELISA method are identified.As a result it is identified through double digestion and sequencing, eukaryotic expression recombinant plasmid pCIneo-g E537-His is built successfully.200mmol/L imidazole elutions are the best imidazole concentration for eluting destination protein.Purified product can be with The anti-gE glycoprotein monoclonal antibody of mouse is specifically bound at relative molecular mass about 90 000, and can be anti-with mAb-10, mAb-12 GE monoclonal antibodies react (Products in China magazine, Chinese Journal of Biologicals, 11 phases in 2016, ISSN：1004-5503).Yi Xingxu discloses a kind of clone of VZVgE genes extracellular domain, expression, specially：From clinic The skin vesica liquid of acquisition Patients with Herpes Zoster is seeded to single layer human embryonic fibroblast (human embryo Fibroblast, HF), carry out virus purification；Cells characteristic lesion effect (Cytopathic is carried out to the Strain of separation Effect, CPE), indirect immunofluorescence and DNA sequencing identification.The VZV clinical separation strain in vitro cultures that will confirm that, PCR amplification VZV g E gene extracellular domain segments build prokaryotic expression plasmid g E-p ET-32a (+) and eukaryon expression plasmid g E-p respectively CDNA3.1/myc-His (-) converts prokaryotic plasrnid to E.coli BL21 (DE3) competent cell, with isopropyl after sequencing Thio β-D- galactosides (Isopropyl- β-D-thiogalactopyranoside, IPTG) induction, it is former to obtain VZV g E The fusion protein of nuclear expression.The specificity that fusion protein is identified by SDS-PAGE electrophoresis, Western blot, utilizes Ni2+- NTA columns carry out purifying and on-column refolding to expression albumen.By eucaryon plasmid liposome mediated transfection to COS-7 cells, warp G418 filters out the cell strain for stablizing expression VZV g E proteins, and expression product is through Ni2+-NTA column purifications；It is detected by RT-PCR The immunoreactivity of m RNA, the Western blot and indirect immunofluorescene assay g E fusion proteins of VZV g E genes.Respectively With after purification prokaryotic expression g E proteins and eukaryotic expression g E proteins new zealand rabbit is immunized, obtain more grams of rabbit-anti VZV g E Grand antibody (Medical University Of Anhui, large rich paper).Above-mentioned expression is expressed by animal cell line, the expression system valence Lattice are expensive, and production cost is high and the period is long.

And as eucaryote, pichia yeast expression system has many advantages of Higher eukaryotic expression system, not only It is Protein processing, folding, posttranslational modification, also there is easy to operate, quick, cheap, and the higher advantage of expression.Due to The deficiency of the characteristics of glycoprotein E gene of varicella virus and other expression systems, with pichia yeast expression system table Glycoprotein E gene up to varicella virus can be used as a kind of possible selection and approach, but yet there are no varicella The glycoprotein E gene of the herpesviral report of successful expression and research in pichia yeast expression system.

Invention content

In view of the above-mentioned problems existing in the prior art, an object of the present invention is to provide a kind of varicella-zoster disease Malicious glycoprotein E gene expression vector, to realize the glycoprotein E successful expression of varicella virus.

For achieving the above object, the technical solution adopted by the present invention is as follows：

VZV glycoprotein E genes (sketching gE afterwards) expression vector, the carrier are the company of α-gE fusions and pPink-HC Junctor, wherein α-gE fusions are the fusion of the gene complete sequence and alpha signal peptide of VZV glycoprotein Es.

Preferably, the α-gE fusions such as SEQ ID NO：Shown in 6.

Preferably, the gene complete sequence of the VZV glycoprotein Es such as SEQ ID NO：Shown in 1.

As another object of the present invention, the present invention provides a kind of expression vector, can be used for expressing VZV glycoprotein E genes, The expression vector is built as follows：

Step A, design primer separately designs according to the multiple cloning sites sequence on gE gene orders and pPink-HC and draws Object adds I restriction enzyme site of EcoR I and Sph respectively to realize at target gene segment both ends；

Step B, recombinant vector is built, gE genetic fragments after amplification and pPink-HC are connected after double digestion, will be connected Product selects positive clone molecule after sequencing identification is correct through culture to obtain the final product.

Preferably, step A design of primers is：The ends F primer 5' are equipped with EcoRI restriction enzyme sites, and the ends R primer 5' are equipped with I enzymes of Sph Enzyme site, and primer XF, XR carry out PCR amplification alpha signal peptide, GF, GR carry out PCR amplification gE, X-GF, X-GR and carry out PCR amplification α-gE fusions.

More preferably：

XF：CGGAATTCGAAACGATGAGATTTCCTTCAATTTTTAC, the primer sequence such as SEQ ID NO：Shown in 2.

XR：AcaactggcttgttaacagtaccTCTTTTCTCGAGAGATACCCC, the primer sequence such as SEQ ID NO：Shown in 3.

GF：GAA GGGGTATCTCTCGAGAAAAGAggtactgttaacaagccagttgt, the primer sequence such as SEQ ID NO：Shown in 4.

GR：ACATGCATGCTTATCTGATCAATGGGGAAGTAC, the primer sequence such as SEQ ID NO：Shown in 5.

X-GF：CGGAATTCGAAACGATGAGATTTCCTTCAATTTTTAC, the primer sequence such as SEQ ID NO：2 institutes Show.

X-GR：ACATGCATGCTTATCTGATCAATGGGGAAGTAC, the primer sequence such as SEQ ID NO：Shown in 3.

Preferably, the concrete operations of step A are：

A1, using pGAPZ α A-mix as template, primer XF, XR carries out PCR amplification alpha signal peptide, the PCR product profit after reaction With 1% agarose gel electrophoresis test strip size, and the Ago-Gel of correct band is cut, is returned with plastic recovery kit Receive purpose α segments；

A2, using pGAPZ α A-mix as template, GF, GR carry out PCR amplification gE, and PCR product after reaction utilizes 1% fine jade Sepharose electrophoresis detection stripe size, and the Ago-Gel of correct band is cut, with plastic recovery kit recycling purpose gE Segment；

A3, using gE segments and alpha signal peptide fragment as template, primer X-GF, X-GR carries out fusion DNA vaccine amplification α-gE and merges base Cause, the PCR product after reaction utilizes 1% agarose gel electrophoresis test strip size, and cuts the agarose of correct band Gel recycles purpose α-gE fusion segments with plastic recovery kit.

Preferably, the concrete operations of step B are：Distinguish double digestion recycling step A with restriction enzyme EcoR I and Sph I Gained α-gE fusions fragment products and yeast vector pPink-HC, after agarose gel electrophoresis detection digestion is complete, glue returns Receive endonuclease bamhi；α-gE fusions segments after recycling are mixed with carrier pPink-HC segments, in the effect of T4 ligases Underlying 16 DEG C of connections overnight, then connection product are converted into bacillus coli DH 5 alpha competent cell, and coating contains Amp resistances On LB tablets, 37 DEG C of overnight incubations；Picking positive clone molecule carries out bacterium colony PCR, the whether correct table of sequencing analysis after digestion identification It reaches.

Preferably, the LB tablets are the LB tablets containing 100 μ g/mL Amp.

Another object of the present invention is to provide a kind of construction method of VZV glycoprotein E genes (sketching gE afterwards) expression vector, Specifically comprise the following steps：

Step A, design primer separately designs primer according to the multiple cloning sites sequence on gE and pPink-HC, to realize I restriction enzyme site of EcoR I and Sph is added respectively at target fragment both ends；

Step B, α-gE gene orders are merged, password is carried out under the premise of not changing amino acid sequence with gE original series Son optimization；Using pGAPZ α A-mix as template, gE is expanded with primer XF, XR amplification alpha signal peptide and with GF, GR respectively；Again with gE Segment and alpha signal peptide fragment are template, and primer X-GF, X-GR carry out fusion DNA vaccine and expand α-gE fusions；

Step C, recombinant vector is built, is expanded respectively as template using α-gE fusions and pPink-HC obtained by step B Increase, the PCR product after reaction is recycled through plastic recovery kit；Segment and pPink-HC will be recycled through restriction enzyme EcoR I With Sph I carry out double digestion it is complete after, glue recycle endonuclease bamhi；GE segments are mixed with pPink-HC through T4 ligases after recycling 16 DEG C of connections are overnight；Connection product is converted into bacillus coli DH 5 alpha competent cell again, is coated on flat containing Amp resistances On plate, 37 DEG C of overnight incubations；Picking positive clone molecule carries out bacterium colony PCR, and sequencing analysis is identified after digestion identification；Complete the table Up to the structure of carrier, gained recombinant expression carrier is named as pHC-gE, i.e. yeast recon.

As the another embodiment of the object of the invention, above-mentioned VZV glycoprotein E genes (sketching gE afterwards) expression vector, The expression vector obtains as follows：

Step a, according to such as SEQ ID NO：Varicella virus glycoprotein E shown in 1 after codon optimization Gene complete sequence, the multiple cloning sites sequence design on yeast expression vector pGAPZ α A-mix and/or alpha signal peptide draws Object XF, XR, GF, GR, X-GF and X-GR, the ends F primer 5' are equipped with EcoRI restriction enzyme sites, and the ends R primer 5' are equipped with the I digestion positions Sph Point；After primer XF, XR amplification alpha signal peptide and GF, GR carry out PCR amplification gE, by gained PCR product with gE segments and alpha signal peptide Segment is template, and primer X-GF, X-GR carry out PCR amplification, and PC products recycle α-gE fusion segments through glue again；

Step b, it after α-gE fusions segments obtained by step a being expanded recycling respectively with pPink-HC again, then uses respectively Restriction enzyme EcoR I and Not I recycles endonuclease bamhi after carrying out double digestion, and the gE segments after digestion are mixed with pGAPZ α A It closes and connects to obtain a connection product through T4 ligases, then gained connection product is converted to bacillus coli DH 5 alpha competent cell, then Picking positive clone molecule carries out colony PCR amplification to get the recombinant expression carrier；

Wherein,

XF：CGGAATTCGAAACGATGAGATTTCCTTCAATTTTTAC

XR：acaactggcttgttaacagtaccTCTTTTCTCGAGAGATACCCC

GF：GAA GGGGTATCTCTCGAGAAAAGAggtactgttaacaagccagttgt

GR：ACATGCATGCTTATCTGATCAATGGGGAAGTAC.

X-GF：CGGAATTCGAAACGATGAGATTTCCTTCAATTTTTAC

X-GR：ACATGCATGCTTATCTGATCAATGGGGAAGTAC.

Preferably, the extracted total DNA of above-mentioned expression vector carries out PCR identifications, PCR reaction the primers be respectively X-GF and X-GR。

Another goal of the invention of the present invention is to provide a kind of recombination yeast strain for expressing gE, and the yeast strains are to express such as SEQ ID NO：The yeast strains Pichia pastoris S1 of the gene complete sequence of VZV glycoprotein Es shown in 1.

Preferably, the yeast strains are the yeast strains containing any of the above-described VZV glycoprotein E gene expression vectors Pichia pinkTM S1。

It is a further object of the present invention to provide a kind of recombination yeast strain, the yeast strains can effective expression gE, the yeast strains It screens and obtains by the following method：Any of the above-described recombinant expression carrier pHC-gE is converted to Escherichia coli and is again applied to bacterium solution Electrotransformation after plasmid, then linearized single endonuclease digestion, recycling is cultivated and extracts after LB tablet cultures to single bacterium colony, until competent yeast It is cultivated in constant-temperature table after in cell；Bacterium solution is coated on again and is grown containing YPD tablets culture to single bacterium colony；Picking individual colonies It is protected from light shaking flask culture through YPD fluid nutrient mediums to detect through sequencing again, identifies sequence correctly up to identified recombination ferment after sequencing Mother strains.

Preferably, the yeast is Pichia yeast cell Pichia pastoris S1, preferably Pichia pinkTM S1。

Preferably, the Escherichia coli are DH5 α or TOP10.

Further, which obtains by the following method：

Step i, above-mentioned recombinant expression carrier pHC-gE is converted into Escherichia coli, then by bacterium solution be applied to containing The LB tablets culture of 100ug/mL Amp largely extracts plasmid after carrying out shaking flask culture to single bacterium colony；Through restriction enzyme A vr II carries out linearisation single endonuclease digestion recycles digestion carrier after linearization for enzyme restriction is complete；By the carrier electrotransformation of linearisation to yeast sense In by state cell, the sorbitol solution for the 1M that precooling is added after the 5ms that shocks by electricity is cultivated in 28 DEG C of constant-temperature tables；Bacterium solution EP is managed again 1h is cultivated in 28 DEG C of constant-temperature tables, is coated and is protected from light culture 3- on PAD tablets, tablet is positioned in 28 DEG C of constant incubators 5d is grown to single bacterium colony；

Step ii, the transformant grown after conversion is protected from light shaking flask culture through YPD fluid nutrient mediums, is carried through Yeast genome Kit is taken to carry out the extracting of total DNA to the transformant bacterium solution, it is template to take a small amount of total DNA, and PCR reactions are carried out to transformant, Identification sequence is correctly up to identified restructuring yeast strains after sending PCR product to sequencing.

Preferably, cultivation temperature is 20~30 DEG C, most preferably 28 DEG C in step ii.

It is a further object of the present invention to provide the applications of above-mentioned recombination yeast strain, by above-mentioned yeast strains for expressing varicella- Herpes zoster virus glycoprotein E gene.

Preferably, expression product obtained by above-mentioned yeast strains is used to prepare to the medicine of immune response of the induction for VZV antigens Object.

Preferably, above-mentioned expression product is used to prepare the drug that protection individual prevents VZV infection.

Preferably, above-mentioned expression product can be used for preparing the medicine for having infected VZV individuals.

As a preferred embodiment, above-mentioned expression product is used to prepare the medicine for having infected VZV human bodies.

It to sum up states, the present invention realizes high efficient expression of the VZV glycoprotein E genes in yeast expression system, is not changing In the case of its amino acid sequence, codon is optimized according to the codon-bias of yeast and synthesizes VZV glycoprotein E genes, and structure Carrier for expression of eukaryon pHC-gE is built with this again after building α-gE fusion segments, and is converted to Pichia pastoris Pichia In pinkTM S1 bacterial strains, after the recon shaking flask expression after screening, it is detected using SDS-PAGE and Western-blot Protein expression situation.The results show that being detected by SDS-PAGE and Western-blot, in the recon shaking flask that screening obtains The destination protein band that size is about 60kD is detected in expression supernatant, realizes VZV glycoprotein E genes in Pichi strain In secreting, expressing, lay a good foundation to study the immunogenicity of VZV and the correlation research such as research and development of vaccine.

The present invention has the advantage that compared with prior art：

1. the yeast expression vector that the present invention selects is secreted expression carrier, seldom oneself protein is only secreted, And there was only a small amount of albumen in Pichia pastoris minimum growth medium, therefore the foreign protein secreted is the main of albumen in culture medium Ingredient is conducive to late protein purification step in this way；

2. protein immunogenic obtained by expression vector provided by the present invention and yeast strains the experimental results showed that, the present invention carries The antibody that more high titre can be obviously generated using the gE albumen of restructured Pichia pastoris in expression as the immune mouse of antigen supplied, and it is bright It is aobvious to be better than commercial available vaccines or the albumen by coli expression system；

3. yeast expression system is simple for process, cost is relatively low, it is convenient for the amplification of the follow-up pilot-scale of enterprise, has extensive The foreground and advantage of popularization.

Description of the drawings

Fig. 1 is the pPink-HC plasmid insertion point figures of the present invention；

Fig. 2 is gE gene PCRs amplification identification electrophoretogram in the embodiment of the present invention 1；

Fig. 3 is agarose gel electrophoresis figure in the embodiment of the present invention 2；

Fig. 4 is the Supernatant samples Westernblot testing result figures for having in 2 step 3 of the embodiment of the present invention clear band；

Fig. 5 be 2 step 4 of the embodiment of the present invention in it is concentrated after sample SDS PAGE electrophoretograms；

Fig. 6 be 2 step 4 of the embodiment of the present invention in it is purified after sample SDS PAGE electrophoretograms；

Fig. 7 be 2 step 4 of the embodiment of the present invention in it is purified after sample Westernblot testing result figures.

Specific implementation mode

The present invention is made further in detail, completely to illustrate with reference to embodiment, but is not construed as the limit to the present invention It is fixed.Reagent used below or equipment are commercial product, unless otherwise specified, are operated to specifications, this will not be repeated here.

Experiment material is used in following embodiments：

Yeast eukaryon recombinant vector pGAPZ α A-mix, carrier pPink-HC Escherichia coli (Escherichia coli) DH5 α and S1 plants of Pichia yeast (Pichia pastoris) Pichia pinkTM is purchased from Thermo Fisher；

Primer sequence synthesis, DNA sequencing are completed by the Wuhan bio tech ltd Qing Ke；

RTaq archaeal dna polymerases, DL2000, DL5000 are purchased from TaKaRa treasured bioengineering (Dalian) Co., Ltd；

Restriction enzyme EcoR I, Sph I, T4 ligases are purchased from New England Biolabs (Britain) company；

Ago-Gel DNA QIAquick Gel Extraction Kits, PCR product purification kit and Plasmid DNA Mini Kit are purchased from Axygen companies

Peptone, yeast extract are purchased from OXIOD companies；

Agarose is purchased from GENVIEW companies；

YNB is purchased from sigma companies；

MOUSE ANTI-VARICELLA ZOSTER MONOCLONAL ANTIBODY are purchased from Milipore companies of the U.S.；

Goat anti-mouse igg-HRP is purchased from the green skies company in Shanghai；

PBS is purchased from Thermo Fisher；

Aluminium adjuvant is purchased from Thermo Fisher.

The preparation of 1 recombinant vector of embodiment and construction method

1, the synthesis of VZV gE gene orders

According to preference of the yeast codon, codon is carried out under the premise of not changing amino acid sequence to gE original series Gene nucleotide series SEQ ID NO.1 are obtained after optimization.

SEQ ID NO.1：

ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGT ATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTC CGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGT ACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGG GTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCT TGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAAC GTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAA GAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTT GCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGCTTAAAACATACAACATGCTTTCAAG ACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGT AAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGA GATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACATGCGCGGCT CCGATGGTACGTCTACCTACGCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCA GTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTT TAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCA TCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCAT ATGAATTCCGGTTGTACATTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACA TGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGG GCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCAT GTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCC AACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAATTACCCCCGTAAACCCCGGAACGTCACCACTTATAC GATATGCCGCATGGACCGGAGGGCTTGCA

2, design primer

According to the multiple cloning sites sequence on above-mentioned gE genes complete sequence and yeast expression vector pPink-HC point Analysis separately designs primer, and the plasmid insertion point figure being inserted into after expression vector is as shown in Figure 1：

XF：SEQ ID NO.2：CGGAATTCGAAACGATGAGATTTCCTTCAATTTTTAC

XR：SEQ ID NO.3：acaactggcttgttaacagtaccTCTTTTCTCGAGAGATACCCC

GF：SEQ ID NO.4：GAA GGGGTATCTCTCGAGAAAAGAggtactgttaacaagccagttgt

GR：SEQ ID NO.5：ACATGCATGCTTATCTGATCAATGGGGAAGTAC

Above-mentioned primer is synthesized by the Wuhan bio tech ltd Qing Ke, is added respectively at target fragment both ends with realizing I restriction enzyme site of EcoR I and Sph.

3, construction recombination plasmid pHC-gE

3.1 amplification α-gE fusion segments

Using pGAPZ α A-mix as template, primer XF, XR carry out PCR amplification alpha signal peptide, and the PCR product after reaction utilizes 1% agarose gel electrophoresis test strip size, and the Ago-Gel of correct band is cut, it is recycled with plastic recovery kit Purpose α segments.

Using pGAPZ α A-mix as template, GF, GR carry out PCR amplification gE, and the PCR product after reaction utilizes 1% agarose Detected through gel electrophoresis stripe size, and the Ago-Gel of correct band is cut, recycle purpose gE segments with plastic recovery kit.

Using gE segments and alpha signal peptide fragment as template, primer X-GF, X-GR carry out fusion DNA vaccine and expand α-gE fusions, PCR product after reaction utilizes 1% agarose gel electrophoresis test strip size, and the agarose for cutting correct band is solidifying Glue recycles purpose α-gE fusion segments, wherein α-gE fusions nucleotide sequence such as sequence table with plastic recovery kit Shown in SEQ ID NO.6.

SEQ ID NO.6：

CGGAATTCGAAACGATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAG CTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTA GAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTAT TGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGGTACTGTTAACAAGCCAGTTGTTGGTGTTT TGATGGGTTTCGGTATCATCACTGGTACTTTGAGAATCACTAACCCAGTTAGAGCTTCCGTTTTGAGATACGACGAC TTCCACATTGACGAGGACAAGTTGGACACTAACTCCGTTTACGAGCCTTACTACCACTCTGATCACGCTGAATCCTC TTGGGTTAACAGAGGTGAATCCTCCAGAAAGGCTTACGACCACAACTCCCCATATATCTGGCCAAGAAACGACTACG ACGGTTTCTTGGAAAACGCTCATGAACACCACGGTGTTTACAACCAGGGTAGAGGTATTGACTCCGGTGAGAGATTG ATGCAGCCAACTCAAATGTCTGCTCAAGAGGACTTGGGTGACGACACTGGTATTCACGTTATCCCAACTTTGAACGG TGATGACAGACACAAGATCGTTAACGTTGACCAGAGACAGTACGGTGACGTTTTCAAGGGTGACTTGAACCCAAAGC CACAGGGTCAAAGATTGATCGAGGTTTCCGTTGAAGAGAACCACCCATTCACTTTGAGAGCTCCAATCCAGAGAATC TACGGTGTTAGATACACTGAGACTTGGTCTTTCTTGCCATCCTTGACTTGTACTGGTGATGCTGCTCCAGCTATCCA GCACATTTGTTTGAAGCACACTACTTGTTTCCAGGACGTTGTTGTTGACGTTGACTGTGCTGAGAACACAAAAGAGG ACCAGTTGGCTGAGATCTCCTACAGATTCCAGGGTAAGAAAGAGGCTGACCAGCCTTGGATCGTTGTTAACACTTCC ACTTTGTTCGACGAGTTGGAGTTGGACCCACCAGAAATTGAACCAGGTGTTTTGAAGGTTTTGAGAACTGAGAAGCA GTACTTGGGAGTTTACATCTGGAACATGAGAGGTTCCGACGGTACTTCTACTTACGCTACTTTCTTGGTTACTTGGA AGGGTGACGAAAAGACTAGAAACCCAACTCCAGCTGTTACTCCACAACCTAGAGGTGCTGAATTTCACATGTGGAAC TACCATTCCCACGTTTTCTCCGTTGGTGATACTTTCTCCTTGGCTATGCACTTGCAGTACAAGATTCACGAGGCTCC ATTCGACTTGTTGTTGGAGTGGTTGTACGTTCCAATCGACCCTACTTGTCAGCCAATGAGATTGTACTCCACTTGTT TGTACCACCCAAACGCTCCACAATGTTTGTCCCACATGAACTCCGGTTGTACTTTCACTTCTCCACACTTGGCTCAG AGAGTTGCTTCCACTGTTTACCAGAACTGTGAGCACGCTGACAACTACACTGCTTACTGTTTGGGTATCTCCCACAT GGAACCATCCTTCGGTTTGATCTTGCACGACGGTGGTACTACTTTGAAGTTCGTTGACACTCCAGAGTCCTTGTCCG GTTTGTATGTTTTCGTTGTTTACTTCAACGGTCACGTTGAGGCTGTTGCTTACACAGTTGTTTCTACTGTTGACCAC TTCGTTAACGCTATCGAAGAGAGAGGTTTCCCACCAACTGCTGGTCAACCACCAGCTACTACTAAGCCAAAAGAGAT CACTCCAGTTAACCCAGGTACTTCCCCATTGATCAGATAAGCATGCATGT

Above-mentioned PCR reaction systems are：dd H₂O 22uL, primerstar 25uL, X-GF1, X-GR1 each 1.5uL, α letter Number Peptide D NA segments 0.1uL, gE DNA fragmentation 0.1uL.

3.2 distinguish double digestion with restriction enzyme EcoR I and Sph I recycles 3.1 gained α-gE fusion fragment products With yeast vector pPink-HC, after agarose gel electrophoresis detection digestion is complete, glue recycles endonuclease bamhi.By the α-gE after recycling Fusion segment is mixed with carrier pPink-HC segments, and 16 DEG C of connections are set under the action of T4 ligases overnight, then will connection Product is converted into bacillus coli DH 5 alpha competent cell, is coated on the LB tablets containing 100 μ g/mL Amp resistances, 37 DEG C of trainings It supports overnight.Picking positive clone molecule carries out bacterium colony PCR reactions, reaction system：dd H₂O 22uL, primerstar 25uL, X- GF1, X-GR1 each 1.5uL, bacterium solution 0.2uL.Digestion identifies that the results are shown in Figure 2：There is the specificity of 1 treaty 150bp in electrophoresis Band, be consistent (note with target gene fragment size：M：DL5000；1~3：Different bacterium colony PCR products).Send recombinant plasmid to survey Sequence, sequencing result show that the plasmid sequence is consistent with gene order, are confirmed as expressing correct recon, obtained recombinant plasmid life Entitled pHC-gE.

2 recombination yeast strain preparation of embodiment and its detection of expression

1, recombinant plasmid pHC-gE yeast strains convert

After 1 gained recombinant plasmid pHC-gE of embodiment is imported bacillus coli DH 5 alpha progress large amplification, plasmid is extracted.It takes Suitable recombinant plasmid pHC-gE carries out linearisation single endonuclease digestion, agarose gel electrophoresis using restriction enzyme A fl II to it After detection linearization for enzyme restriction is complete, solution recycling is carried out to digestion carrier.Prepare fresh Pichia pinkTM S1 yeast senses By state cell, by the carrier electrotransformation of linearisation to Pichia pinkTM S1 competent yeast cells, electricity turns condition and is： 2000V, 25 μ F, 400 Ω, shock by electricity 5ms.It is rapidly added the 1M sorbitol solutions of 1mL precoolings after electric shock, shifts bacterium solution after mixing Into 1.5mL EP pipes, it is put into 28 DEG C of constant-temperature tables and cultivates 1h.Bacterium solution 100- after taking target gene and zero load to convert respectively 200 μ L are coated on PAD tablets, and tablet is positioned in 28 DEG C of constant incubators and is protected from light culture 3-5d and grows to single bacterium colony.

2, the screening of recombinant yeast

The transformant grown on rear plate is converted in 2 step 1 of picking embodiment in YPD fluid nutrient mediums, 28 DEG C of shaking flasks Culture extracts transformant bacterium solution total DNA with Yeast genome extracts kit, and it is template to take a small amount of DNA, is carried out to transformant PCR reacts (reaction system：dd H₂O 22uL, primerstar 25uL, X-GF1, X-GR1 each 1.5uL, total DNA 0.2uL), Agarose gel electrophoresis detect PCR product in whether purposeful band.The results are shown in Figure 3, and agarose gel electrophoresis result is aobvious Show about there is a specific band, clip size to be consistent with expection at 1500bp；In its Fig. 3：M is DL5000, and 1~8 is ferment Female recon total DNA PCR product, 9 be positive control.The plasmid sequence and gene order one are identified after sending PCR product to sequencing It causes, is confirmed as correct recon.The transformant of the purposeful segment of picking as identifies obtained recon.

3, the expression and identification of recombinant yeast

Restructuring yeast strains after step 2 is identified are inoculated in YPD plate streakings, and incubator culture is to list under the conditions of 28 DEG C Bacterium colony is grown.Single bacterium colony is taken to be seeded in fresh BMGY fluid nutrient mediums, 28 DEG C, shaking flask culture is extremely under the conditions of 200rpm OD600=6~8 collect thalline under aseptic condition and abandon supernatant, and it is 20 or more that thalline, which is resuspended to OD600, with BMMY culture mediums, is added Add 1% methanol induction, it is primary at interval of addition for 24 hours.Take culture medium Supernatant samples after induction 72h, using SDS-PAGE and Western-blot detects each period protein expression situation.

It is random select PCR and be accredited as positive transformant and be connected to shaking flask in YPD fluid nutrient mediums express, take culture after 72h Base supernatant carries out SDS PAGE electrophoresis and is carried out with Anti-His Tag Mouse Monoclonal Antibody Westernblot is detected, and the results are shown in Figure 4, and M is protein Marker in Fig. 4, and 1~4 is recon supernatant (S1-pHC- GE) 5 be negative control (S1-pHC) Mouse Anti-Varicella Zoster Monoclonal Antibody；It swims at No. 1 Occurring apparent clearly band, 2,3, No. 4 swimming lanes in road has mild band, as a result shows albumen size position and is expected unanimously, Relative molecular mass is about 60 × 10³。

4, gE protein concentrations and purifying

Isometric saturated ammonium sulfate solution is slowly added in the culture medium supernatant of collection in 4 DEG C of precipitates overnights. 12000rpm, 4 DEG C, centrifugation 10min collection ammonium sulfate precipitations, abandon supernatant.50 are pressed with 20mM PH8.0Tris-HCl：1 will precipitation Dissolving, and in 4 DEG C of dialysis 48h of 20mM PH8.0Tris-HCL.The sample after dialysis is taken to carry out SDS PAGE and western Blot is analyzed.The results are shown in Figure 5, and wherein M is protein Marker, and 1 is induced expression 72h culture medium supernatants (S1-pHC- gE)；2 be induced expression 72h culture medium supernatant ammonium sulfate precipitations (S1-pHC-gE)；3 be negative control (S1-pHC)；Compared to There is relative molecular mass about 60 × 10 after ammonium sulfate precipitation in negative control³Clear band, with prediction albumen relative molecular mass Unanimously.

The concentrated sample of ammonium sulfate precipitation is subjected to anion-exchange chromatography, 1mL anion exchanges (prepackage) column is taken to use The 20mM PH8.0Tris-HCL of 10 volumes are balanced.By the protein sample after dialysis with 0.22uM filters filter after with The flow velocity of 1mL/min passes through equilibrated anion-exchange column.Pillar is washed with the 20mM PH8.0Tri-HCL of 5 volumes.Again It is eluted with the NaCL solution of 200mM, 300Mm, 500mM, 1M successively.Eluent is sampled, in 300mM SDS PAGE analyses are carried out after NaCL elutions.Analysis result as shown in fig. 6,

Wherein：M is protein Marker in Fig. 6, and 1~4 elutes (S1-pHC-gE) for 300mM NaCL；In 1,2,3,4 swimming Occurs relative molecular mass about 60 × 10 in road³Clear band, it is consistent with prediction albumen relative molecular mass.And with purifying Before compare, foreign protein significantly reduces.

By the sample for having clear band with Mouse Anti-Varicella Zoster Monoclonal Antibody into The detection of row Western blot, the results are shown in Figure 7, and M is protein Marker in Fig. 7, and 1~2 is negative control (S1- PHC), 3~6 different applied sample amount (S1-pHC-gE) Mouse Anti-Varicella Zoster are eluted for 300mM NaCL Monoclonal Antibody；Occur apparent clearly band in 3~No. 6 swimming lanes, albumen size position with it is expected consistent, Relative molecular mass is about 60 × 103.Prove ammonium sulfate precipitation and anion-exchange chromatography can successful purification gained VZVgE eggs In vain, and purification effect is stablized.

By above-mentioned experimental result：(1) recombinant plasmid sequence verification is correct, builds successfully；(2) recombinant yeast egg It is white to identify and expected consistent, correct and stable expression.After testing, after recombinant yeast pichia pastoris bacterium shake flask fermentation disclosed in this invention Product detected by SDS-PAGE and Western-blot, detect that its destination protein is about 60kD in clear liquid on it, Illustrate the glycoprotein E for capableing of successful expression varicella virus in the expression system of Pichia pastoris, for the follow-up albumen Immunogenicity detects and the research and development of the high efficient expression in Pichia pastoris and varicella zoster vaccine are laid a good foundation.

Destination protein Antigenicity assays

1, experimental method

SPF grades of Balb/c mouse of selection, 6~8 week old (about 3~7 days temporal adaptation environment), single female, totally 48.It is dynamic Object is grouped after inspection and quarantine by weight at random, every group 6, each group such as table 1.

1 experiment packet of table and medication

Every group is all made of muscle (mouse limb muscle tissue) and injects, each administered volume 0.1ml/, every time in administration Containing 6.5 μ g gE albumen, a concentration of 0.5mg/mL of aluminium adjuvant.It was administered at the 0th, 3,6 week, totally 3 times, every minor tick 2 weeks.Point First 3~7 days not immune in first time, (0 week) 12 days after first time is immune, second of immune rear (2 weeks) 12 days every group of eye socket is adopted Blood system is to be measured from serum；Eyeball takes blood and takes spleen at 6 weeks.Serum keeping is in≤- 60 DEG C of low temperature refrigerator.Take spleen to sterile sky Guan Zhongjia PBS are stored on ice.

2, rGE antibody contents in serum are detected using ELISA

Agents useful for same and consumptive material such as the following table 2：

Table 2

Detecting step：

1) according to layout templates, per 100 μ l of hole, after being placed in 4 DEG C of incubation 16-18h.

2) Elisa plates are taken out, liquid in hole, Wash buffer board-washings 3 times are discarded.

3) 200 μ l confining liquids are added per hole, are placed in 37 DEG C of incubation 2h.

4) it presses layout and primary antibody dilution is added, per 100 μ l of hole, be placed in 37 DEG C of incubation 120min.

5) Elisa plates are taken out, liquid in hole, Wash buffer board-washings 3 times are discarded.

6) Antibody buffer are used to prepare 1：Secondary antibody is added by layout templates, per 100 μ of hole in 2000 secondary antibody diluent L, 37 DEG C of placement 1h.

7) Elisa plates are taken out, liquid in hole, Wash buffer board-washings 6 times are discarded.

8) TMB is added, per 100 μ l of hole, 15min is placed in dark place.

9) 100 μ l terminate liquids are added in every hole and terminate reaction.

10) upper microplate reader is read after terminating reaction 5min, 450nm-620nm.

3, experimental result

Measured antibody content result see the table below 3：

3 mouse experiment antibody content (GMT) of table

	It is 3 weeks immune	It is 6 weeks immune	It is 9 weeks immune
				PBS negative controls	21.54	4.64	4.64
Commercially available positive control	11.22	1392.88	4850.29
				Experimental group 1	712.72	229.74	229.74
Experimental group 2 (adjuvant)	400	636.96	4524.48
				Comparative example 1	158.74	459.48	262.57

From 3 experimental result of table：The present invention is provided using the gE albumen of restructured Pichia pastoris in expression as the immune small of antigen Mouse can obviously generate the neutralizing antibody of more high titre, hence it is evident that be better than Bacillus coli expression, and exempt within 9 weeks or so with commercial available vaccines group Epidemic disease effect is suitable, but first immunisation effect is more preferable, and VZV gE expression vectors and yeast strains immune effect provided by the invention are splendid, Has the foreground for greatly preventing and treating VZV relevant diseases.

Comparative example 2

The used yeast strains that differ only in of this comparative example and embodiment 2 are Pichia pinkTM S4 yeast cells, Not obtaining can the consistent recombination yeast strain correctly expressed of sequence verification.

It is it is necessary to described herein finally：Above example is served only for making technical scheme of the present invention further detailed Ground illustrates, should not be understood as limiting the scope of the invention, those skilled in the art's the above according to the present invention Some the nonessential modifications and adaptations made all belong to the scope of protection of the present invention.

Sequence table

<110>The Wuhan bio tech ltd Bo Wo

<120>VZV glycoprotein E genes expression vector and its restructuring yeast strains and application

<130> 1

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1638

<212> DNA

<213> Varicella zoster

<220>

<221> gene

<222> (1)..(1638)

<223>VZV gene orders

<400> 1

atggggacag ttaataaacc tgtggtgggg gtattgatgg ggttcggaat tatcacggga 60

acgttgcgta taacgaatcc ggtcagagca tccgtcttgc gatacgatga ttttcacatc 120

gatgaagaca aactggatac aaactccgta tatgagcctt actaccattc agatcatgcg 180

gagtcttcat gggtaaatcg gggagagtct tcgcgaaaag cgtacgatca taactcacct 240

tatatatggc cacgtaatga ttatgatgga tttttagaga acgcacacga acaccatggg 300

gtgtataatc agggccgtgg tatcgatagc ggggaacggt taatgcaacc cacacaaatg 360

tctgcacagg aggatcttgg ggacgatacg ggcatccacg ttatccctac gttaaacggc 420

gatgacagac ataaaattgt aaatgtggac caacgtcaat acggtgacgt gtttaaagga 480

gatcttaatc caaaacccca aggccaaaga ctcattgagg tgtcagtgga agaaaatcac 540

ccgtttactt tacgcgcacc gattcagcgg atttatggag tccggtacac cgagacttgg 600

agctttttgc cgtcattaac ctgtacggga gacgcagcgc ccgccatcca gcatatatgc 660

ttaaaacata caacatgctt tcaagacgtg gtggtggatg tggattgcgc ggaaaatact 720

aaagaggatc agttggccga aatcagttac cgttttcaag gtaagaagga agcggaccaa 780

ccgtggattg ttgtaaacac gagcacactg tttgatgaac tcgaattaga cccccccgag 840

attgaaccgg gtgtcttgaa agtacttcgg acagaaaaac aatacttggg tgtgtacatt 900

tggaacatgc gcggctccga tggtacgtct acctacgcca cgtttttggt cacctggaaa 960

ggggatgaaa aaacaagaaa ccctacgccc gcagtaactc ctcaaccaag aggggctgag 1020

tttcatatgt ggaattacca ctcgcatgta ttttcagttg gtgatacgtt tagcttggca 1080

atgcatcttc agtataagat acatgaagcg ccatttgatt tgctgttaga gtggttgtat 1140

gtccccatcg atcctacatg tcaaccaatg cggttatatt ctacgtgttt gtatcatccc 1200

aacgcacccc aatgcctctc tcatatgaat tccggttgta catttacctc gccacattta 1260

gcccagcgtg ttgcaagcac agtgtatcaa aattgtgaac atgcagataa ctacaccgca 1320

tattgtctgg gaatatctca tatggagcct agctttggtc taatcttaca cgacgggggc 1380

accacgttaa agtttgtaga tacacccgag agtttgtcgg gattatacgt ttttgtggtg 1440

tattttaacg ggcatgttga agccgtagca tacactgttg tatccacagt agatcatttt 1500

gtaaacgcaa ttgaagagcg tggatttccg ccaacggccg gtcagccacc ggcgactact 1560

aaacccaagg aaattacccc cgtaaacccc ggaacgtcac cacttatacg atatgccgca 1620

tggaccggag ggcttgca 1638

<210> 2

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(37)

<223>XF primer sequences

<400> 2

cggaattcga aacgatgaga tttccttcaa tttttac 37

<210> 3

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(44)

<223>XR primer sequences

<400> 3

acaactggct tgttaacagt acctcttttc tcgagagata cccc 44

<210> 4

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(47)

<223>GF primer sequences

<400> 4

gaaggggtat ctctcgagaa aagaggtact gttaacaagc cagttgt 47

<210> 5

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(33)

<223>GR primer sequences

<400> 5

acatgcatgc ttatctgatc aatggggaag tac 33

<210> 6

<211> 1890

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(1890)

<223>α-gE fusion gene sequences

<400> 6

cggaattcga aacgatgaga tttccttcaa tttttactgc tgttttattc gcagcatcct 60

ccgcattagc tgctccagtc aacactacaa cagaagatga aacggcacaa attccggctg 120

aagctgtcat cggttactca gatttagaag gggatttcga tgttgctgtt ttgccatttt 180

ccaacagcac aaataacggg ttattgttta taaatactac tattgccagc attgctgcta 240

aagaagaagg ggtatctctc gagaaaagag gtactgttaa caagccagtt gttggtgttt 300

tgatgggttt cggtatcatc actggtactt tgagaatcac taacccagtt agagcttccg 360

ttttgagata cgacgacttc cacattgacg aggacaagtt ggacactaac tccgtttacg 420

agccttacta ccactctgat cacgctgaat cctcttgggt taacagaggt gaatcctcca 480

gaaaggctta cgaccacaac tccccatata tctggccaag aaacgactac gacggtttct 540

tggaaaacgc tcatgaacac cacggtgttt acaaccaggg tagaggtatt gactccggtg 600

agagattgat gcagccaact caaatgtctg ctcaagagga cttgggtgac gacactggta 660

ttcacgttat cccaactttg aacggtgatg acagacacaa gatcgttaac gttgaccaga 720

gacagtacgg tgacgttttc aagggtgact tgaacccaaa gccacagggt caaagattga 780

tcgaggtttc cgttgaagag aaccacccat tcactttgag agctccaatc cagagaatct 840

acggtgttag atacactgag acttggtctt tcttgccatc cttgacttgt actggtgatg 900

ctgctccagc tatccagcac atttgtttga agcacactac ttgtttccag gacgttgttg 960

ttgacgttga ctgtgctgag aacacaaaag aggaccagtt ggctgagatc tcctacagat 1020

tccagggtaa gaaagaggct gaccagcctt ggatcgttgt taacacttcc actttgttcg 1080

acgagttgga gttggaccca ccagaaattg aaccaggtgt tttgaaggtt ttgagaactg 1140

agaagcagta cttgggagtt tacatctgga acatgagagg ttccgacggt acttctactt 1200

acgctacttt cttggttact tggaagggtg acgaaaagac tagaaaccca actccagctg 1260

ttactccaca acctagaggt gctgaatttc acatgtggaa ctaccattcc cacgttttct 1320

ccgttggtga tactttctcc ttggctatgc acttgcagta caagattcac gaggctccat 1380

tcgacttgtt gttggagtgg ttgtacgttc caatcgaccc tacttgtcag ccaatgagat 1440

tgtactccac ttgtttgtac cacccaaacg ctccacaatg tttgtcccac atgaactccg 1500

gttgtacttt cacttctcca cacttggctc agagagttgc ttccactgtt taccagaact 1560

gtgagcacgc tgacaactac actgcttact gtttgggtat ctcccacatg gaaccatcct 1620

tcggtttgat cttgcacgac ggtggtacta ctttgaagtt cgttgacact ccagagtcct 1680

tgtccggttt gtatgttttc gttgtttact tcaacggtca cgttgaggct gttgcttaca 1740

cagttgtttc tactgttgac cacttcgtta acgctatcga agagagaggt ttcccaccaa 1800

ctgctggtca accaccagct actactaagc caaaagagat cactccagtt aacccaggta 1860

cttccccatt gatcagataa gcatgcatgt 1890

Claims

1.VZV glycoprotein E gene expression vectors, it is characterised in that：The carrier is the company of α-gE fusions and pPink-HC Junctor, wherein α-gE fusions are the fusion of the gene complete sequence and alpha signal peptide of VZV glycoprotein Es.

2. expression vector according to claim 1, it is characterised in that：α-gE fusions such as SEQ ID the NO：6 institutes Show.

3. for expressing the expression vectors of VZV glycoprotein E genes, which is characterized in that expression vector structure by the following method It builds：

Step A, design primer separately designs primer according to the multiple cloning sites sequence on gE gene orders and pPink-HC, with It realizes and adds I restriction enzyme site of EcoR I and Sph respectively at target gene segment both ends；

Step B, recombinant vector is built, gE genetic fragments after amplification and pPink-HC are connected after double digestion, by connection product Positive clone molecule is selected through culture after sequencing identification is correct to obtain the final product.

4. expression vector according to claim 4, which is characterized in that step A design of primers is：The ends F primer 5' are equipped with EcoRI restriction enzyme sites, the ends R primer 5' are equipped with I restriction enzyme sites of Sph, and primer XF, XR carry out PCR amplification alpha signal peptide, GF, GR It carries out PCR amplification gE, X-GF, X-GR and carries out PCR amplification α-gE fusions.

5.VZV glycoprotein E gene expression vectors, which is characterized in that the expression vector obtains as follows：

Step a, according to such as SEQ ID NO：The base of varicella virus glycoprotein E shown in 1 after codon optimization Because on complete sequence, yeast expression vector pGAPZ α A-mix and/or alpha signal peptide multiple cloning sites primers XF, XR, GF, GR, X-GF and X-GR, the ends F primer 5' are equipped with EcoRI restriction enzyme sites, and the ends R primer 5' are equipped with I restriction enzyme sites of Sph；Draw After object XF, XR amplification alpha signal peptide and GF, GR carry out PCR amplification gE, it is with gE segments and alpha signal peptide fragment by gained PCR product Template, primer X-GF, X-GR carry out PCR amplification, and PCR product recycles α-gE fusion segments through glue again；

Step b, after α-gE fusions segments obtained by step a being expanded recycling respectively with pPink-HC again, then respectively with limitation Property restriction endonuclease EcoR I and Not I carry out double digestion after recycle endonuclease bamhi, the gE segments after digestion are mixed with pGAPZ α A A connection product is connected to obtain through T4 ligases, then gained connection product is converted to bacillus coli DH 5 alpha competent cell, then is chosen Positive clone molecule is taken to carry out colony PCR amplification to get the recombinant expression carrier；

Wherein, primer XF sequences such as SEQ ID NO：Shown in 2, primer XR sequences such as SEQ ID NO：Shown in 3；Primer GF sequences are such as SEQ ID NO：Shown in 4, primer GR sequences such as SEQ ID NO：Shown in 5；Primer X-GF sequences such as SEQ ID NO：Shown in 2, draw Object X-GR sequences such as SEQ ID NO：Shown in 3.

6. a kind of construction method of VZV glycoprotein E genes expression vector, which is characterized in that specifically comprise the following steps：

Step A, design primer separately designs primer according to the multiple cloning sites sequence on gE and pPink-HC, to realize in mesh Segment both ends add I restriction enzyme site of EcoR I and Sph respectively；

Step B, α-gE gene orders are merged, it is excellent that codon is carried out under the premise of not changing amino acid sequence with gE original series Change；Using pGAPZ α A-mix as template, gE is expanded with primer XF, XR amplification alpha signal peptide and with GF, GR respectively；Again with gE segments It is template with alpha signal peptide fragment, primer X-GF, X-GR carry out fusion DNA vaccine and expand α-gE fusions；

Step C, recombinant vector is built, is expanded respectively as template using α-gE fusions and pPink-HC obtained by step B, instead PCR product after answering is recycled through plastic recovery kit；Segment and pPink-HC will be recycled through restriction enzyme EcoR I and Sph After I progress double digestion is complete, glue recycles endonuclease bamhi；GE segments are mixed with pPink-HC through 16 DEG C of companies of T4 ligases after recycling Take over night；Connection product is converted into bacillus coli DH 5 alpha competent cell again, is coated on the tablet containing Amp resistances, 37 DEG C of overnight incubations；Picking positive clone molecule carries out bacterium colony PCR, and sequencing analysis is identified after digestion identification；Complete expression load The structure of body, gained recombinant expression carrier are named as pHC-gE, i.e. yeast recon.

7. a kind of recombination yeast strain for expressing gE, it is characterised in that：The yeast strains are expression such as SEQ ID NO：Shown in 1 The yeast strains Pichia pinkTM S1 of the gene complete sequence of VZV glycoprotein Es.

8. a kind of recombination yeast strain, which is characterized in that the yeast strains can effective expression gE, and screen by the following method and ：Any expression vector pHC-gE of claim 1~13 is converted to Escherichia coli, bacterium solution is applied to the training of LB tablets again Electrotransformation after plasmid, then linearized single endonuclease digestion, recycling is cultivated and extracted after supporting to single bacterium colony, until after in competent yeast cells It is cultivated in constant-temperature table；Bacterium solution is coated on again and is grown containing YPD tablets culture to single bacterium colony；Picking individual colonies are through YPD liquid Body culture medium is protected from light shaking flask culture and is detected again through sequencing, identifies sequence correctly up to identified restructuring yeast strains after sequencing.

9. recombination yeast strain according to claim 8, which is characterized in that the yeast strains obtain by the following method：

Step i, above-mentioned recombinant expression carrier pHC-gE is converted into Escherichia coli, then bacterium solution is applied to containing 100ug/mL The LB tablets culture of Amp largely extracts plasmid after carrying out shaking flask culture to single bacterium colony；It is carried out linearly through restriction enzyme A vr II Change single endonuclease digestion and recycles digestion carrier after linearization for enzyme restriction is complete；By the carrier electrotransformation of linearisation to competent yeast cells In, the sorbitol solution for the 1M that precooling is added after the 5ms that shocks by electricity is cultivated in 28 DEG C of constant-temperature tables；Again by 28 DEG C of constant temperature of bacterium solution EP pipes 1h is cultivated in shaking table, is coated and is protected from light culture 3-5d to single bacterium on PAD tablets, tablet is positioned in 28 DEG C of constant incubators It falls and grows；

Step ii, the transformant grown after conversion is protected from light shaking flask culture through YPD fluid nutrient mediums, extracts and tries through Yeast genome Agent box carries out the transformant bacterium solution extracting of total DNA, and it is template to take a small amount of total DNA, PCR reactions is carried out to transformant, by PCR Identification sequence is correctly up to identified restructuring yeast strains after product send sequencing.

10. the application of any recombination yeast strain of claim 15~21, it is characterised in that：The yeast strains are used for table Up to varicella virus glycoprotein E gene.