CN116334078A - Method for detecting sweet potato virus disease based on CRISPR technology - Google Patents

Abstract

The invention provides a method for detecting sweet potato virus diseases based on a CRISPR technology, in particular to a method for detecting sweet potato chlorosis dwarf virus or sweet potato virus diseases based on the CRISPR technology, which comprises the steps of detecting by using gRNA, cas protein and a single-stranded nucleic acid detector; the invention improves the detection efficiency through screening and optimizing the gRNA, and has wide application prospect.

Description

Method for detecting sweet potato virus disease based on CRISPR technology

Technical Field

The invention relates to the field of nucleic acid detection, relates to a method for detecting sweet potato virus diseases based on a CRISPR technology, and in particular relates to a method, a system and a kit for detecting sweet potato chlorosis dwarf virus based on the CRISPR technology.

Background

Sweet potato chlorosis dwarf virus (Sweet potato chlorotic stunt virus, SPCSV) belongs to a member of the genus Mao-shaped virus of the family Leptoviridae. The sweet potato chlorosis dwarf virus is one of main viruses which harm sweet potatoes and is mainly transmitted by bemisia tabaci, and particularly important, the sweet potato chlorosis dwarf virus can co-infect sweet potato with sweet potato pinnate mottle virus to cause sweet potato virus diseases (sweet potato virus disease, SPVD). Sweet potato virus disease is one of the most serious virus diseases on sweet potato, and can generally reduce the yield of sweet potato by 50% -98% and even eliminate the yield.

The detection method of the sweet potato chlorosis dwarf virus mainly comprises the following steps: visual inspection, plant detection, enzyme-linked immunosorbent assay, immunoelectron microscopy, nucleic acid hybridization, RT-PCR.

The invention provides a novel method for detecting sweet potato chlorosis dwarf virus, which is a rapid detection method with high specificity and high detection sensitivity based on a CRISPR technology, especially based on trans activity of V-type Cas enzyme.

Disclosure of Invention

The invention provides a method, a system and a kit for detecting sweet potato chlorosis dwarf virus based on CRISPR technology.

In one aspect, the invention provides a gRNA for detecting sweet potato chlorosis dwarf virus, the gRNA comprising a region that binds to Cas protein and a guide sequence that hybridizes to a target nucleic acid that is a nucleic acid derived from sweet potato chlorosis dwarf virus.

In the present invention, the region that binds to the CRISPR/CAS effector protein, also referred to as the homeotropic repeat, framework region, or spacer sequence, interacts with the CAS protein, thereby binding to the CAS protein.

In one embodiment, the gRNA comprises, in order from the 5 'end to the 3' end, a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid.

In one embodiment, the targeting sequence that hybridizes to a target nucleic acid comprises 17 to 30 bases and hybridizes to the sequence shown in SEQ ID No.2 or its reverse complement, and the targeting sequence comprises any of the sequences shown in SEQ ID Nos. 8 to 9; preferably, the targeting sequence comprises the sequence shown in any one of SEQ ID No.8, 9.

In preferred embodiments, the targeting sequence that hybridizes to the target nucleic acid comprises 17-30 bases, e.g., 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases.

In one embodiment, the targeting sequence that hybridizes to a target nucleic acid comprises any of the sequences shown in SEQ ID Nos. 8-9, and further comprises 1-13 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 bases) at the 3' end of any of the sequences shown in SEQ ID Nos. 8-9, and the targeting sequence that hybridizes to the sequence shown in SEQ ID No.2 or the reverse complement thereof; preferably, the targeting sequence comprises the sequence shown in any one of SEQ ID No.8, 9.

In one embodiment, the targeting sequence that hybridizes to a target nucleic acid is a continuous deletion of 1-4 bases (e.g., 1, 2, 3, 4 bases) at the 3' end of any of the sequences shown in SEQ ID Nos. 8-9 as compared to any of the sequences shown in SEQ ID Nos. 8-9.

The hybridization with the sequence shown in SEQ ID No.2 or the reverse complementary sequence thereof means that the guide sequence and a continuous segment of the reverse complementary sequence of SEQ ID No.2 or SEQ ID No.2 can be in continuous complementary pairing. For example, the targeting sequence that hybridizes to the target nucleic acid contains 30 bases, and then 30 bases of the targeting sequence need to be complementarily paired with consecutive 30 bases of SEQ ID No.2 or the complement of SEQ ID No. 2.

In a more preferred embodiment, the targeting sequence that hybridizes to a target nucleic acid is set forth in any one of SEQ ID Nos. 8-9.

In one embodiment, the Cas protein is selected from a type V Cas protein, e.g., a Cas12, cas14 family protein, or a mutant thereof.

In one embodiment, the Cas protein is preferably a Cas12 family including, but not limited to, one or any of Cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12 j.

Preferably, the sequence of the region that binds to Cas protein is shown in SEQ ID No. 10.

In another aspect, the invention provides a method of detecting/diagnosing sweet potato chlorosis dwarf virus or sweet potato virus disease comprising contacting a nucleic acid to be tested with a V-type Cas protein, the above-described gRNA, and a single-stranded nucleic acid detector; the detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector is detected, thereby detecting/diagnosing sweet potato chlorosis dwarf virus or sweet potato virus disease.

In one embodiment, the V-type Cas protein is selected from any one of the following I-II:

I. the amino acid sequence of the V-type Cas protein is shown in SEQ ID No. 3;

II. The amino acid sequence of the V-type Cas protein is mutated at amino acid 168 corresponding to the amino acid sequence shown in SEQ ID No.3 as compared with SEQ ID No. 3.

In one embodiment, the amino acid position 168 is mutated to a non-N amino acid, e.g., a, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, the amino acid 168 is mutated to R.

It will be appreciated that proteins may be altered in a variety of ways, including amino acid substitutions, deletions, truncations and insertions, and that methods for such manipulation are generally known in the art. For example, amino acid sequence variants of the above proteins can be prepared by mutation of DNA. Single or multiple amino acid substitutions, deletions and/or insertions may also be made by other forms of mutagenesis and/or by directed evolution, for example, using known mutagenesis, recombination and/or shuffling (shuffleling) methods, in combination with associated screening methods.

Those skilled in the art will appreciate that these minor amino acid changes in the Cas proteins of the invention may occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site or other functional domain of the protein, the nature of the polypeptide may be altered, but the polypeptide may retain its activity. Smaller effects can be expected if mutations are present that are not close to the catalytic domain, active site or other functional domain.

The skilled artisan can identify the essential amino acids of the Cas muteins of the invention according to methods known in the art, such as site-directed mutagenesis or protein evolution or analysis of bioinformatics. The catalytic, active or other functional domains of a protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutations in the amino acids at putative key sites.

In the present invention, amino acid residues may be represented by single letters or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp,

w), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser,

s), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

The term "AxxB" means that amino acid a at position xx is changed to amino acid B, e.g. N168R means that N at position 168 is mutated to R.

The specific amino acid positions (numbering) within the proteins of the invention are determined by aligning the amino acid sequence of the protein of interest with SEQ ID No.3 using standard sequence alignment tools, such as by aligning the two sequences using the Smith-Waterman algorithm or using the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. The alignment score can be determined according to Wilbur, w.j.and Lipman, d.j. (1983) Rapid similarity searches ofnucleic acid and protein data banks, proc.Natl. Acad.Sci.USA,80: 726-730. Default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap opening penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein/DNA endplay= -1; protein/DNAGAPDIST =4. The position of a specific amino acid within a protein according to the invention is preferably determined by aligning the amino acid sequence of the protein with SEQ ID No.3 using the AlignX program (part of the vectorNTI group) with default parameters (gap opening penalty: 10 g gap extension penalty 0.05) suitable for multiple alignments.

Further, the method further comprises the step of obtaining a test nucleic acid from the test sample; preferably, the nucleic acid to be detected is obtained from the sample to be detected by an amplification method.

Further, the method also comprises the step of amplifying by using the primer pair to obtain the nucleic acid to be detected.

The primer pair is selected from the following i and/or ii:

i. the upstream primer of the primer pair is shown as SEQ ID N0:15, the downstream primer of the primer pair is shown as SEQ ID N0: shown at 16;

ii. The upstream primer of the primer pair is shown as SEQ ID NO:17, the downstream primer of the primer pair is shown as SEQ ID N0: shown at 16;

preferably, the upstream primer of the primer pair is set forth in SEQ ID N0:15, the downstream primer of the primer pair is shown as SEQ ID NO: shown at 16.

In the present invention, the nucleic acid to be measured may be a double-stranded nucleic acid or a single-stranded nucleic acid.

The amplification of the invention is selected from one or more of PCR, nucleic Acid Sequencing Based Amplification (NASBA), recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase Dependent Amplification (HDA), or Nicking Enzyme Amplification Reaction (NEAR), multiple Displacement Amplification (MDA), rolling Circle Amplification (RCA), ligase Chain Reaction (LCR), or derivative amplification method (RAM).

In the present invention, the sample may be a sample derived from a plant, for example, sweet potato, potato; in other embodiments, the sample may also be from other plants, such as tobacco.

In one embodiment, the sample may be a plant's toxic medium, e.g., potato seedling, potato block, bemisia tabaci, aphid sample.

In other embodiments, the sample may also be derived from an environmental sample, e.g., air, water, soil, etc.

In another aspect, the invention provides a composition for detecting/diagnosing sweet potato chlorosis dwarf virus, the composition comprising the above gRNA, further comprising Cas protein and a single-stranded nucleic acid detector; preferably, the primer pair is also included.

In another aspect, the invention also provides a system, composition or kit for detecting or diagnosing whether a plant to be tested is infected with a sweetpotato virus disease, the system, composition or kit comprising a V-type Cas protein, a gRNA as described above, and a single-stranded nucleic acid detector. Further, the system, composition or kit further comprises amplification primers; preferably, the amplification primers comprise the primer pair described above.

On the other hand, the invention also provides the application of the composition for detecting or diagnosing whether the plant to be detected is infected with the sweet potato virus disease in diagnosing or detecting the sweet potato virus disease or the application of the composition for preparing a reagent or a kit for diagnosing or detecting the sweet potato virus disease.

In another aspect, the invention also provides a system, composition or kit for detecting/diagnosing sweet potato chlorosis dwarf virus, comprising a V-type Cas protein, the above-described gRNA (guide RNA) and a single-stranded nucleic acid detector; preferably, the primer pair is also included.

In another aspect, the invention also provides the use of the above system, composition or kit for detecting/diagnosing sweet potato chlorosis dwarf virus.

On the other hand, the invention also provides application of the composition in preparing a reagent or a kit for detecting/diagnosing the sweet potato chlorosis dwarf virus.

Further, the type V Cas protein is selected from Cas12, cas14 family proteins, or mutants thereof.

In one embodiment, the Cas protein is preferably a Cas12 family including, but not limited to, one or any of Cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12 j.

In one embodiment, the Cas12a is selected from one or any several of FnCas12a, asCas12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a, or Lb4Cas12 a.

In preferred embodiments, the amino acid sequence of the Cas12i protein is selected from the group consisting of:

(1) SEQ ID NO:3, a protein shown in the formula 3;

(2) Setting SEQ ID NO:3 or an active fragment thereof by substitution, deletion or addition of one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues, and having substantially the same function;

(3) And SEQ ID NO:3, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%, and has trans-activity.

In one embodiment, the Cas protein mutant comprises an amino acid substitution, deletion, or substitution, and the mutant retains at least its trans-cleavage activity. Preferably, the mutants have Cis and trans cleavage activity.

In the present invention, a "Cas mutein" may also be referred to as a mutated Cas protein, or a Cas protein variant.

In the present invention, the single-stranded nucleic acid detector includes single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrid. In other embodiments, the single-stranded nucleic acid detector comprises single-stranded DNA, single-stranded RNA, or a mixture of any two or three of single-stranded DNA-RNA hybrids, e.g., a combination of single-stranded DNA and single-stranded RNA, a combination of single-stranded DNA and single-stranded DNA-RNA hybrids, a combination of single-stranded RNA and single-stranded DNA-RNA. In other embodiments, the single stranded nucleic acid detector further comprises modifications to the bases.

In a preferred embodiment, the single stranded nucleic acid detector is a single stranded oligonucleotide detector.

The single stranded nucleic acid detector does not hybridize to the gRNA.

In the present invention, the detectable signal is realized by: visual-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase change/dispersion, electrochemical detection, and semiconductor-based detection.

In some embodiments, the methods of the invention further comprise the step of measuring the detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein recognizes or hybridizes to the target nucleic acid and can trigger the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector to generate a detectable signal.

In the present invention, the detectable signal may be any signal that is generated when a single-stranded nucleic acid detector is cleaved. For example, gold nanoparticle based detection, fluorescence polarization, fluorescence signal, colloidal phase change/dispersion, electrochemical detection, semiconductor based sensing. The detectable signal may be read out by any suitable means including, but not limited to: measurement of detectable fluorescent signals, gel electrophoresis detection (by detecting a change in the band on the gel), detection based on the presence or absence of a visual or sensor color, or differences in color (e.g., based on gold nanoparticles), and differences in electrical signals.

In a preferred embodiment, the detectable signal is achieved by: different reporting groups are respectively arranged at the 5 'end and the 3' end of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cut, a detectable reporting signal can be displayed; for example, a single-stranded nucleic acid detector may exhibit a detectable fluorescent signal when cleaved, with a fluorescent group and a quenching group disposed at each end of the single-stranded nucleic acid detector.

In one embodiment, the fluorophore is selected from one or any of FAM, FITC, VIC, JOE, TET, CY, CY5, ROX, texas Red or LC Red 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In other embodiments, the detectable signal may also be implemented by: different labeling molecules are respectively arranged at the 5 'end and the 3' end of the single-stranded nucleic acid detector, and a reaction signal is detected in a colloidal gold detection mode.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single stranded nucleic acid detector produces a first detectable signal before cleavage by the Cas protein and a second detectable signal different from the first detectable signal after cleavage.

In other embodiments, the single stranded nucleic acid detector comprises one or more modifications, such as base modifications, backbone modifications, sugar modifications, etc., to provide new or enhanced features (e.g., improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids having modified backbones include those that retain phosphorus atoms in the backbone and those that do not have phosphorus atoms in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms therein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates. In some embodiments, the single stranded nucleic acid detector comprises one or more phosphorothioate and/or heteroatom nucleoside linkages. In other embodiments, the single stranded nucleic acid detector may be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetic is a Peptide Nucleic Acid (PNA), and another class of nucleic acid mimetics is based on a linked morpholino unit (morpholino nucleic acid) having a heterocyclic base linked to a morpholino ring, and other nucleic acid mimetics further include cyclohexenyl nucleic acid (CENA) and further include ribose or deoxyribose chains.

In one embodiment, the Cas protein to gRNA molar ratio is used in an amount of (0.8-1.2): 1.

in one embodiment, the Cas protein is used in a final concentration of 20-200nM, preferably 30-100nM, more preferably 40-80nM, more preferably 50nM.

In one embodiment, the final concentration of the gRNA is used in an amount of 20-200nM, preferably 30-100nM, more preferably 40-80nM, more preferably 50nM.

In one embodiment, the nucleic acid to be tested is used in a final concentration of 5-100nM, preferably 10-50nM.

In one embodiment, the single stranded nucleic acid detector is used in a final concentration of 100-1000nM, preferably 150-800nM, preferably 200-500nM, preferably 200-300nM.

In one embodiment, the single stranded nucleic acid detector has 2-300 nucleotides, preferably 3-200 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides.

The term "hybridization" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) comprises a nucleotide sequence that enables it to bind non-covalently, i.e., form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid specifically binds to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, variables well known in the art. Typically, the hybridizable nucleic acid is 8 nucleotides or more in length (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It will be appreciated that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. Polynucleotides may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to a target region in a target nucleic acid sequence to which it hybridizes.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living bodies are composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence of 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when two sequences are aligned to produce maximum identity. Such an alignment may be used, for example, by conventional methods for amino acid sequence identity, see, for example, smith and Waterman,1981, adv.appl.math.2:482Pearson&Lipman,1988,Proc.Natl Acad.Sci.USA 85:2444,Thompson etal, 1994,Nucleic Acids Res 22:467380, etc., is determined by computerized operation algorithms (GAP, BESTFIT, FASTA in Wisconsin Genetics software package, and TFASTA, genetics Computer Group). The default parameters may also be used to determine using BLAST algorithms available from the national center for Biotechnology information (NCBI www.ncbi.nlm.nih.gov /).

As used herein, the "CRISPR" refers to clustered, regularly interspaced short palindromic repeats (Clustered regularly interspaced short palindromic repeats) from the immune system of a microorganism.

As used herein, "biotin" is also known as vitamin H, a small molecule vitamin having a molecular weight of 244 Da. "avidin", also known as avidin, is an alkaline glycoprotein having 4 binding sites with very high affinity for biotin, commonly known as streptavidin. The extremely strong affinity of biotin for avidin can be used to amplify or enhance the detection signal in a detection system. For example, biotin is easily combined with protein (such as antibody) by covalent bond, while avidin molecule combined with enzyme reacts with biotin molecule combined with specific antibody, thus playing the role of multi-stage amplification, and achieving the purpose of detecting unknown antigen (or antibody) molecule due to the catalytic action of enzyme when encountering corresponding substrate.

Cas proteins

"Cas protein" as used herein refers to a CRISPR-associated protein, preferably from a type V or VI CRISPR/Cas protein, which upon binding to the feature sequence to be detected (target sequence), i.e. forming a ternary complex of Cas protein-gRNA-target sequence, can induce its trans activity, i.e. randomly cleaving non-targeted single stranded nucleotides (i.e. single stranded nucleic acid detector as described herein, preferably single stranded DNA (ssDNA), single stranded DNA-RNA hybrids, single stranded RNA). When the Cas protein binds to a signature sequence, it either cleaves or does not cleave the signature sequence, which can induce its trans activity; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single stranded signature sequence.

The Cas protein of the present invention is a protein having at least trans-cleavage activity, preferably, the Cas protein is a protein having Cis and trans-cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize the PAM locus and specifically cut the target sequence under the action of gRNA.

The Cas proteins comprise V-type and VI-type CRISPR/CAS effect proteins, and include protein families such as Cas12, cas13, cas14 and the like. Preferably, for example, a Cas12 protein, such as Cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12j; preferably, the Cas protein is Cas12a, cas12b, cas12i, cas12j. Cas13 protein families include Cas13a, cas13b, and the like.

In embodiments, cas proteins referred to herein, such as Cas12, also encompass functional variants of Cas or homologs or orthologs thereof. "functional variant" of a protein as used herein refers to a variant of such a protein that retains, at least in part, the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Functional variants also include fusion products of such proteins with another nucleic acid, protein, polypeptide or peptide that is not normally associated. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or an ortholog or homolog thereof, may be codon optimized for expression in eukaryotic cells. Eukaryotes may be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or an ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding the same may have one or more mutations).

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, sart, legionella, treponema, actinomyces, eubacterium, streptococcus, lactobacillus, mycoplasma, bacteroides, flaviivola, flavobacterium, azospirillum, sphaerochaeta, gluconacetobacter, neisseria, rochanterium, parvibacum, staphylococcus, nifctifraactor, mycoplasma, campylobacter and chaetobacter.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule for encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by the cell or disrupted by conventional extraction techniques to obtain the protein. The coding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements that facilitate sequence integration, or self-replication. The vector may be of the type plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art, and preferably the expression vector in the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, streptomyces, agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select appropriate vectors and host cells.

gRNA

As used herein, the "gRNA" is also known as guide RNA or guide RNA, and has the meaning commonly understood by those of skill in the art. In general, the guide RNA can comprise, consist essentially of, or consist of, a direct (direct) repeat sequence and a guide sequence (spacer), also referred to in the context of endogenous CRISPR systems. The gRNA may include crRNA and tracrRNA, or may contain only crRNA, depending on the Cas protein on which it depends, in different CRISPR systems. The crRNA and tracrRNA may be fused by artificial engineering to form single guide RNA (sgRNA). In certain instances, a targeting sequence is any polynucleotide sequence that has sufficient complementarity to a target sequence (a feature sequence described herein) to hybridize to the target sequence and direct specific binding of a CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The co-repeat sequence can be folded to form a specific structure (e.g., a stem-loop structure) for Cas protein recognition to form a complex. The targeting sequence need not be 100% complementary to the feature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of matching) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned. It is within the ability of one of ordinary skill in the art to determine the optimal alignment. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, the Smith-Waterman algorithm (Smith-Waterman), bowtie, geneious, biopython, and SeqMan in ClustalW, matlab.

The gRNA of the invention can be natural or artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector according to the present invention means a detector comprising a sequence of 2 to 200 nucleotides, preferably 2 to 150 nucleotides, preferably 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single-stranded nucleic acid detector is used in a detection method or system to report the presence or absence of a target nucleic acid in a sample. The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, which do not exhibit a reporter signal when in an initial state (i.e., not cleaved), and which exhibit a detectable signal when cleaved, i.e., a detectable distinction between cleaved and pre-cleaved. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid can be detected; alternatively, if the detectable difference is not detected, it is reflected that the target nucleic acid is not detected.

In one embodiment, the reporter or marker molecule comprises a fluorophore and a quencher, wherein the fluorophore is selected from one or more of FAM, FITC, VIC, JOE, TET, CY, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In other embodiments, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to one end and a second molecule (e.g., biotin) attached to the other end. The reaction system containing the single-stranded nucleic acid detector is matched with a flow strip to detect target nucleic acid (preferably, a colloidal gold detection mode). The flow strip is designed with two capture lines, with an antibody binding to a first molecule (i.e., a first molecular antibody) at the sample contact end (colloidal gold), an antibody binding to the first molecular antibody at the first line (control line), and an antibody binding to a second molecule (i.e., a second molecular antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group at each line will result in a strong readout/signal (e.g., color). As more reporter is cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (lateral) flow test or a (lateral) flow immunochromatographic assay. In certain aspects, the molecules in the single stranded nucleic acid detector may be interchanged or the positions of the molecules may be changed, so long as the reporting principle is the same or similar to that of the present invention, and the modified manner is also included in the present invention.

The detection method provided by the invention can be used for quantitative detection of target nucleic acid. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of the fluorescent group, the width of the color-developing strip, and the like.

Sequence information

The partial sequence information according to the present invention is provided as follows:

drawings

FIG. 1. Amplified sequences-A and B sequences of sweet potato chlorosis dwarf virus, and the positions of each primer on the amplified sequences.

FIG. 2 shows the amplification results of different primer pairs (F1-R1, F2-R2, F3-R3, F4-R3). Wherein line 1 is the experimental group and line 2 is the control group without template. Each amplification primer corresponds to the amplification curve and the dissolution curve of PCR, respectively. As can be seen from the amplification curves, the CT values of F1-R1, F2-R2, F3-R3 and F4-R3 are 33.9, 34.6, 35.0 and 34.1, respectively; from the dissolution profile, F1-R1, F2-R2 and F3-R3 were free of primer dimer, and F4-R3 were primer dimer.

FIG. 3. Amplified sequences-A and B sequences of sweet potato chlorosis dwarf virus, and the position of each gRNA on the amplified sequences.

FIG. 4 shows the results of detection of ssDNA target nucleic acids by different gRNAs (gRNA-1, gRNA-2, gRNA-3, gRNA-4, gRNA-5, gRNA-6). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time to peak (plateau) of the fluorescent signal when the gRNA-1, gRNA-2, gRNA-3, gRNA-4, gRNA-5, gRNA-6 reacted with ssDNA target nucleic acid was about 23min, 7min, 15min, 9min, 6min and 15min, respectively.

FIG. 5 shows the results of detection of dsDNA target nucleic acids by different gRNAs (gRNA-2, gRNA-4, gRNA-5). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescence signal to reach the peak (reach the plateau) when the gRNA-2, the gRNA-4, the gRNA-5 and the dsDNA target nucleic acid react is about 20min, about 12min and about 17min respectively.

Figure 6.Cas mutein editing efficiency validation results.

Detailed Description

The present invention is further described in terms of the following examples, which are given by way of illustration only, and not by way of limitation, of the present invention, and any person skilled in the art may make any modifications to the equivalent examples using the teachings disclosed above. Any simple modification or equivalent variation of the following embodiments according to the technical substance of the present invention falls within the scope of the present invention.

The technical scheme of the invention combines PCR amplification and CRISPR technology based on the following principle, and has the characteristics of rapidness, sensitivity, specificity and high efficiency. On the premise that specific nucleic acid of target pathogenic bacteria exists in a sample, a specific primer is combined with a target sequence, the target sequence is enriched through PCR amplification, casase (Cas protein) is combined with an amplification product under the guidance of gRNA, the trans-cleavage (trans) activity of the Cas protein is activated, and a Reporter (one end of the Reporter is connected with a fluorescent group, and the other end of the Reporter is connected with a quenching group) in a cleavage system, so that fluorescence is released after the Reporter is cleaved by the Cas protein, and a detection result is presented. In other embodiments, both ends of the single-stranded nucleic acid detector (Reporter) may also be provided with a label that can be detected by colloidal gold.

EXAMPLE 1 amplification of sweet potato chlorosis dwarf Virus specific nucleic acid

In this embodiment, primer design and target nucleic acid amplification were performed on specific nucleic acid of sweet potato chlorosis dwarf virus (SPCSV) Sweet potato chlorotic stunt virus.

According to the genome of SPCSV, two specific sequences are selected for PCR amplification (named sequence A and sequence B for convenience of distinction):

ttctggtgctctgtttcttgttggcggatcctcgttactgcggaaagtgcaatctgacgttagtaatttttccaagtcgattggactgactcccataattgacaaagacttaaggtctgccgtgtcttatggttgttctat (A sequence, SEQ ID No. 1)

gatgtaatagtcggtggtgctgcacaagtgttagatgcttctcaactaccgcactgttacttctacgatctaaaacgatgggttggggttgataggctgtcttttgaagaaatcaaacgtaagatagctccccagtattcggtcaaattggaaggtaatgatgttctga (B sequence, SEQ ID No. 2)

Based on the genomic A sequence of SPCSV, the amplification primers were designed as follows:

F1：tgttggcggatcctcgttac；

R1：ccataagacacggcagacct；

F2：gttggcggatcctcgttact；

R2：ccataagacacggcagacctt；

based on the genomic B sequence of SPCSV, the amplification primers were designed as follows:

F3：aaacgatgggttggggttga；

R3：ttgaccgaatactggggagc；

F4：gtggtgctgcacaagtgttag；

FIG. 1 shows the positions of the primers on the amplified sequence.

The following PCR amplification primer pair combinations were selected: F1-R1, F2-R2, F3-R3, F4-R3.

The PCR amplification system was as follows:

component (A)	Final concentration	Additive amount uL
			2×Hifair V MP Buffer	1×	7.5
Hifair V Enzyme Mix		1.2
			Primer F(10uM)	400nM	0.6
Primer R(10uM)	400nM	0.6
			20X Eva Green		0.75
ROX Dye 2(50x)	1×	0.3
			RNase free water		3.05
Template		1
			Total volume of		15

The PCR reaction procedure was as follows:

Each amplification primer pair was PCR amplified with the same template amount in the same PCR amplification system.

FIG. 2 shows the amplification results of the primer pairs F1-R1, F2-R2, F3-R3, F4-R3. As shown in FIGS. 2A-2H, each amplification primer corresponds to the amplification curve and the dissolution curve of PCR, respectively. As can be seen from the amplification curves, the CT values of F1-R1, F2-R2, F3-R3 and F4-R3 were 33.9, 34.6, 35.0 and 34.1, respectively. From the dissolution profile, the control groups of F1-R1, F2-R2 and F3-R3 had no peaks, and therefore, F1-R1, F2-R2 and F3-R3 had no primer dimer; the control group of F4-R3 had peaks, i.e., primer dimer. Wherein line 1 is the experimental group and line 2 is the control group without template.

And (3) selecting a primer pair with no primer dimer and smaller CT value of the amplified product, carrying out subsequent experiments, selecting an F1-R1 primer pair for the A sequence of the SPCSV, and selecting an F3-R3 primer pair for the B sequence of the SPCSV.

Example 2 design of gRNA for sweet potato chlorosis dwarf Virus specific nucleic acid

For the target sequence SEQ ID No.1, 4 gRNAs (gRNA 1, gRNA2, gRNA3, gRNA 4) were designed inside the segment or inside its complement; for the target sequence SEQ ID No.2, 2 gRNAs (gRNA 5, gRNA 6) were designed inside the segment or inside its complement. This embodiment is a gRNA designed based on Cas12i (SEQ ID No. 3) capable of binding Casl2i, the first 3 bases at the 5' end of each gRNA being TTN (PAM sequence).

The sequence of the designed gRNA is as follows:

FIG. 3 shows the position of each gRNA on the amplified sequence.

Example 3 use of gRNA for nucleic acid detection

To verify the detection efficiency of the different grnas designed in example 2 when applied to Cas12i proteins, the activity of the different grnas was verified in this embodiment.

Firstly, a single-stranded target sequence (ssDNA, SEQ ID No.1, 2) or a reverse complementary sequence thereof is adopted as a target nucleic acid, wherein the ssDNA is the ssDNA targeted by the corresponding gRNA.

The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

the following reaction system is adopted: cas12i final concentration was 25nM, gRNA final concentration was 25nM, target nucleic acid final concentration was 25nM, single-stranded nucleic acid detector final concentration was 200nM. FAM fluorescence/20 sec was read by incubation at 37 ℃. The control group had no target nucleic acid added.

FIG. 4 shows the results of reactions with target nucleic acids of ssDNA using gRNA-1, gRNA-2, gRNA-3, gRNA-4, gRNA-5, gRNA-6. As shown in FIGS. 4A-4F, the peak (plateau) times of the fluorescence signal when the gRNA-1, gRNA-2, gRNA-3, gRNA-4, gRNA-5, gRNA-6 reacted with the ssDNA target nucleic acid were around 23min, 7min, 15min, 9min, 6min and 15min, respectively. Compared with a control group, the gRNA-1, the gRNA-2, the gRNA-3, the gRNA-4, the gRNA-5 and the gRNA-6 can rapidly report fluorescence, and reflect better sensitivity of the detection method when the detection method is used for detecting the specific nucleic acid of the sweet potato chlorosis dwarf virus. Wherein line 1 is the experimental group and line 2 is the control group without template.

The efficiency of detecting double-stranded target sequences (dsDNA) was further verified for the good results of detecting single-stranded target sequences, gRNA-2, gRNA-4 and gRNA-5.

Double-stranded target sequences (dsDNA, SEQ ID nos. 1, 2) were used as double-stranded target nucleic acids, dsDNA being the dsDNA targeted by the corresponding gRNA.

The double-stranded target nucleic acid is obtained by the PCR reaction of the embodiment 1, wherein the template adopts the plasmid containing the target nucleic acid fragment, the adding amount of the template for the PCR reaction is 1000 copies, the PCR is amplified for 45 cycles, and after the PCR reaction is finished, 45ul of the Cas reaction system is added into 15ul of the PCR system.

The sequence of the single-stranded nucleic acid detector is FAM-TTATT-BHQ1;

the following detection system was used: cas12i was 50nM final, gRNA was 50nM final, target nucleic acid (dsDNA amplified by PCR in example 1) 15. Mu.l, single stranded nucleic acid detector was 200nM final. FAM fluorescence/20 sec was read by incubation at 37 ℃. The control group had no target nucleic acid added.

FIG. 5 shows the results of gRNA-2, gRNA-4 and gRNA-5 when reacted with a target nucleic acid of dsDNA. As shown in FIGS. 5A-5C, the peak (plateau) times of the fluorescent signals were about 20min, 12min and 17min, respectively, when the gRNA-2, gRNA-4, and gRNA-5 reacted with dsDNA target nucleic acids. Compared with a control group, the gRNA-2, the gRNA-4 and the gRNA-5 can show remarkable fluorescent signals in a shorter time, and reflect that the gRNA-2, the gRNA-4 and the gRNA-5 have better sensitivity for detecting dsDNA; in particular, gRNA-4 can reach the peak value of fluorescence signal in about 12 min. In fig. 5, 1 is an experimental group and 2 is a control group.

The length of the guide sequence of the gRNA (gRNA-5, 6) with better screening effect is 17-19bp, namely, the hybridization area of the guide sequence and the target nucleic acid is 17-19bp; in practice, one skilled in the art can add or subtract any base to the 3' end of the guide sequence (although it is also ensured that it hybridizes to the target nucleic acid); the 5' end of the guide sequence is adjacent to the PAM sequence and is not suitable for readjustment; however, as long as it is ensured that it has a hybridization region of 15bp to 30bp with the target sequence, the function of binding Cas enzyme to the target sequence can be achieved, and these changes in length do not substantially affect the activity of gRNA. For example, for the guide sequence of gRNA-5, 6, 1-4 bases (e.g., 1, 2, 3, or 4 bases) can be reduced at the 3' end, or 1-13 bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 bases) can be added without substantially affecting the efficiency of the gRNA and Cas protein in detecting the target nucleic acid, if pairing with the target sequence is warranted.

Example 4 further improving detection efficiency by mutating Cas protein

In order to further improve the detection efficiency of the sweet potato chlorosis dwarf virus, the embodiment performs mutation optimization on the Cas protein to improve the editing and detection activity of the Cas protein, and the applicant predicts key amino acid sites which possibly influence the biological functions of the Cas protein through bioinformatics and mutates the amino acid sites to obtain the Cas mutant protein with improved editing activity. Specifically, site-directed mutagenesis is performed on the amino acids that potentially inter-bind Cas12i3 to the target sequence by bioinformatics. In this example, the 168 th amino acid site from the N-terminus shown in SEQ ID No.3 is predicted by bioinformatics and subjected to site-directed mutagenesis, and the nucleic acid sequence of the wild type Cas12i3 is shown as SEQ ID No. 18.

Variants of Cas protein were generated by PCR-based site-directed mutagenesis. The specific method is to design a DNA sequence of the Cas12i3 protein into two parts by taking a mutation site as a center, design two pairs of primers to amplify the two parts of DNA sequences respectively, introduce the sequences to be mutated on the primers, and finally load the two fragments on a pcDNA3.3-eGFP vector in a Gibson cloning mode. The combination of mutants was constructed by splitting the DNA of Cas12i3 protein into multiple segments using PCR, gibson clone. Fragment amplification kit: transStart FastPfu DNA Polymerase (containing 2.5mM dNTPs) and the specific experimental procedures are shown in the specification. Glue recovery kit:

gel DNA Extraction Mini Kit, the detailed experimental procedures are shown in the specification. Kit for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU 201-03), the specific experimental procedures are described in the specification. The mutant amino acid sites involved and the primer sequences employed are shown in the following table: />

Cas protein obtained through experiments and mutated from N to R relative to 168 th amino acid of SEQ ID No.3, and then the activity of the mutant protein is verified through experiments.

Verifying the activity of gene editing of the obtained mutant protein N168R of the Cas12i in animal cells, and designing targets aiming at Chinese hamster ovary Cells (CHO) FUT8 genes, wherein the FUT8-Cas-XX-g3 is as follows: TTCCAGCCAAGGTTGTGGACGGATCA, italic part PAM sequence, underlined region Is a targeting region. The vector pcDNA3.3 is transformed to carry EGFP fluorescent protein and PuroR resistance genes. The SV40 NLS-Cas-XX fusion protein is inserted through enzyme cutting sites XbaI and PstI; the U6 promoter and the gRNA sequence are inserted through the enzyme cutting site Mfe 1. The CMV promoter initiates expression of the fusion protein SV40 NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS is linked to the protein GFP with the linker peptide T2A. Promoter EF-1. Alpha. Initiates puromycin resistance gene expression. And (3) paving: CHO cells were plated at a confluence of 70-80% and the number of cells seeded in 12 well plates was 8 x 10 x 4 cells/well. Transfection: plating for 24h for transfection, 6.25. Mu.l Hieff Trans were added to 100. Mu.l opti-MEM ^TM A liposome nucleic acid transfection reagent, and mixing uniformly; mu.l opti-MEM was added with 2.5ug of plasmid and mixed well. Diluted Hieff Trans ^TM The liposome nucleic acid transfection reagent is mixed with the diluted plasmid uniformly and incubated for 20min at room temperature. The incubated mixture is added to the cell-plated medium for transfection. Screening by adding puromycin: puromycin was added 24h after transfection, at a final concentration of 10. Mu.g/ml. Puromycin treatment for 24h was replaced with normal medium and incubation continued for 24h. 48h after transfection, cells with GFP signal were sorted by flow cytometry (FACS) digested with trypsin-EDTA (0.05%).

Extracting DNA, PCR amplifying the vicinity of the editing region, and carrying out hiTOM sequencing: cells were collected after pancreatin digestion and genomic DNA was extracted using the cell/tissue genomic DNA extraction kit (baitaike). Amplifying the region near the target for genomic DNA. The PCR products were subjected to hiTOM sequencing. Sequencing data analysis, counting the sequence types and the proportion in the range of 15nt and 10nt at the upstream and downstream of the target position, and counting the sequence with SNV frequency greater than/equal to 1% or non-SNV mutation frequency greater than/equal to 0.06% in the sequence to obtain the editing efficiency of Cas-XX protein on the target position. CHO cell FUT8 gene target sequence: FUT8-Cas-XX-g3: TTCCAGCCAAGGTTGTGGACGGATCA, italic part PAM sequence, underlined region targeting region. The gRNA sequence is: AGAGAAUGUGUGCAUAGUCAaCAC CAGCCAAGGUUGUGGACGGAUCA the underlined region is the targeting region and the other regions are the DR (repeat sequence) regions.

As shown in fig. 6, the editing efficiency of Cas12i3 protein (N168R) after the N168R amino acid site mutation is significantly improved compared with the wild-type Cas12i3 protein (WT) by about 2.5 times the editing efficiency of the wild-type, which indicates that the 168 th amino acid site from the N-terminus of SEQ ID No.3 is a key site for Cas12i3 to exert activity.

The efficiency of example 3 was further verified for the better detection of the double stranded target sequence (dsDNA) for the gRNA-5 in combination with the mutant protein Casl2i3-N168R using the method of example 3. A double-stranded target sequence (dsDNA, SEQ ID No. 2) is used as double-stranded target nucleic acid, the dsDNA is dsDNA targeted by the corresponding gRNA, the single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1, the double-stranded target nucleic acid amplification system and the detection system are referred to example 3, and the detection method is the same as that of example 3.

Experimental results show that the detection efficiency can be obviously improved by utilizing the combination of the optimized Cas12i3 mutant protein (N168R) and the gRNA-5 screened in the embodiment 3; when dsDNA is detected, the peak value of the fluorescence signal can be reached within about 10 min; compared with the combination of the wild type Cas12i and the gRNA, the detection time of the Cas12i3 mutant protein is shorter, the sensitivity is higher, and the effect is more remarkable.

Although specific embodiments of the invention have been described in detail, those skilled in the art will appreciate that: many modifications and variations of details may be made to adapt to a particular situation and the invention is intended to be within the scope of the invention. The full scope of the invention is given by the appended claims together with any equivalents thereof.

Claims (13)

1. A gRNA for detecting sweet potato chlorosis dwarf virus, the gRNA comprising a region that binds to a V-type Cas protein and a guide sequence that hybridizes to a target nucleic acid that is a nucleic acid derived from sweet potato chlorosis dwarf virus; wherein the targeting sequence that hybridizes to the target nucleic acid is selected from any one or a combination of the following:

(1) The targeting sequence hybridized with the target nucleic acid contains 17-30 bases and hybridizes with the sequence shown in SEQ ID No.2 or the reverse complement thereof, and the targeting sequence contains any one of the sequences shown in SEQ ID No. 8-9;

(2) The guide sequence hybridized with the target nucleic acid comprises any one of the sequences shown in SEQ ID No.8-9, and further comprises 1-13 bases at the 3' -end of any one of the sequences shown in SEQ ID No.8-9, and hybridizes with the sequence shown in SEQ ID No.2 or the reverse complement thereof;

(3) Compared with any one of the sequences shown in SEQ ID No.8-9, the guide sequence hybridized with the target nucleic acid continuously lacks 1-4 bases at the 3' -end of any one of the sequences shown in SEQ ID No. 8-9;

(4) The targeting sequence hybridized with the target nucleic acid is shown in any one of SEQ ID Nos. 8-9.

2. A method of detecting/diagnosing a sweet potato chlorosis dwarf virus or a sweet potato virus disease, the method comprising contacting a nucleic acid to be tested with a V-type Cas protein, the gRNA of claim 1, and a single stranded nucleic acid detector; the detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector is detected, thereby detecting/diagnosing sweet potato chlorosis dwarf virus or sweet potato virus disease.

3. The method of claim 2, wherein the V-type Cas protein is selected from any one of the following I-II:

I. the amino acid sequence of the V-type Cas protein is shown as SEQ ID No. 3;

II. Compared with SEQ ID No.3, the amino acid sequence of the V-type Cas protein has mutation at the 168 th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 3.

4. The method of claim 2, further comprising the step of obtaining the test nucleic acid from the test sample.

5. The method of any one of claims 2 to 4, further comprising the step of amplifying the nucleic acid to be detected using a primer pair.

6. The method according to claim 5, wherein the primer pair is selected from i and/or ii:

i. the upstream primer of the primer pair is shown as SEQ ID No.15, and the downstream primer of the primer pair is shown as SEQ ID No. 16;

ii. The upstream primer of the primer pair is shown as SEQ ID No.17, and the downstream primer of the primer pair is shown as SEQ ID No. 16.

7. The method of claim 4, wherein the sample is a sample of a plant or a plant-derived toxin-transmitting medium.

8. The method of claim 2, wherein the detectable signal is achieved by either: visual-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase change, electrochemical detection, or semiconductor-based detection.

9. A system, composition or kit for detecting or diagnosing whether a plant to be tested is infected with sweet potato chlorosis dwarf virus, the system, composition or kit comprising a type V Cas protein, the gRNA of claim 1, and a single stranded nucleic acid detector.

10. A system, composition or kit for detecting/diagnosing a sweet potato chlorosis dwarf virus or a sweet potato virus disease, the system, composition or kit comprising the gRNA of claim 1, the system, composition or kit further comprising a type V Cas protein and a single stranded nucleic acid detector.

11. The system, composition or kit according to any one of claims 9-10, wherein the system, composition or kit comprises the primer pair of claim 6.

12. Use of a composition according to any one of claims 9-11 for diagnosing or detecting a sweet potato virus disease, or for the preparation of a reagent or kit for diagnosing or detecting a sweet potato virus disease.

13. Use of a composition according to any one of claims 9-11 for detecting or diagnosing sweet potato chlorosis virus or for preparing a reagent or kit for detecting or diagnosing sweet potato chlorosis virus.

Images