CN115851714A

CN115851714A - Method for detecting sweet potato chlorotic stunt virus based on CRISPR technology

Info

Publication number: CN115851714A
Application number: CN202211009780.7A
Authority: CN
Inventors: 王丽梅; 赵莹
Original assignee: Shunfeng Biotechnology Hainan Co ltd; Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shunfeng Biotechnology Hainan Co ltd; Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2021-09-27
Filing date: 2022-08-22
Publication date: 2023-03-28
Also published as: CN113789330A

Abstract

The invention provides a method for detecting sweet potato chlorosis dwarfing virus or sweet potato virus disease based on CRISPR technology, which comprises the steps of detecting by using gRNA, cas protein and a single-stranded nucleic acid detector; by screening and optimizing the gRNA, the detection efficiency is improved, and the method has a wide application prospect.

Description

Method for detecting sweet potato chlorotic stunt virus based on CRISPR technology

Technical Field

The invention relates to the field of nucleic acid detection, in particular to a method, a system and a kit for detecting sweet potato chlorotic stunt virus based on a CRISPR (clustered regularly interspaced short palindromic repeats) technology.

Background

Sweet Potato Chlorotic Stunt Virus (SPCSV) belongs to a member of the genus Rhabdoviridae of the family Rhabdoviridae. The sweet potato chlorotic stunt virus is one of main viruses harmful to sweet potatoes and is mainly transmitted by bemisia tabaci, and particularly, the sweet potato chlorotic stunt virus can co-infect the sweet potatoes together with the sweet potato feather mottle virus to cause Sweet Potato Virus Diseases (SPVD). Sweet potato virus diseases are one of the most serious virus diseases of sweet potatoes, and can generally reduce the yield of the sweet potatoes by 50-98 percent and even stop the harvest.

The detection method of the sweet potato chlorotic stunt virus mainly comprises the following steps: visual inspection, indicator plant detection method, enzyme-linked immunosorbent assay, immune electron microscopy, nucleic acid hybridization and RT-PCR.

The invention provides a novel method for detecting sweet potato chlorotic stunt virus, which is a rapid detection method with high specificity and high detection sensitivity based on CRISPR technology, in particular based on trans activity of V-type Cas enzyme.

Disclosure of Invention

The invention provides a method, a system and a kit for detecting sweet potato chlorotic stunt virus based on a CRISPR technology.

In one aspect, the present invention provides a gRNA for detecting sweetpotato chlorotic stunt virus, the gRNA including a region binding to a Cas protein and a guide sequence hybridizing to a target nucleic acid, which is a nucleic acid derived from sweetpotato chlorotic stunt virus.

In the present invention, the region that binds to the CRISPR/CAS effector protein, also known as the direct repeat, backbone region or spacer sequence, interacts with the CAS protein, thereby binding to the CAS protein.

In one embodiment, the gRNA comprises, in order from 5 'to 3', a region that binds to a Cas protein and a guide sequence that hybridizes to a target nucleic acid.

In one embodiment, the guide sequence which hybridizes to the target nucleic acid comprises 20 to 30 bases and hybridizes to the sequence shown in SEQ ID No.1 or the reverse complement thereof and comprises the sequence shown in any one of SEQ ID nos. 4 to 7; preferably, the targeting sequence comprises a sequence shown in any one of SEQ ID nos. 4, 5, 6, 7.

In preferred embodiments, the targeting sequence that hybridizes to the target nucleic acid contains 20-30 bases, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bases.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid comprises the sequence set forth in any one of SEQ ID nos. 4 to 7 and further comprises 1 to 10 bases (preferably, 1, 2, 3, 4, 5, 6, 7, 8, 9 bases) at the 3' end of the sequence set forth in any one of SEQ ID nos. 4 to 7, and the targeting sequence that hybridizes to the target nucleic acid hybridizes to the sequence set forth in SEQ ID No.1 or the reverse complement thereof; preferably, the targeting sequence comprises a sequence shown in any one of SEQ ID nos. 4, 5, 6, 7.

In one embodiment, the targeting sequence that hybridizes to the target nucleic acid lacks 1 to 5 bases (e.g., 1, 2, 3, 4, 5 bases) in succession from the 3' end of the sequence shown in any of SEQ ID Nos. 4 to 7 as compared to the sequence shown in any of SEQ ID Nos. 4 to 7.

The hybridization with the sequence shown in SEQ ID No.1 or the reverse complementary sequence thereof means that the guide sequence and a continuous section of the reverse complementary sequence of SEQ ID No.1 or SEQ ID No.1 can be continuously complementary and paired. For example, if the targeting sequence that hybridizes to the target nucleic acid contains 30 bases, then 30 bases of the targeting sequence need to be complementarily paired with the consecutive 30 bases of SEQ ID No.1 or the complement of SEQ ID No. 1.

In a more preferred embodiment, the targeting sequence for hybridization to the target nucleic acid is as set forth in any one of SEQ ID Nos. 4-7.

In one embodiment, the Cas protein is selected from a type V Cas protein, e.g., cas12, cas14 family proteins, or mutants thereof.

In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12j.

Preferably, the sequence of the region binding to the Cas protein is shown in SEQ ID No. 10.

In another aspect, the present invention provides a method for detecting/diagnosing sweet potato chlorosis-dwarfing virus or sweet potato virus disease, comprising contacting a nucleic acid to be detected with a V-type Cas protein, the above gRNA, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting/diagnosing the sweetpotato chlorosis-dwarfing virus or the sweetpotato virus disease.

In one embodiment, the V-type Cas protein is selected from any one of the following I-II:

I. the amino acid sequence of the V-type Cas protein is shown as SEQ ID No. 3;

II. Compared with the amino acid sequence of SEQ ID No.3, the amino acid sequence of the V-type Cas protein has mutation at the 168 th amino acid corresponding to the amino acid sequence shown in SEQ ID No. 3.

In one embodiment, the 168 th amino acid position is mutated to a non-N amino acid, e.g., a, V, G, L, Q, F, W, Y, D, S, E, K, M, T, C, P, H, R, I; preferably, the 168 th amino acid is mutated to R.

It will be appreciated that proteins may be altered in various ways, including amino acid substitutions, deletions, truncations, and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above proteins can be prepared by mutation of the DNA. It may also be accomplished by other forms of mutagenesis and/or by directed evolution, e.g., using known methods of mutagenesis, recombination and/or shuffling (shuffling), in conjunction with related screening methods, to make single or multiple amino acid substitutions, deletions and/or insertions.

One skilled in the art will appreciate that these minor amino acid changes in the Cas protein of the invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site or other functional domain of the protein, the properties of the polypeptide may change, but the polypeptide may retain its activity. Minor effects may be expected if the mutations present are not close to the catalytic domain, active site or other functional domains.

One skilled in the art can identify essential amino acids of the Cas mutein of the present invention according to methods known in the art, such as site-directed mutagenesis or analysis of protein evolution or bioinformatics. The catalytic domain, active site or other functional domain of a protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutations in putative key site amino acids.

In the present invention, amino acid residues can be represented by a single letter or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro,

p), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

The term "AxB" means that the amino acid A at position xx is changed to the amino acid B, for example N168R means that N at position 168 is mutated to R.

The specific amino acid position (numbering) within the proteins of the invention is determined by aligning the amino acid sequence of the protein of interest with SEQ ID No.3 using standard sequence alignment tools, such as the Smith-Waterman algorithm or the CLUSTALW2 algorithm, wherein the sequences are considered aligned when the alignment score is highest. The alignment score can be determined according to Wilbur, w.j.and Lipman, d.j. (1983) Rapid basis search of nuclear acid and protein data bases, proc.natl.acad.sci.usa,80: 726-730. Default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap opening penalty =10.0; protein gap extension penalty =0.2; protein matrix = Gonnet; protein/DNA end gap = -1; protein/dnagapdest =4. The position of a particular amino acid within a protein according to the invention is preferably determined by comparing the amino acid sequence of the protein with SEQ ID No.3 using the AlignX program (part of the vectorNTI set) with default parameters (gap opening penalty: 10og gap extension penalty 0.05) that are suitable for multiple alignments.

Further, the method further comprises the step of obtaining a nucleic acid to be tested from a sample to be tested; preferably, the nucleic acid to be detected is obtained from a sample to be detected by amplification.

Further, the method also comprises a step of obtaining the nucleic acid to be detected by amplifying the nucleic acid to be detected by using the primer pair.

The upstream primer of the primer pair is shown as SEQ ID NO:11 or 13, and the downstream primer of the primer pair is shown as SEQ ID NO:12 or 14.

In one embodiment, the primer pair is selected from i and/or ii as follows:

i. the upstream primer of the primer pair is shown as SEQ ID NO:11, the downstream primer of the primer pair is shown as SEQ ID NO:12 is shown in the specification;

ii. The upstream primer of the primer pair is shown as SEQ ID NO:13, the downstream primer of the primer pair is shown as SEQ ID NO:14 is shown in the figure;

preferably, the upstream primer of the primer pair is shown as SEQ ID NO:11, the downstream primer of the primer pair is shown as SEQ ID NO: shown at 12.

In the present invention, the nucleic acid to be detected may be a double-stranded nucleic acid or a single-stranded nucleic acid.

The amplification of the invention is selected from one or more of PCR, nucleic acid sequencing-based amplification (NASBA), recombinase Polymerase Amplification (RPA), loop-mediated isothermal amplification (LAMP), strand Displacement Amplification (SDA), helicase-dependent amplification (HDA), nicking Enzyme Amplification Reaction (NEAR), multiple Displacement Amplification (MDA), rolling Circle Amplification (RCA), ligase Chain Reaction (LCR) and derivative amplification method (RAM).

In the present invention, the sample may be a sample from a plant, for example, sweet potato, potato; in other embodiments, the sample may also be from other plants, for example, tobacco.

In one embodiment, the sample may be a viral vector of a plant, e.g., potato seedling, potato tuber, bemisia tabaci, aphid sample.

In other embodiments, the sample may also be derived from an environmental sample, e.g., air, water, soil, etc.

In another aspect, the present invention provides a composition for detecting/diagnosing sweet potato chlorotic stunting virus, the composition including the above gRNA, further including a Cas protein and a single-stranded nucleic acid detector; preferably, the primer set is further included.

In another aspect, the present invention further provides a system, composition or kit for detecting or diagnosing whether a plant to be tested is infected with sweet potato virus disease, wherein the system, composition or kit comprises a V-type Cas protein, the gRNA and a single-stranded nucleic acid detector. Further, the system, composition or kit further comprises an amplification primer; preferably, the amplification primers comprise the primer pairs described above.

On the other hand, the invention also provides the application of the composition for detecting or diagnosing whether the plant to be detected is infected with the sweet potato virus disease in diagnosing or detecting the sweet potato virus disease, or the application in preparing a reagent or a kit for diagnosing or detecting the sweet potato virus disease.

In another aspect, the present invention also provides a system, composition or kit for detecting/diagnosing sweet potato chlorotic stunting virus, which includes a type V Cas protein, the above-mentioned gRNA (guide RNA), and a single-stranded nucleic acid detector; preferably, the primer set is further included.

In another aspect, the invention also provides the application of the system, the composition or the kit in detecting/diagnosing the sweet potato chlorosis dwarfing virus.

On the other hand, the invention also provides application of the composition in preparing a reagent or a kit for detecting/diagnosing sweet potato chlorotic stunt virus.

Further, the V-type Cas protein is selected from Cas12, a Cas14 family protein, or a mutant thereof.

In one embodiment, the Cas12a is selected from one or any several of FnCas12a, assas 12a, lbCas12a, lb5Cas12a, hkCas12a, osCas12a, tsCas12a, bbCas12a, boCas12a or Lb4Cas12 a.

In a preferred embodiment, the amino acid sequence of the Cas12i protein is selected from the group consisting of:

(1) The amino acid sequence of SEQ ID NO: 3;

(2) Converting SEQ ID NO:3 or an active fragment thereof by substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues, and has substantially the same function;

(3) And SEQ ID NO:3, and having trans activity, of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%.

In one embodiment, the Cas protein mutant comprises amino acid substitutions, deletions or substitutions, and the mutant retains at least its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

In the present invention, a "Cas mutein" may also be referred to as a mutated Cas protein, or a Cas protein variant.

In the present invention, the single-stranded nucleic acid detector includes a single-stranded DNA, a single-stranded RNA, or a single-stranded DNA-RNA hybrid. In other embodiments, the single-stranded nucleic acid detector comprises a mixture of any two or three of single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrids, e.g., a combination of single-stranded DNA and single-stranded RNA, a combination of single-stranded DNA and single-stranded DNA-RNA hybrids, and a combination of single-stranded RNA and single-stranded DNA-RNA. In other embodiments, the single stranded nucleic acid detector further comprises modifications to the bases.

In a preferred embodiment, the single stranded nucleic acid detector is a single stranded oligonucleotide detector.

The single-stranded nucleic acid detector does not hybridize to the gRNA.

In the present invention, the detectable signal is realized by: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, and semiconductor-based detection.

In some embodiments, the methods of the invention further comprise the step of measuring a detectable signal produced by the CRISPR/CAS effector protein (CAS protein). The Cas protein, upon recognition or hybridization to the target nucleic acid, can stimulate the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and thereby producing a detectable signal.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, fluorescence signal, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal may be read by any suitable means, including but not limited to: measurement of a detectable fluorescent signal, gel electrophoresis detection (by detecting a change in a band on the gel), detection of the presence or absence of a color based on vision or a sensor, or a difference in the presence of a color (e.g., based on gold nanoparticles) and a difference in an electrical signal.

In a preferred embodiment, the detectable signal is achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different reporter groups, and when the single-stranded nucleic acid detector is cut, a detectable reporter signal can be shown; for example, a single-stranded nucleic acid detector having a fluorophore and a quencher disposed at opposite ends thereof, when cleaved, can exhibit a detectable fluorescent signal.

In one embodiment, the fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In other embodiments, the detectable signal may also be achieved by: the 5 'end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different marker molecules, and a reaction signal is detected in a colloidal gold detection mode.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single stranded nucleic acid detector produces a first detectable signal prior to cleavage by the Cas protein and produces a second detectable signal different from the first detectable signal after cleavage.

In other embodiments, the single-stranded nucleic acid detector comprises one or more modifications, such as base modifications, backbone modifications, sugar modifications, and the like, to provide new or enhanced features (e.g., improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms therein include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates. In some embodiments, the single stranded nucleic acid detector comprises one or more phosphorothioate and/or heteroatomic nucleotide linkages. In other embodiments, the single stranded nucleic acid detector can be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetics are Peptide Nucleic Acids (PNAs), another class of nucleic acid mimetics is based on linked morpholino units having a heterocyclic base attached to a morpholino ring (morpholino nucleic acids), and other nucleic acid mimetics further include cyclohexenyl nucleic acids (CENAs), further including ribose or deoxyribose chains.

In one embodiment, the Cas protein and gRNA are used in a molar ratio of (0.8-1.2): 1.

in one embodiment, the Cas protein is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50nM.

In one embodiment, the gRNA is used in a final concentration of 20-200nM, preferably, 30-100nM, more preferably, 40-80nM, more preferably, 50nM.

In one embodiment, the test nucleic acid is used in a final concentration of 5-100nM, preferably 10-50nM.

In one embodiment, the single stranded nucleic acid detector is used in a final concentration of 100-1000nM, preferably 150-800nM, preferably 200-500nM, preferably 200-300nM.

In one embodiment, the single stranded nucleic acid detector has 2 to 300 nucleotides, preferably, 3 to 200 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, more preferably, 5 to 15 nucleotides.

The terms "hybridize" or "complementary" or "substantially complementary" refer to a nucleic acid (e.g., RNA, DNA) that comprises a nucleotide sequence that enables it to bind non-covalently, i.e., to form base pairs and/or G/U base pairs with another nucleic acid in a sequence-specific, antiparallel manner (i.e., the nucleic acid binds specifically to the complementary nucleic acid), "anneal" or "hybridize". Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases are possible. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, variables well known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or a target region that hybridizes thereto has 100% sequence complementarity of the target region.

General definition:

unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence of 3 to 100 nucleotides, preferably 3 to 30 nucleotides, preferably 4 to 20 nucleotides, more preferably 5 to 15 nucleotides.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. Between the two sequences. Typically, the comparison is made when the two sequences are aligned to yield maximum identity. Such alignment can be achieved by using, for example, the identity of the amino acid sequences can be determined by conventional methods, see, e.g., smith and Waterman,1981, adv.Appl.Math.2: 482Pearson &Lipman,1988, proc.Natl Acad.Sci.USA 85: 2444, thompson et al, 1994, nucleic Acids Res22:467380 et al, determined by computerized operations algorithms (GAP, BESTFIT, FASTA, and TFASTA, genetics Computer Group in the Wisconsin Genetics software package). The BLAST algorithm, available from the national center for Biotechnology information (NCBI www.ncbi.nlm.nih.gov /), can also be used, determined using default parameters.

As used herein, the "CRISPR" refers to Clustered, regularly spaced short palindromic repeats (Clustered regulated interspersed short palindromic repeats) derived from the immune system of a microorganism.

As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "avidin", also called avidin, is a basic glycoprotein having 4 binding sites with a very high affinity to biotin, and streptavidin is a commonly used avidin. The very strong affinity of biotin to avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easily bonded to a protein (such as an antibody) by a covalent bond, and an avidin molecule bonded to an enzyme reacts with a biotin molecule bonded to a specific antibody, so that not only is a multi-stage amplification effect achieved, but also color is developed due to the catalytic effect of the enzyme when the enzyme meets a corresponding substrate, and the purpose of detecting an unknown antigen (or antibody) molecule is achieved.

Cas protein

As used herein, "Cas protein" refers to a CRISPR-associated protein, preferably from type V or type VI CRISPR/Cas protein, which upon binding to a signature sequence (target sequence) to be detected (i.e., forming a ternary complex of Cas protein-gRNA-target sequence) can induce its trans activity, i.e., random cleavage of non-targeted single-stranded nucleotides (i.e., single-stranded nucleic acid detector, preferably single-stranded DNA (ssDNA), single-stranded DNA-RNA hybrid, single-stranded RNA, as described herein). When the Cas protein is combined with the characteristic sequence, the protein can induce the trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cleaving the signature sequence; more preferably, it induces its trans activity by cleaving the single-stranded signature sequence.

The Cas protein is a protein at least having trans cleavage activity, and preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity that the Cas protein can recognize a PAM site and specifically cut a target sequence under the action of gRNA.

The Cas protein provided by the invention comprises CRISPR/CAS effector proteins of V type and VI type, and comprises protein families of Cas12, cas13, cas14 and the like. Preferably, e.g., a Cas12 protein, e.g., cas12a, cas12b, cas12d, cas12e, cas12f, cas12g, cas12h, cas12i, cas12j; preferably, the Cas protein is Cas12a, cas12b, cas12i, cas12j. The Cas13 protein family includes Cas13a, cas13b, and the like.

In embodiments, a Cas protein, as referred to herein, such as Cas12, also encompasses a functional variant of Cas or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Also included in functional variants are fusion products of such proteins with another, usually unrelated, nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or orthologs or homologs thereof, may be codon optimized for expression in a eukaryotic cell. Eukaryotes can be as described herein. One or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or ortholog or homolog thereof may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations.

In one embodiment, the Cas protein may be from: cilium, listeria, corynebacterium, satrapia, legionella, treponema, proteus, eubacterium, streptococcus, lactobacillus, mycoplasma, bacteroides, flavivivola, flavobacterium, azospirillum, sphaerochaeta, gluconacetobacter, neisseria, rochelia, parvibaculum, staphylococcus, nitrarefactor, mycoplasma, campylobacter, and Muspirillum.

The Cas protein can be obtained by recombinant expression vector technology, namely, a nucleic acid molecule encoding the protein is constructed on a proper vector and then is transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, and the corresponding protein is obtained. The protein can be secreted by cells, or the protein can be obtained by breaking cells through a conventional extraction technology. The encoding nucleic acid molecule may or may not be integrated into the genome of the host cell for expression. The vector may further comprise regulatory elements which facilitate sequence integration, or self-replication. The vector may be of the type of plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art, and preferably, the expression vector of the present invention is a plasmid. The vector further comprises one or more regulatory elements selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

The host cell may be a prokaryotic cell, such as E.coli, streptomyces, agrobacterium: or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell.

gRNA

As used herein, the "gRNA" is also known as guidearna or guide RNA, and has a meaning commonly understood by those skilled in the art. In general, the guide RNA may comprise, or consist essentially of, a direct repeat and a guide sequence (guide sequence). grnas in different CRISPR systems may include crRNA and tracrRNA, or may contain only crRNA, depending on the Cas protein on which they depend. The crRNA and tracrRNA may be artificially engineered to fuse to form singleguideRNA (sgRNA). In certain instances, the guide sequence is any polynucleotide sequence that is sufficiently complementary to a target sequence (a signature sequence described in the present invention) to hybridize to the target sequence and direct specific binding of the CRISPR/Cas complex to the target sequence, typically having a sequence length of 12-25 nt. The direct repeat sequence can fold to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The targeting sequence need not be 100% complementary to the signature sequence (target sequence). The targeting sequence is not complementary to the single stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (degree of match) between a targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% when optimally aligned. It is within the ability of one of ordinary skill in the art to determine the optimal alignment. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, clustalW, the Smith-Waterman algorithm in matlab (Smith-Waterman), bowtie, geneius, biopython, and SeqMan.

The gRNA of the invention can be natural, and can also be artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2 to 200 nucleotides, preferably, 2 to 150 nucleotides, preferably, 3 to 100 nucleotides, preferably, 3 to 30 nucleotides, preferably, 4 to 20 nucleotides, and more preferably, 5 to 15 nucleotides. Preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

The single stranded nucleic acid detector is used in a detection method or system to report the presence or absence of a target nucleic acid in a sample. The single-stranded nucleic acid detector comprises different reporter groups or marker molecules at both ends, and does not present a reporter signal when in an initial state (i.e., an uncleaved state), and presents a detectable signal when the single-stranded nucleic acid detector is cleaved, i.e., presents a detectable difference after cleavage from before cleavage. In the present invention, if a detectable difference can be detected, it is reflected that the target nucleic acid can be detected; alternatively, if the detectable difference is not detectable, it is a reflection that the target nucleic acid is not detectable.

In one embodiment, the reporter group or the marker molecule comprises a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, texas Red or LC RED 460; the quenching group is selected from one or more of BHQ1, BHQ2, BHQ3, dabcy1 or Tamra.

In other embodiments, the single stranded nucleic acid detector has a first molecule (e.g., FAM or FITC) attached to one end and a second molecule (e.g., biotin) attached to the other end. The reaction system containing the single-stranded nucleic acid detector is used in combination with a flow strip to detect the target nucleic acid (preferably, in a colloidal gold detection manner). The flow strip is designed with two capture lines, with an antibody that binds to a first molecule (i.e. a first molecular antibody) at the sample contacting end (colloidal gold), an antibody that binds to the first molecular antibody at the first line (control line), and an antibody that binds to a second molecule (i.e. a second molecular antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecular antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture line, the cleaved reporter will bind to the antibody of the first molecular antibody at the first capture line, and the uncleaved reporter will bind to the second molecular antibody at the second capture line. Binding of the reporter group on each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signal will accumulate at the first capture line and less signal will appear at the second line. In certain aspects, the invention relates to the use of a flow strip as described herein for detecting nucleic acids. In certain aspects, the invention relates to a method of detecting nucleic acids using a flow strip as defined herein, e.g. a (side) flow test or a (side) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector may be replaced with each other, or the positions of the molecules may be changed, and the modified form is also included in the present invention as long as the reporting principle is the same as or similar to that of the present invention.

The detection method of the present invention can be used for quantitative detection of a target nucleic acid. The quantitative detection index can be quantified according to the signal intensity of the reporter group, such as the luminous intensity of a fluorescent group, or the width of a color development strip.

Sequence information

The partial sequence information related to the present invention is provided as follows:

/>

drawings

FIG. 1 shows the amplification sequences-A and-B of sweetpotato chlorotic stunt virus, and the positions of the primers on the amplification sequences.

FIG. 2 is a graph showing the amplification results of different primer pairs (F1-R1, F2-R2, F3-R3, and F4-R3). Wherein line 1 is the experimental group and line 2 is the control group without template. Each amplification primer pair corresponds to the amplification curve and the dissolution curve of PCR respectively. According to the amplification curves, the CT values of F1-R1, F2-R2, F3-R3 and F4-R3 are 33.9, 34.6, 35.0 and 34.1 respectively; according to the melting curve, F1-R1, F2-R2 and F3-R3 have no primer dimer, and F4-R3 have primer dimer.

FIG. 3 shows the amplification sequences-A and B-sequences of sweetpotato chlorotic stunt virus, and the positions of the respective gRNAs on the amplification sequences.

FIG. 4 is a graph showing the results of detection of ssDNA target nucleic acids by different gRNAs (gRNA-1, gRNA-2, gRNA-3, gRNA-4, gRNA-5, and gRNA-6). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when the gRNA-1, the gRNA-2, the gRNA-3, the gRNA-4, the gRNA-5 and the gRNA-6 react with the ssDNA target nucleic acid is respectively about 23min, 7min, 15min, 9min, 6min and 15 min.

FIG. 5 is a graph showing the results of detection of dsDNA target nucleic acids by different gRNAs (gRNA-2, gRNA-4, and gRNA-5). Wherein line 1 is an experimental group and line 2 is a control group to which no target nucleic acid is added; the time for the fluorescent signals to reach the peak value (reach the plateau phase) when the gRNA-2, the gRNA-4 and the gRNA-5 react with the dsDNA target nucleic acid is respectively about 20min, 12min and 17 min.

Figure 6. Validation results of editing efficiency of cas mutein.

Detailed Description

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

The technical scheme of the invention is based on the following principle, combines PCR amplification with CRISPR technology, and has the characteristics of rapidness, sensitivity, specificity and high efficiency. Under the premise that specific nucleic acid of target pathogenic bacteria exists in a sample, a specific primer is combined with a target sequence, the target sequence is enriched through PCR amplification, cas enzyme (Cas protein) is combined with an amplification product under the guidance of gRNA, the trans-cleavage (trans) activity of the Cas protein is activated, a Reporter (one end of the Reporter is connected with a fluorescent group, and the other end of the Reporter is connected with a quenching group) in a cleavage system can release fluorescence after being cleaved by the Cas protein, so that a detection result is presented. In other embodiments, both ends of the single-stranded nucleic acid detector (Reporter) may be provided with a label capable of being detected by colloidal gold.

Example 1 amplification of sweet Potato chlorotic dwarf Virus-specific nucleic acid

In this embodiment, the design of primers and the amplification of target nucleic acids are performed for specific nucleic acids of Sweet Potato Chlorotic Stunt Virus (SPCSV).

According to the genome of SPCSV, two specific sequences are selected for PCR amplification (for the convenience of distinguishing, named as A sequence and B sequence respectively):

<xnotran> ttctggtgctctgtttcttgttggcggatcctcgttactgcggaaagtgcaatctgacgttagtaatttttccaagtcgattggactgactcccataattgacaaagacttaaggtctgccgtgtcttatggttgttctat (A , SEQ ID No. 1) </xnotran>

<xnotran> gatgtaatagtcggtggtgctgcacaagtgttagatgcttctcaactaccgcactgttacttctacgatctaaaacgatgggttggggttgataggctgtcttttgaagaaatcaaacgtaagatagctccccagtattcggtcaaattggaaggtaatgatgttctga (B , SEQ ID No. 2) </xnotran>

Based on the genome a sequence of SPCSV, amplification primers were designed as follows:

F1：tgttggcggatcctcgttac；

R1：ccataagacacggcagacct；

F2：gttggcggatcctcgttact；

R2：ccataagacacggcagacctt；

based on the genome B sequence of SPCSV, the amplification primers were designed as follows:

F3：aaacgatgggttggggttga；

R3：ttgaccgaatactggggagc；

F4：gtggtgctgcacaagtgttag；

FIG. 1 shows the position of each primer on the amplified sequence.

The following PCR amplification primer pair combinations were selected: F1-R1, F2-R2, F3-R3, F4-R3.

The PCR amplification system is as follows:

components	Final concentration	Addition amount uL
			2×Hifair V MP Buffer	1×	7.5
Hifair V Enzyme Mix		1.2
			Primer F(10uM)	400nM	0.6
Primer R(10uM)	400nM	0.6
			20X Eva Green		0.75
ROX Dye2(50x)	1×	0.3
			RNase free water		3.05
Template		1
			Total volume		15

The PCR reaction procedure was as follows:

two step amplification
			Step1
	50℃	10min
			Step2	95℃	5min
Step3	95℃	15Sec
				60℃	30sec
45cycles

And each amplification primer pair is subjected to PCR amplification under the same PCR amplification system and the same template amount.

FIG. 2 shows the amplification results of the primer pairs F1-R1, F2-R2, F3-R3, F4-R3. As shown in FIGS. 2A-2H, each amplification primer pair corresponds to the amplification curve and the lysis curve of PCR, respectively. According to the amplification curves, the CT values of F1-R1, F2-R2, F3-R3 and F4-R3 are 33.9, 34.6, 35.0 and 34.1 respectively. As can be seen from the dissolution curves, the control groups of F1-R1, F2-R2 and F3-R3 have no peaks, and thus F1-R1, F2-R2 and F3-R3 have no primer dimers; the control group of F4-R3 had a peak, i.e., primer dimer. Wherein line 1 is the experimental group and line 2 is the control group without template.

And selecting a primer pair with an amplification product without primer dimer and a smaller CT value for subsequent experiments, selecting an F1-R1 primer pair for the A sequence of the SPCSV, and selecting an F3-R3 primer pair for the B sequence of the SPCSV.

Example 2 design of gRNA of sweet Potato chlorotic dwarf Virus-specific nucleic acid

4 gRNAs (gRNA 1, gRNA2, gRNA3, gRNA 4) are designed in the segment or the complementary sequence thereof aiming at the target sequence SEQ ID No. 1; 2 gRNAs (gRNA 5, gRNA 6) were designed in the region of the target sequence SEQ ID No.2 or in the complementary sequence. The grnas designed based on Cas12i (SEQ ID No. 3) and capable of binding Cas12i in this embodiment are TTN (PAM sequence) for the first 3 bases at the 5' end of each gRNA.

The sequences of the designed grnas were as follows:

fig. 3 shows the position of each gRNA on the amplified sequence.

Example 3 application of gRNA to nucleic acid detection

In order to verify the detection efficiency of different grnas designed in example 2 when applied to Cas12i protein, the activity of different grnas was verified in this embodiment.

Firstly, a single-stranded target sequence (ssDNA, SEQ ID No.1, 2) or a reverse complement thereof is used as a target nucleic acid, and the ssDNA is the ssDNA targeted by the corresponding gRNA.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

the following reaction system is adopted: cas12i final concentration is 25nM, gRNA final concentration is 25nM, target nucleic acid final concentration is 25nM, single stranded nucleic acid detector final concentration is 200nM. Incubation at 37 ℃ and reading FAM fluorescence/20 sec. The control group had no target nucleic acid added.

FIG. 4 shows the results of reactions with a target nucleic acid of ssDNA using gRNA-1, gRNA-2, gRNA-3, gRNA-4, gRNA-5, and gRNA-6. As shown in FIGS. 4A to 4F, the time when the fluorescence signal reaches the peak (plateau) when the gRNA-1, the gRNA-2, the gRNA-3, the gRNA-4, the gRNA-5, and the gRNA-6 react with the ssDNA target nucleic acid was 23min, 7min, 15min, 9min, 6min, and 15min, respectively. Compared with a control group, the gRNA-1, the gRNA-2, the gRNA-3, the gRNA-4, the gRNA-5 and the gRNA-6 can rapidly report fluorescence, and reflect better sensitivity when the sweet potato chlorosis dwarfing virus specific nucleic acid detection is carried out. Wherein line 1 is the experimental group and line 2 is the control group without template.

Aiming at gRNA-2, gRNA-4 and gRNA-5 with better effect of detecting single-chain target sequences, the efficiency of the method in detecting double-chain target sequences (dsDNA) is further verified.

Double-stranded target sequences (dsDNA, SEQ ID nos. 1, 2) are used as double-stranded target nucleic acids, the dsDNA being the dsDNA targeted by the corresponding gRNA.

The double-stranded target nucleic acid was obtained from the PCR reaction of example 1, wherein the template was a plasmid containing the target nucleic acid fragment, the amount of template added for the PCR reaction was 1000 copies, the PCR amplification was performed for 45 cycles, and after the PCR reaction was completed, 45ul of Cas reaction system was added to 15ul of PCR system.

The single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1;

the following detection system was used: cas12i concentration of 50nM, gRNA concentration of 50nM, target nucleic acid (PCR amplified dsDNA in example 1) 15. Mu.l, single stranded nucleic acid detector concentration of 200nM. Incubation at 37 ℃ and reading FAM fluorescence/20 sec. The control group had no target nucleic acid added.

FIG. 5 shows the results of gRNA-2, gRNA-4, and gRNA-5 when reacted with a target nucleic acid of dsDNA. As shown in FIGS. 5A to 5C, the time for the fluorescence signal to reach the peak (plateau) when gRNA-2, gRNA-4, and gRNA-5 react with the dsDNA target nucleic acid was about 20min, 12min, and 17min, respectively. Compared with a control group, the gRNA-2, the gRNA-4 and the gRNA-5 can show obvious fluorescent signals in a shorter time, so that the sensitivity of detecting dsDNA is better; particularly gRNA-4, the peak value of the fluorescence signal can be reached within about 12 min. In fig. 5, 1 is an experimental group and 2 is a control group.

The length of the guide sequence of the gRNA (gRNA-1, 2, 3 and 4) with better effect screened in the application is 20bp, namely, the hybridization region of the guide sequence and the target nucleic acid is 20bp; in practice, one skilled in the art can add or reduce any base at the 3' end of the guide sequence (although it is also ensured that it hybridizes to the target nucleic acid); the 5' end of the leader sequence is adjacent to the PAM sequence and is not suitable for readjustment; however, these length changes do not substantially affect the activity of gRNA, as long as the 3' end is guaranteed to have a 15bp-30bp hybridizing region with the target sequence, i.e., to achieve the function of binding Cas enzyme to the target sequence. For example, a guide sequence for a gRNA-1, 2, 3, 4, while ensuring its pairing with a target sequence, can be reduced by 1-5 bases (e.g., 1, 2, 3, 4, or 5 bases) or increased by 1-10 bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases) at the 3' end, which does not substantially affect the efficiency of the gRNA and Cas protein in detecting the target nucleic acid.

Example 4 further improvement of detection efficiency by mutating Cas protein

In order to further improve the detection efficiency of sweet potato chlorotic stunt virus, in this embodiment, the Cas protein is subjected to mutation optimization to improve the editing and detection activities thereof, and the applicant predicts key amino acid sites which may affect the biological functions thereof through bioinformatics and performs mutation on the amino acid sites to obtain the Cas mutein with improved editing activity. Specifically, amino acids of potential Cas12i3 and target sequence binding to each other are site-directed mutated by bioinformatics method. In this example, the 168 th amino acid site from the N-terminus shown in SEQ ID No.3 was obtained by bioinformatics method prediction, and site-directed mutagenesis was performed on the site, and the nucleic acid sequence of wild-type Cas12i3 is shown in SEQ ID No. 18.

Variants of Cas proteins were generated by PCR-based site-directed mutagenesis. Utensil for cleaning buttockThe method of the body is to divide the DNA sequence design of the Cas12i3 protein into two parts by taking a mutation site as a center, design two pairs of primers to respectively amplify the two parts of DNA sequences, simultaneously introduce a sequence needing mutation on the primers, and finally load the two fragments onto a pcDNA3.3-eGFP vector in a Gibson cloning mode. The combination of mutants was constructed by splitting the DNA of the Casl2i3 protein into multiple fragments using PCR, gibsonnclone. Fragment amplification kit: transStart FastPFu DNA Polymerase (containing 2.5mM dNTPs), and the detailed experimental flow is shown in the specification. And (3) glue recovery kit:

the specific experimental process of the Gel DNA Extraction Mini Kit is described in the specification. Kit for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU 201-03), the detailed experimental procedures are described in the specification. The mutated amino acid sites involved and the primer sequences employed are shown in the following table:

cas protein with mutation from N to R relative to 168 th amino acid of SEQ ID No.3 is obtained through experiments, and then the activity of the mutant protein is verified through experiments.

The obtained mutant protein N168R of Cas12i is verified to have the gene editing activity in animal cells, and a target point is designed aiming at Chinese hamster ovary Cells (CHO) FUT8 gene, FUT8-Cas-XX-g3: TTCCAGCCAAGGTTGTGGACGGATCA, the PAM sequence is arranged in italic part, and the target area is arranged in underlined region. The vector pcDNA3.3 is modified to carry EGFP fluorescent protein and Puror resistance gene. Inserting SV40 NLS-Cas-XX fusion protein through restriction enzyme sites XbaI and PstI; the U6 promoter and gRNA sequence are inserted through the restriction enzyme site Mfe 1. The CMV promoter initiates expression of the fusion protein SV40 NLS-Cas-XX-NLS-GFP. The protein Cas-XX-NLS is linked to the protein GFP with the linker peptide T2A. The promoter EF-1 alpha initiates puromycin resistance gene expression. Plate paving: the CHO cell fusion degree is 70-80%, and the plating is carried out, and the number of the inoculated cells in a 12-hole plate is 8 × 10 ^ 4 cells/hole. Transfection: paving for 24hFor transfection, 6.25. Mu.l of Hieff Trans were added to 100. Mu.l of opti-MEM ^TM The liposome nucleic acid transfection reagent is evenly mixed; mu.l of opti-MEM was added to 2.5ug of plasmid, and mixed well. Diluted Hieff Trans ^TM The liposome nucleic acid transfection reagent and the diluted plasmid are mixed uniformly and incubated for 20min at room temperature. The incubated mixture is added to a medium plated with cells for transfection. Puromycin screening: puromycin was added for 24h of transfection at a final concentration of 10. Mu.g/ml. The puromycin is treated for 24 hours and is replaced by a normal culture medium for further culture for 24 hours. 48h after transfection, digestion with trypsin-EDTA (0.05%) and sorting of cells with GFP signal using flow cytometry (FACS).

Extracting DNA, amplifying the vicinity of an editing area by PCR, sending HITOM for sequencing: cells are collected after being digested by pancreatin, and genome DNA is extracted by a cell/tissue genome DNA extraction kit (Baitag). Amplifying the region near the target point for the genome DNA. PCR products were subjected to hitoM sequencing. And analyzing sequencing data, counting the types and the proportion of sequences within the range of 15nt at the upstream and 10nt at the downstream of the target position, and counting the sequences with the SNV frequency of more than or equal to 1% or the non-SNV mutation frequency of more than or equal to 0.06% in the sequences to obtain the editing efficiency of the Cas-XX protein on the target position. CHO cell FUT8 gene target sequence: FUT8-Cas-XX-g3: TTCCAGCCAAGGTTGTGGACGGATCA, the PAM sequence is arranged in italic part, and the target area is arranged in underlined region. The gRNA sequence is: AGAGAGAAUGUGUGCAUAGUCAACCAGCAAGGUGUGGACGGAUCA, the underlined region is the targeting region, and the other region is the DR (direct repeat) region.

As shown in fig. 6, compared with the wild-type Cas12i3 protein (WT), the editing efficiency of the Cas12i3 protein (N168R) with the mutated N168R amino acid site is significantly improved, which is about 2.5 times higher than that of the wild-type protein, which indicates that the 168 th amino acid site from the N-terminus of SEQ ID No.3 is a key site for the Cas12i3 to exert activity.

By adopting the method in example 3, the efficiency of detecting double-stranded target sequences (dsDNA) by using the gRNA-4 with better effect in example 3 and the mutant protein Cas12i3-N168R is further verified. A double-stranded target sequence (dsDNA, SEQ ID No. 1) is adopted as a double-stranded target nucleic acid, the dsDNA is the dsDNA targeted by the corresponding gRNA, the single-stranded nucleic acid detector sequence is FAM-TTATT-BHQ1, the double-stranded target nucleic acid amplification system and the detection system refer to example 3, and the detection method is the same as example 3.

The experimental result shows that the detection efficiency can be obviously improved by using the optimized Cas12i3 mutant protein (N168R) and the gRNA-4 screened in the embodiment 3; when dsDNA is detected, the peak value of the fluorescence signal can be reached within about 9 min; compared with the combination of wild Cas12i and gRNA, the detection time of the Cas12i3 mutant protein is shorter, the sensitivity is higher, and the effect is more obvious.

While specific embodiments of the invention have been described in detail, those skilled in the art will understand that: various modifications and changes in detail can be made in light of the overall teachings of the disclosure, and such changes are intended to be within the scope of the present invention. A full appreciation of the invention is gained by taking the entire specification as a whole in the light of the appended claims and any equivalents thereof.

Claims

1. A gRNA for detecting sweetpotato chlorotic stunt virus, the gRNA comprising a region binding to a V-type Cas protein and a guide sequence hybridizing to a target nucleic acid, which is a nucleic acid derived from sweetpotato chlorotic stunt virus; wherein the guide sequence hybridized with the target nucleic acid is selected from any one or the combination of the following groups:

(1) The targeting sequence which hybridizes to the target nucleic acid contains 20 to 30 bases and hybridizes to the sequence shown by SEQ ID No.1 or a reverse complement thereof, and the targeting sequence comprises a sequence shown by any one of SEQ ID Nos. 4 to 7;

(2) The guide sequence hybridized with the target nucleic acid comprises a sequence shown by any one of SEQ ID No.4-7, and also comprises 1-10 bases at the 3' end of the sequence shown by any one of SEQ ID No.4-7, and the guide sequence hybridized with the target nucleic acid is hybridized with the sequence shown by SEQ ID No.1 or the reverse complementary sequence thereof;

(3) Compared with the sequence shown in any one of SEQ ID No.4-7, the guide sequence hybridized with the target nucleic acid continuously deletes 1-5 bases from the 3' end of the sequence shown in any one of SEQ ID No. 4-7;

(4) The guide sequence hybridized with the target nucleic acid is shown as any one of SEQ ID No. 4-7.

2. A method of detecting/diagnosing sweet potato chlorotic dwarf virus or sweet potato virus disease, the method comprising contacting a nucleic acid to be tested with a V-type Cas protein, a gRNA of claim 1, and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cleavage single-stranded nucleic acid detector, thereby detecting/diagnosing the sweetpotato chlorosis-dwarfing virus or the sweetpotato virus disease.

3. The method of claim 2, wherein the V-type Cas protein is selected from any one of the following groups I-II:

I. the amino acid sequence of the V-type Cas protein is shown as SEQ ID No. 3;

4. The method of claim 2, further comprising the step of obtaining the test nucleic acid from the test sample.

5. The method of any one of claims 2-4, further comprising the step of amplifying with a primer pair to obtain the test nucleic acid.

6. The method according to claim 5, wherein the upstream primer of the primer pair is shown as SEQ ID No.11 or 13, and the downstream primer of the primer pair is shown as SEQ ID No.12 or 14.

7. The method of claim 4, wherein the sample is a sample of a plant or a plant-derived toxic medium.

8. The method of claim 2, wherein the detectable signal is achieved by any one of: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition, electrochemical detection, or semiconductor-based detection.

9. A system, composition or kit for detecting or diagnosing whether a test plant is infected with sweetpotato chlorotic stunt virus, the system, composition or kit comprising a V-type Cas protein, the gRNA of claim 1, and a single-stranded nucleic acid detector.

10. A system, composition or kit for detecting/diagnosing sweet potato chlorotic stunt virus or sweet potato virus disease, the system, composition or kit including a gRNA of claim 1, the system, composition or kit further including a V-type Cas protein and a single-stranded nucleic acid detector.

11. The system, composition or kit of any of claims 9-10, wherein the system, composition or kit comprises the primer pair of claim 6.

12. The use of the composition of any one of claims 9-11 in the diagnosis or detection of sweet potato virus diseases, or in the preparation of a reagent or kit for the diagnosis or detection of sweet potato virus diseases.

13. Use of the composition of any one of claims 9 to 11 for detecting or diagnosing sweet potato chlorotic stunt virus, or for preparing a reagent or kit for detecting or diagnosing sweet potato chlorotic stunt virus.