CN1163146A - Cardio-sodium complementary DNA eucaryon expression plasmid component and its muscle introduction therapy - Google Patents

Abstract

The present invention relates to gene therapeutic technology of cardio-vascular disease by introducing cardip-sodium directly into body. Cardio-sodium cDNA obtained from the total RNA of embryonic brain tissue of human through reverse transcription-polymerase chain reaction(RT-PCR) is cloned to eucaryon expressing carrier PcDNA3 through sticky end EcRI-BamHI connection mode of THE4 ligase to obtiain recombined plamid PcDNA3/ANF (cardio sodium), which is introduced directly into muscle tissue for long-term expression so as to reduce blood pressure and cure cardio-vascular disease.

Description

Atrial natriuretic peptide complementary DNA (cDNA) construction of eukaryon expression plasmid for expressing and muscle mediation treatment thereof

The present invention relates to the gene therapy technology that dna direct imports the vivo control cardiovascular diseases.

At present, be used for treatment of diseases medicines such as cardiovascular diseases such as hypertension, heart failure, gestational hypertension, pulmonary edema and be symptomatic treatment, not only timeliness is short, and also there is side effect simultaneously in some drugs.Gene therapy technology just moves towards clinical from laboratory at present, and more than 100 therapeutic scheme of U.S. FDA approved just in clinic trial, obtained obvious effects to diseases such as heredopathia, tumor, familial hypercholesterolemias.Kallikrein, DNA such as promoting erythrocyte growth hormone directly carry out the animal muscle injection, and confirmation can give expression to corresponding proteins matter (list of references: J.Clin.Invest.1995 in vivo; 95:1808.Hypertension 1995; 25 (Suppliment): 715), with diseases such as treatment experimental hypertension, renal insufficiency anemias.But intramuscular injection atrial natriuretic peptide (ANF) DNA expresses atrial natriuretic peptide treatment cardiovascular disease in vivo, does not report as yet so far.

The objective of the invention is to make up the atrial natriuretic peptide eukaryon expression plasmid, directly import muscular tissue, make its long-term expression atrial natriuretic peptide, bring high blood pressure down the treatment cardiovascular disease for seeking a kind of better treatment means.Content of the present invention and main points:

The reason that essential hypertension takes place is many-sided, and wherein atrial natriuretic peptide generation, excretory minimizing in the body is one of major reason of hypertension generation.Therefore, atrial natriuretic peptide (ANF) cDNA is inserted eukaryotic expression vector, directly import in the body by suitable approach, after ANFcDNA expresses in vivo, the ANF that produces can remedy that ANF produces in the body, excretory deficiency, thereby reaches the purpose of preventing and treating hypertension and relevant cardiovascular diseases thereof.1, human atrial natriuretic peptide gene's acquisition primer is synthetic: according to people-ANF cDNA sequence that document is introduced, synthetic primer (Fed. Proc.1986; 45:2086) 5 ' CCGGATCCATGAGCTCCTTCTCCACCAC, 3 ' 5 ' GGGATTCTTATCTTCAGTACCGGAAGC 3 ' extracts total RNA of human embryo and brain tissue, by reverse transcription-polymerase chain reaction (the acquisition atrial natriuretic peptide cDNA of RT-PCR).The PCR condition is: 94 ℃ of 1min; 55 ℃ of 1min; 72 ℃ of 3min.Totally 40 circulations.2, the structure (Fig. 1) of expressing the atrial natriuretic peptide gene recombination plasmid is in the T4 ligase is recombinated ANF cDNA into the pGEM-T plasmid, recombiant plasmid pGEM-T/ANF.PGEM-T/ANF is through the EcoRI/BamHI double digestion, and it is identical with PCR length that electrophoresis detection is inserted fragment length.Dna sequencing result proof is identical with the cDNA sequence of bibliographical information.ANF cDNA is cloned into carrier for expression of eukaryon PcDNA3 through the T4 ligase with sticky end EcoRI, BamHI connected mode again, gets recombiant plasmid PcDNA3/ANF.

Annotate: pGEM-T is Promega company commercial goods.

PcDNA3 is Invitrogen company commercial goods.3, intramuscular gene mediated technology: 1) choose 4 week spontaneous hypertensive rat apoplectic type in age (SHRsp) 12, be divided into experimental group (n=6) and matched group (n=6), two groups of equal left lower limb quadriceps femoris injection marcaine 0.2ml make anathrepsis.After three days, experimental group is injected PcDNA3/ANF 200ug in same position, matched group injecting normal saline (NS), and injection depth is 2-3mm, multiple spot injects.2) choose 11 all SHRsp in age (young Mus) 12, grouping and injecting method are the same, and only experimental group PcDNA 3/ANF injection volume is 650ug.4, gene expression: gene imports after 7 days, 14 days, 1 month, get muscular tissue and carry out the RT-PCR reaction, radioimmunoassay, RIA proves that the gene that changes over to can transcribe, express (Fig. 2) in tissue, and the ANF that gives expression to can secrete to blood circulation (table 1).

Plasma ANF concentration (pg/ml) matched group 0.64 ± 0.21 experimental group 1.53 ± 0.73

N=6, p＜0.05. and matched group ratio

5, resisting hypertension effect:

1) delays hypertensive generation: the SHRsp injection 200ug PcDNA3/ANF that gives birth 4 weeks of back, annotate the 4th week of back, the control rats blood pressure rises to 150mmHg above (normal value 130mmHg is following), and the experimental group rat blood pressure still remains on normal level, during to 4.5 weeks, blood pressure rises to (Fig. 3) about 150mmHg.

2) treatment hypertension: give year through the disposable injection PcDNA3/ANF650ug of SHRsp (blood pressure has reached 185mmHg) intramuscular, can make blood pressure reduce 20-30mmHg (Fig. 4) and also can keep more than three months.If injected dose is increased to enough scopes, blood pressure is expected to reduce to normal level.

Description of drawings:

The structure of Fig. 1-atrial natriuretic peptide gene recombination plasmid

Wherein: 1-atrial natriuretic peptide cDNA fragment

The ANF-atrial natriuretic peptide

RT-PCR product-RT-polymerase chain reaction product

The 2-plasmid

LacZ-galactosidase gene (trade name)

PGEM-T-is terminal GEM serial carrier with the thymus pyrimidine

3-contains the plasmid of atrial natriuretic peptide

The 4-carrier

CMV-cytomegalovirus PolyA-polyadenylic acid

BamHI, the EcoRI-restricted enzyme

5-contains sticking terminal atrial natriuretic peptide cDNA fragment

6-contains the expression vector of atrial natriuretic peptide

PcDNA3ANF-contains No. 3 plasmids of atrial natriuretic peptide complementary DNA (cDNA)

The amplification analysis of 7-6

T7, SP6-promoter code name

BGHpA-bovine growth hormone polyadenylic acid

Ampicillin-ampicillin enzyme gene

ColEl-plasmid replication starting point

SV40 ori-simian virus replication origin

SV40pA-simian virus polyadenylic acid

Fl ori-filobactivirus replication origin

The kb-kilobase is right

The Neomycin neomycin

The ori-replication origin

The pCMV-cytomegalovirus promoter

SspI, NruI, NdeI, BsmI, the expression of SamI-restriction map 2-atrial natriuretic peptide DNA in skeletal muscle

Control-contrast pcDNA3-plasmid

Water-water ANF-atrial natriuretic peptide

RT-PCR-RT-polymerase chain reaction Fig. 3-atrial natriuretic peptide DNA illustrates hypotensive effect Fig. 1 of SHRsp rat the hypertensive retarding action Fig. 4 of SHRsp rat-atrial natriuretic peptide DNA:

The structure of Fig. 1-atrial natriuretic peptide gene recombination plasmid

1. atrial natriuretic peptide cDNA fragment

1-1 ' reverse transcriptase polymerase chain reaction gained atrial natriuretic peptide gene;

2. plasmid

2-2 ' plasmid;

2-3 ' galactoside enzymatic marker gene;

3. the plasmid that contains the atrial natriuretic peptide gene

3-1 ' reverse transcriptase polymerase chain reaction gained atrial natriuretic peptide gene;

The reorganization pGEM-T plasmid of 3-2 ' insertion atrial natriuretic peptide gene;

4. carrier

4-5 ' restriction endonuclease Bam H1 otch;

4-6 ' restriction endonuclease Eco R1 otch;

Plasmid behind 4-7 ' usefulness restriction endonuclease Bam H1 and the Eco R1 double digestion;

4-8 ' cytomegalovirus eukaryotic promoter;

4-9 ' polyadenylic acid tailing signal;

5. the atrial natriuretic peptide cDNA fragment that contains sticky end

5-1 ' reverse transcriptase polymerase chain reaction gained atrial natriuretic peptide gene;

5-5 ' restriction endonuclease Bam H1 otch;

5-6 ' restriction endonuclease Eco R1 otch;

6. contain the atrial natriuretic peptide expression carrier

6-1 ' reverse transcriptase polymerase chain reaction gained atrial natriuretic peptide gene;

6-5 ' restriction endonuclease Bam H1 otch;

6-6 ' restriction endonuclease Eco R1 otch;

6-8 ' cytomegalovirus eukaryotic promoter;

6-9 ' polyadenylic acid tailing signal;

The pcDNA of 6-10 ' insertion atrial natriuretic peptide gene ₃Plasmid;

7.6 amplification analysis

7-1 ' reverse transcriptase polymerase chain reaction gained atrial natriuretic peptide gene;

7-5 ' restriction endonuclease Bam H1 otch;

7-6 ' restriction endonuclease Eco R1 otch;

7-8 ' cytomegalovirus eukaryotic promoter;

The pcDNA of 7-10 ' insertion atrial natriuretic peptide gene ₃Plasmid;

7-11 ' T7 promoter;

7-12 ' SP6 promoter;

7-13 ' bovine growth hormone gene polyadenylic acid tailing signal;

7-14 ' f1 virus replication initiation site;

7-15 ' SV40 virus replication initiation site;

7-16 ' restriction endonuclease Sma 1 site;

The plain resistant maker gene of the new enzyme of 7-17 ';

7-18 ' restriction endonuclease Bsm 1 site;

7-19 ' replicon;

7-20 ' amicillin resistance marker gene;

7-21 ' restriction endonuclease Ssp 1 site;

7-22 ' restriction endonuclease Nru 1 site;

7-23 ' restriction endonuclease Nde 1 site.

Claims (3)

1, atrial natriuretic peptide cDNA construction of eukaryon expression plasmid for expressing and muscle thereof mediation treatment, it is characterized in that utilizing gene recombination technology, ANF cDNA is cloned into eukaryotic expression vector PcDNA3, construction recombination plasmid PcDNA3/ANF, directly import in the body by suitable approach, with treatment hypertension and relevant disease thereof.

2, expression plasmid according to claim 1 makes up and the mediation treatment, it is characterized in that according to a pair of special primer of people ANFcDNA sequential design, the human embryo and brain total tissue RNA that extraction obtains is reacted by RT-PCR, obtain people ANF cDNA full length fragment, be cloned into the pGEM-T plasmid through the T4 ligase again, carry out EcoRI and BamHI double digestion then, regain the ANFcDNA fragment of band sticky end, insert carrier for expression of eukaryon PcDNA3 again, obtain recombiant plasmid PcDNA3/ANF.

3, make up and the mediation treatment according to right 1 described expression plasmid, it is characterized in that at first injection muscles regenerative agent marcaine, inject a certain amount of people ANFcDNA recombiant plasmid PcDNA3/ANF after 3 days again to animal muscle tissue, by gene expression, treatment hypertension and relevant disease thereof.

Images