CN101074266A - Transduced peptide-humanized granular leukocyte colony stimulating factor fusion protein and its medicinal composition - Google Patents

Abstract

A transduction peptide-humanized granulocyte colony stimulating factor fusion protein, nucleic acid molecule of nucleic acid sequence for encoding fusion protein, expression carrier containing the nucleic acid molecule and its usage of fusion protein in preparation of medicine are disclosed. It can be used for neutrophil reduction after tumor radiant chemo-radiotherapy, hematopoietic restoration after bone marrow transplantation, peripheral blood stem cells mobilization, anti-infective therapy, aregenerative anemia, systemic lupus erythematosus and immune response adjustment.

Description

Transduced peptide-humanized granular leukocyte colony stimulating factor fusion rotein and pharmaceutical composition thereof

Invention field:

The present invention relates to have the fusion rotein of pharmaceutical use, be specially the transduced peptide-humanized granular leukocyte colony stimulating factor fusion rotein, the nucleic acid molecule of this fusion rotein of encoding.The present invention also relates to contain the pharmaceutical composition of this fusion rotein.

Background of invention

General introduction

Granulocyte colony-stimulating factor (Granulocyte colony stimulating factor, G-CSF) be a kind of cell growth factor of polypeptide chain, stimulate medullary cell to form granular leukocyte colony and form unit, increase neutrophil leucocyte (ANC), monocyte, T lymphocyte quantity.It is that progenitor cell, grain are precursor cell propagation, differentiation that G-CSF mainly acts on grain, and strengthens ripe granulocytic functionally active; Strengthen the phagolysis of ANC, the release function that improves the ANC active oxygen is to strengthen its pathogenic microbe killing ability, and is significant to the physical stress system of defense.

The biological property of G-CSF

Human G-CSF is encoded by individual gene, and its gene is positioned at chromosomal q21-22 district No. 17, is about 2.5kb, and 5 exons and 4 introns are arranged; Its protein is made up of 174 amino acid, has 2 disulfide linkage to connect therebetween and the formation tertiary structure, and molecular weight is 22kD.Natural G-CSF contains glycosyl, and glycosylation site is positioned at Thr133, no N-glycosyl site, and glycosyl is not contributed the biologic activity of G-CSF, the G-CSF sugar based of in E.coli, expressing, but its function and natural G-CSF do not have significant difference.

The biological action of G-CSF is by producing with effector cell's surface specific receptors bind.The G-CSF acceptor is a high-affinity receptor, is distributed in hemopoietic progenitor cell, neutrophil leucocyte, endotheliocyte, marrow series leukemia cell, thrombocyte and T, bone-marrow-derived lymphocyte.Some non-hematopoietic cell (as vascular endothelial cell, placenta cells, minicell, lung carcinoma cell and trophocyte etc.) also has G-CSFR to exist.But Rd differs greatly, the about 37-1000 of Rd/cell.Acceptor and age, sex, peripheral blood mutually in hemoglobin content, leukocyte count, hematoblastic quantity irrelevant, and with marrow in the ratio of initiating cell be remarkable negative correlation, acute leukemic patient G-CSF expression of receptor rate is starkly lower than normally.The quantity of G-CSF acceptor increases along with the maturation of cell, and therefore, the G-CSF receptor expression has reflected the differentiation degree of cell to a certain extent.Even there is the G-CSFR of lower level to express on the in vitro tests demonstration neutrophil leucocyte, dissociation constant very low (3pmol/L) also can be brought into play the higher biological activity of G-CSF, and therefore a small amount of G-CSFR is in conjunction with bringing out very big G-CSF biological effect.

1, G-CSF can induce specifically the grain be the propagation and the differentiation of progenitor cell

The G-CSF effect mainly to as if grain be cell, can promote that not only grain is the propagation of progenitor cell, and induce it to eventually end differentiation.G-CSF is to CD34 ⁺/ CD33 ^-Myeloid progenitor effect a little less than, and to bone marrow granulocyte committed cell (CD34 ⁺/ CD33 ⁺) tangible promotion colony formation effect arranged.The dynamics research of G-CSF hemopoietic progenitor cell shows: G-CSF can induce the cell fission of more ripe progenitor cell (promyelocyte), but can not promote that early progenitor cell enters cell generation cycle.CD34 ⁺The vitro culture of myeloid progenitor find that G-CSF can not keep the self of original hemopoietic progenitor cell alone, therefore, the do time spent of G-CSF in hematopoiesis broken up late period for hematopoietic cell mutually.G-CSF and other cytokines (IL-3, IL-12, IL-1B, IL-6) acting in conjunction has synergism to the growth of hemopoietic progenitor cell, and G-CSF can also influence some hematopoiesis regulatory factor such as GM-CSF simultaneously, and IL-3 is to reaction original and the multipotency progenitor cell.

In vivo, G-CSF can promote that grain is propagation, differentiation and the maturation of progenitor cell, and promotes that neutrophil leucocyte and stem/progenitor cells are released to (Tsuruta T, Tani K, Shimane M, et al.Br J Haematol, 1996 in the peripheral blood in the marrow; 92:9).G-CSF can make in the peripheral blood hematopoietic stem quantity increase by 10 times, and this transplants for peripheral blood hematopoietic stem cells theoretical foundation is provided.G-CSF not only makes autologous peripheral blood stemcell transplant become more possible as the stem cell mobilization agent, and the bone marrow depression of having avoided the agent of cytotoxicity stem cell mobilization to be brought, at present by clinical extensive employing.In addition, G-CSF can obviously quicken granulocytic recovery after the bone marrow transplantation, strengthens granulocytic function, can shorten heating fate and microbiotic and use the time.The G-CSF subcutaneous injection of single dose, after 2 hours, neutrophil leucocyte quantity increases in the visible peripheral blood, and this effect reached the peak in 12 hours, continued to return to previous level gradually after 36 hours; Simultaneously with the increase of marrow progenitor cell, the progenitor cell colony forms and marrow S phase cell proportion increases, but monocyte, lymphocyte, eosinophilic granulocyte, thrombocyte, reticulocyte and oxyphorase etc. are not all had obviously influence in the marrow.

G-CSF can strengthen ripe granulocytic chemotaxis, phagolysis and sterilizing ability, promotes its existence.G-CSF can promote neutrophil leucocyte to discharge arachidonic acid and LAP and myeloperoxidase, and cell killing activity (ADCC) effect (the Aman MJ of the generation of mediation neutrophil leucocyte superoxide anion and antibody dependence, Stockdreher K, Thews A, etal.Ann Hematol, 1996; 73:231; Thomas P.Carsten K, Janet M, et al.Blood, 1996; 87:900].

2, the effect of other hemocytes

¹²⁵I mark G-CSF measures lymphocytic cell surface by the γ calculating instrument and does not have the existence of G-CSF specific receptors, (Morikawa K, Miyawaki T, Oseko F, et al.Eur J Hematol, 1993 such as Morikawa; Show with the measurement result of biotin labeling G-CSF on flow cytometer that 51:144) the B-lymphocytic cell surface has the G-CSF specific receptors to exist.Vitro culture is found: G-CSF can promote the lymphocytic propagation of B-, but it promotes that the effect of B-lymphocytic emiocytosis immunoglobulin (Ig) is more remarkable, and find the G-CSF of high density, can cause that just the B-lymphocyte produces reaction to it, but G-CSF stimulates myeloid cell then to need not so high concentration, infer: under the infectation of bacteria situation, body can discharge activated G-CSF, the haemoconcentration of G-CSF in the body is obviously raise, various cells comprise granulocyte, monocyte and lymphocyte all participate in inflammatory reaction, and secrete the soluble factor of the various activated G-CSF of comprising, therefore the concentration at the local G-CSF of inflammation is quite high, might reach the effect that promotes B-lymphopoiesis and immunoglobulin,exocrine.

[Shimoda K, Okamura S, Harada N, et al.J ClinInvest, 1993 such as Shimoda; 91:1310] there is on the reported first thrombocyte G-CSF specific receptors to exist, and higher avidity (dissociation constant KD:300 ± 150pM) is arranged.Binding site 412 ± 158/ cells, and the G-CSF (0.1ng/ml) that finds lower concentration can change ADP to the Secondary cases agglutination reaction that thrombocyte causes, also has heavy dose of G-CSF to cause the report that the generation of platelet-mediated neutrophil leucocyte superoxide anion and cell killing activity (ADCC) the effect quantity that antibody relies on increase in vivo.

3, G-CSF is to the effect of non-hematopoietic cell

G-CSF not only has obvious effect to the hemopoietic system cell, and some non-hematopoietic cell is also had certain effect.Vitro culture finds that G-CSF can stimulate the hyperplasia and the migration of vascular endothelial cell, stimulates H-69, H-128, and the propagation of small cell lung cancer cell also has the effect that promotes growth to some colorectal carcinoma cell line.The hepatoma cell line of G-CSF and transfection G-CSF acceptor (Hep 3B) cell is hatched jointly, can impel its cell to produce acute phase reactive protein [Mitsuru H, ThomasH, Tsutomu A, et al.Archives Bioche Biophysics, 1995; 324:344].Have the G-CSF acceptor to exist on the placental trophoblasts, G-CSF also plays an important role to the growth and the existence of placenta cells.

4, G-CSF is to leukemia cell's effect

In the vitro culture, the colony that G-CSF can significantly increase acute myelocytic leukemia (AML) cell forms, the DNA synthetic ratio of AML cell also obviously increases, and can promote that the leukemia cell enters cell generation cycle, and the clone (as NFS-60 clone) that G-CSF is relied on etc. also has same purpose.These effects are all receptor related with cell surface expression specificity G-CSF, and it promotes information conductive process still very not clear and definite (Baer MR, Bernstein SH, Brunetto VI., et al.Blood, 1996 of propagation; 87:1484].

G-CSF not only promotes the hyperplasia of myeloid cell, also can promote its differentiation.[Fukunaga R, Etsuko i.shizaka one lkada, Nagata S.Cell, 1993 such as Fukunage; 74:1079] in the mouse marrow progenitor cell FDC-P1 of transfection G-CSF acceptor clone, find that G-CSF can promote the expression of the mRNA of MPD and LE.Vitro culture finds that G-CSF makes the FDC-P1 cell break up to promyelocyte.[Santini V, Colombat PH, DelwelR, et al.Leuk Res, 1991 such as Santini; 15:341] in the serum free medium of AML cell, add an amount of G-CSF, cultivate discovery in 14 days, the ratio of ripe neutrophil leucocyte obviously increases, and points out that this Differentiation is normally incomplete; Can not make the AML cell to granulocyte end differentiation eventually but there is experiment to be presented at external G-CSF, can G-CSF lure that leukemia to Normocellular differentiation, waits further checking in vivo.

Recent study finds that G-CSF not only has effect to myelocytic leukemia, and anxious lymphocyte is also had effect.CD7 ⁺CD3 ^-ALL, CD10 ⁺B-cell ALL, cell surfaces such as T-lymphoblast lymphoma also have the G-CSF acceptor to exist; Vitro culture shows that G-CSF also can promote propagation (Inukai T, Sugita K, lijima K, et al.BrJ Hematol, 1995 of its cell; 89:623; Morikawa K, Morikawa S, Miyawaki T, et al.Br J Haematol, 1996; 94:250).The prompting people will note observing the effect of G-CSF in treatment ALL and lymphadenomatous process.

5, G-CSF and apoptosis

There is the scholar to think G-CSF apoptosis capable of inhibiting cell (apoptosis) thereby propagation and viability (Bin Hu, Kozo Y.Int J Hematol, 1997 of improving the cell that relies on the G-CSF growth; 66:179), vitro culture also shows: hemopoietic progenitor cell is after removing G-CSF, and the apoptosis phenomenon then takes place cell, and chemotherapeutics is the directly necrosis of leukemogenesis cell not only, but also cell death inducing of suitable concn.G-CSF and various kinds of cell drug toxicity add in leukemia cell's suspension simultaneously, hatch certain hour jointly after, finding that the ratio of apoptotic cell is single obviously lowers with cytotoxic drug, prompting G-CSF has the apoptotic effect of inhibition.Yet, find in the experiment of analysis G-CSF function of receptors sections such as Dong: the 32D clone behind the transfection G-CSF acceptor gene, when in containing the substratum of G-CSF, cultivating, differentiating phenomenon does not appear in cell, typical phenomena of apoptosis has but appearred, discover that further the 32D clone of transfection wild-type G-CSF acceptor and rat leukemia cell system (LT12 cell) under the G-CSF effect, has lost further differentiation capability, and with the form of apoptosis death taken place.Bessho etc. have also confirmed the phenomenon that the G-CSF cell death inducing produces in the mouse marrow sexual cell system of expressing endogenous G-CSF acceptor, no matter the cell of endogenous expression G-CSF acceptor or the cell of transfection G-CSF acceptor are described, G-CSF all induces it that effect of apoptosis takes place, and finds to transfer the generation and the G-CSF acceptor intracellular region of dying that substantial connection is arranged.The molecular biology mechanism that apoptosis takes place, and it be not immediately clear with the mutual relationship of cytodifferentiation.

The clinical application of G-CSF

G-CSF can be used for the treatment that neutrophil leucocyte reduces, and the neutrophil leucocyte that is applied to after solid tumor chemotherapy or the radiotherapy reduces, and curative effect is good, also is widely used in the treatment that the neutrophil leucocyte behind leukemia chemotherapy reduces.Treating granulocytopenia and the congenital granulocytopenia that non-chemotherapy of tumors medicine causes also has tangible curative effect, but studies show that prolonged application has the possibility of bringing out myelodysplastisches disease (MDS) and AML.The granulocyte that G-CSF is used for behind marrow and the autologous peripheral blood stemcell transplant recovers, and treatment MDS also has the part curative effect.G-CSF is used for peripheral hematopoietic stem cells and mobilizes, and list is with G-CSF or unite mobilization procedure for peripheral blood stem cells such as using cytosine arabinoside, endoxan, tens of times of the hemopoietic stem cell quantity height that the comparable not time spent gathers behind the application G-CSF.Special infectious diseases is used G-CSF can increase cytophagous quantity, discharges inflammatory mediator, promotes chemotaxis, and activated b lymphocyte enhancing antibody discharges, and promotes anti-infectious function comprehensively.

1, the ANC behind the tumor chemoradiotherapy

But high-dose chemotherapy maximum limit kill tumor cell improves chemotherapy remission rate and curative ratio.Can cause cell proliferation active tissue such as major injuries such as medulla hematopoietic system, mucosal epithelium but increase dosage, cause complication such as bone marrow depression, secondary infection.Continuous appearance of new drug in recent years and updating of chemotherapy regimen are significantly improved the AL remission rate, also must accept high-dose chemotherapy repeatedly but improve long-term DFS, and consequent bone marrow toxicity can affect the treatment again.Use rhG-CSF and can play the effect of remedying.

2, the hematopoiesis after the bone marrow transplantation recovers

Bone marrow transplantation is divided into autologous bone marrow transplantation (ABMT) and allogeneic bone marrow transplantation (alto-BMT).Hematopoiesis after the purpose of application rhG-CSF is to promote to transplant recovers, and transplants the back agranulocytosis phase though can not shorten, and can significantly quicken the recovery of ANC.RhG-CSF all has the effect that promotes hematopoiesis at the 2ug/kg/d-22ug/kg/d dosage range, and be dose-dependently [G Visani, B Gamberi, P Greenbery, et al.The use of GM-CSFas an adjunct to autologous/syngeneic bone marrowtransplanta-tion:a prospective randomized controlled trial[J] .Bone Marrow Transplant, 1991,7 (Supply 2): 81.).

3, peripheral hematopoietic stem cells is mobilized

Stem cell content in peripheral blood is few under the physiological status, separation difficulty, can not satisfy the transplanting needs, therefore the normal medicines such as encircling phosphorus phthalein amine that adopts is mobilized peripheral hematopoietic stem cells (PBSC), ANC through after a while lacks the phase, and stem cell is the rising of knock-on property in peripheral blood, and this moment, the separable more PBSC of going out was used for transplanting, but because of each isolating PBSC amount instability, normal and myeloid element combined transplantation; Use rhG-CSF after the chemotherapy, not only shortened ANC and lacked the phase, reduced the infection complication; In advance amplitude improves the knock-on time in peripheral blood but also make stem cell, and the white corpuscle by less number of times separates just can obtain a large amount of PBSC, thereby transplants the condition that provides for PBSC separately.

4, the application in anti-infective therapy

Because rhG-CSF promotes that grain is that progenitor cell breaks up to grain, macrophage proliferation, and ripe gradually for having the functioning cell of activate the phagocytic capacity, ANC one property crossed increases and increased functionality, therefore is applicable to Synergistic treatment merging bacterium or fungal infection person.Clinically more are used to prevent or treat after cancer patients's chemotherapy because of the infection that agranulocytosis merged dosage range 100ug/m ²-400ug/m ²

5, aplastic anemia

The intractable barrier again of prolonged application rhG-CSF treatment 5 examples, 1--2 after the month all patient's white corpuscles obviously rise, ANC on average increases by 27 times, wherein 2 routine patient's anaemias are improved.Monarch the common people reports the patient of barrier again of 15 routine concurrent infections, and the peripheral blood leucocyte counting rises 3 times-8 times after the rhG-CSF treatment, and the ANC counting rises 2.4 times-6 times, and PLT and Hb do not have considerable change; RhG-CSF treatment back 2d-14d generates heat, infects controlled.3d-10d behind the inactive G-CSF, the level [23] before the peripheral blood leucocyte counting resumes treatment substantially.

6, systemic lupus erythematous

In the treatment of systemic lupus erythematous (SLE), because disease itself or use the granulocytopenia that ring phosphorus phthalein amine causes and reach the infection of secondary therefrom, usually have to therapy discontinued and affect the treatment.5 routine patients SLE of Wang Zhengang report are lower than 3.0 * 10 at WBC ⁹Inactive CTX used rhG-CSF when/L or appearance were infected.The WBC rebound significantly can appear in 3d after use, and along with WBC raises, inflammation disappears, and CTX is continued to be used.

7, the therapeutic action of G-CSF in acute myocardial infarction

G-CSF is the strong mobilization agent of bone marrow stem cell, can mobilize two class stem cells in the marrow: (ancestral) cell is done in hematopoiesis and stroma stem cell enters PBF.These two kinds of cells all have the plasticity-of height, can be divided into neurocyte, scleroblast, stem cell and myocardial cell etc.And different types of cell forms the ability of myocardial cell and vascular endothelial cell and different, mobilizes in the marrow stem cell to peripheral blood to make it " raise " infarcted region with G-CSF and repairs cardiac muscle, may be more more effective than the stem cell of transplanting the single kind type.Under the normal physiological state, hemopoietic stem cell in the marrow (HSC) accounts for the 0.1%-1% of karyocyte, and only accounts for 0.01% in peripheral blood.G-CSF has been widely used in the mobilization of peripheral blood hematopoietic stem cells clinically to obtain the stem cell of sufficient amount, but mobilize really cutter system to understand [Kronenwett R as yet fully to HSC at present, Martin S, Haas R.The role of cytokines andadhesion molecules for mobilization of peripheral blood stemcells.Stem Cells, 2000,18 (5): 320-330].

8, regulate immunne response

RhG-CSF is a kind of Hemopoietic factor with pluripotency, and it not only can promote the proliferation and differentiation of bone marrow precursor, improves the level of peripheral blood cells; And can activate the T cell, endotheliocyte etc. of body, performance immunoregulation effect by number of mechanisms.It can also enhancement antigen presenting cell (APC) function, increase the expression of cell surface MHC molecule, collaborative stimulation molecule (CM) and adhesion molecule, promote emiocytosis cytokine etc., participate in the immunomodulatory of body, the effect PA that presents immunological adjuvant, rhC-CSF is used for the treatment of viral hepatitis, can strengthen the result of treatment of antiviral, strengthen the responsing reaction of host to hepatitis vaccine, aids patient generator opportunistic infections and tumour increase, and it is effective to the diseases related oligoleukocythemia of HIV to use rhG-CSF.

The toxic side effect of rhG-CSF

Most patients can tolerate the toxic side effect of G-CSF short application use.The main adverse reaction of rhG-CSF shows as cold like symptoms such as arthrodynia, ostalgia, sore muscle, low-heat, and liver function ALT (alanine aminotransferase) is slight to raise, and fash or the like can be alleviated after the drug withdrawal automatically.RhG-CSF causes that irritated allergic incidence is very low, sooner or later the differing of generation, but respiratory distress syndrome may appear, very important.Initial dose reaction can appear in some patient, shows as anoxic, hypotension syndrome, and capillary vessel oozes out syndrome such as the water storage is stayed, hydrosarca, erythroderma etc.

In addition, should also be noted that during clinical application that rhG-CSF can cause special leukemoid reaction, promptly juvenile cell appears in peripheral blood, and original cell quantity increases in the marrow, but this phenomenon is a property crossed, and should note carrying out discriminatory analysis in conjunction with medical history.The pernicious leukaemic's treatment of medullary system is more thorny, transforms to real leukemia because of rhG-CSF can make some myeloproliferative syndrome (MDS) case.

The patient of AMI, to the side effect of G-CSF pay close attention to the most no more than high blood coagulation state, cause stenocardia or AMI once more.For patient AMI, white corpuscle own raises than premorbid, adds that G-CSF stimulation white corpuscle rising and the thrombin that causes change the hypercoagulative state that can increase the weight of blood.Report is arranged, and when using G-CSF, the control white corpuscle is 70 * 10 ⁹/ L is safe.But for patient AMI, weigh the advantages and disadvantages, G-CSF still has therapeutic value.

The use of G-CSF must be intravenous injection and subcutaneous injection administering mode at present, the long-term injecting pathway that adopts brings misery and inconvenience for patient's (removing the hemodialysis patient), penetrate administration if use atraumatic administering mode such as skin or mucous membrane instead, easily accepted, and enter the transformation period that to improve security and prolong drug in the body by skin by patient.

For overcoming the above problems, utilization of the present invention can efficiently be carried protein molecule and be penetrated small molecules transduction peptide (the Protein TransductionDomain that microbial film comprises skin, mucous membrane, hemato encephalic barrier, PTD), prokaryotic expression recombinant G-CSF is entered in the body by the atraumatic administering mode, thereby reach the purpose for the treatment of anaemia.

The transduction peptide is a kind ofly can efficiently pass biomembranous nexin transduction domain, and it can be striden the polypeptide covalently bound with it, protein and DNA equimolecular film and import nearly all tissue and cell, can also pass hemato encephalic barrier.Green in 1988 finds that the Tat albumen of HIV can free in and out cell efficiently.After Fawell in 1994 was linked to the regional chemistry of the 36Aa of TAT on the heterologous protein, crosslinking protein is also transducible went in the cell.People such as Schwarze SR with the PTD of TAT zone small peptide and macromole tilactase in prokaryotic cell prokaryocyte behind the amalgamation and expression, fusion rotein is injected in the mouse body, finding all has expression in activated enzyme molecule each tissue in vivo, particularly importantly can pass through hemato encephalic barrier.Except that tat peptide, transcribe the peptide sequence of the 43-58 position of factors A ntp from fruit bat feeler foot homology abnormal shape, 267-300 sequence from the conjugated protein VP22 of the single viral DNA of sore rash all has and on all four transduction function of tat peptide and transduction mechanism, and they are collectively referred to as PTD.

Summary of the invention

One aspect of the invention relates to the transduced peptide-humanized granular leukocyte colony stimulating factor fusion rotein.Among the present invention, PTD sequence, the fruit bat homology abnormal shape that the transduction peptide of the described people source granulocyte colony-stimulating factor that is used to transduce can be selected from trans-activator TAT transcribed PTD sequence or its functional analogue or the fragment of factors A NTP and herpes simplex virus I-type VP22 transcription factor.Preferably, described transduction peptide has the described aminoacid sequence of SEQ ID NO:2 (YGRKKRRQRRR) or its functional fragment.In fact, as long as the transduction peptide of the people of the present invention source granulocyte colony-stimulating factor of can transduceing all is applicable to the present invention.

Among the present invention, the people source granulocyte colony-stimulating factor of described fusion rotein contains aminoacid sequence or its functional fragment of SEQ IDNO:4 (TPLGPASSLP QSFLLKCLEQ VRKIQGDGAA LQEKLCATYK LCHPEELVLLGHSLGIPWAP LSSCPSQALQ LAGCLSQLHS GLFLYQGLLQ ALEGISPELGPTLDTLQLDV ADFATTIWQQ MEELGMAPAL QPTQGAMPAF ASAFQRRAGGVLVASHLQSF LEVSYRVLRH LAQP).Preferably, people source granulocyte colony-stimulating factor is made up of SEQ ID NO:4.

On the other hand, the present invention relates to the to transduce fusion rotein of peptide and people source granulocyte colony-stimulating factor, this fusion rotein preferably has the aminoacid sequence of SEQ ID NO:6 (YGRKKRRQRRR GGS TPLGPASSLPQSFLLKCLEQ VRKIQGDGAA LQEKLCATYK LCHPEELVLL GHSLGIPWAPLSSCPSQALQ LAGCLSQLHS GLFLYQGLLQ ALEGISPELG PTLDTLQLDVADFATTIWQQ MEELGMAPAL QPTQGAMPAF ASAFQRRAGG VLVASHLQSFLEVSYRVLRH LAQP).The invention still further relates to the nucleic acid molecule of the described transduced peptide-humanized granular leukocyte colony stimulating factor fusion rotein of coding.

-,SEQ ID NO：5 ( TAC GGC CGC AAG AAA CGC CGC CAG CGC CGC CGC GGTGGTACC actccactgg gtccggcaag cagcctgccg cagagcttcc tgctgaagtgcctggagcaa gtgcgtaaga tccagggcga tggcgcagcg ctgcaggagaagctgtgtgc cacctacaag ctgtgccacc cggaggagct ggtgctgctgggtcacagcc tgggcatccc gtgggcaccg ctgagcagct gcccgagccaggccctgcag ctggcaggct gcctgagcca actgcatagc ggcctgttcctgtaccaggg tctgctgcag gccctggaag gcatcagccc ggagctgggtccgaccctgg acaccctgca gctggacgtc gccgactttg ccaccaccatctggcagcag atggaagaac tgggtatggc cccggccctg cagccgacccagggtgccat gccggccttc gccagcgcgt tccagcgccg tgcaggcggtgtcctggttg ccagccatct gcagagcttc ctggaggtga gctaccgcgttctgcgccac ctggcccagc cgtaa ) 。

Above-mentioned nucleotide sequence can insert in the expression vector.Preferably, expression vector of the present invention is protokaryon or carrier for expression of eukaryon, wherein is preferably pGEX, pET, pBV220 and pcDNA.

The present invention among the pGEX-4T-1 etc., cultivates the people source G-CSF that obtains with transduction peptide amalgamation and expression by described nucleic acid molecule is imported prokaryotic expression carrier pET28 by prokaryotic cell prokaryocyte.

The method easy handling, cost is low, transduction efficiency is high.Protein purification carries out under the sex change condition, and the purge process of the fusion rotein that exists with the inclusion body form is simplified greatly.Make the native conformation of metaprotein become chain-like structure relatively flexibly, break away from the restriction of space conformation, possess higher energy, transduction efficiency is improved greatly.After fusion rotein changes cell over to, folding again, recover native conformation and make G-CSF bring into play its biologic activity, and the protein transduction domain covalently bound with it does not influence the normal configuration or the function of cell.

Another aspect of the invention relates to the pharmaceutical composition that contains fusion rotein of the present invention, is used for that neutrophil leucocyte behind the tumor chemoradiotherapy reduces, the treatment of the hematopoiesis recovery after the bone marrow transplantation, peripheral hematopoietic stem cells mobilization, anti-infective therapy, aplastic anemia, systemic lupus erythematous, adjusting immunne response etc.

Described pharmaceutical composition can contain non-injection type pharmaceutically acceptable carrier or vehicle commonly used.Preferably, formulation of the present invention is for can pass through all cytolemma and biomembranous formulations such as skin, mucous membrane, cornea, conjunctiva, serous coat, sarolemma, blood vessel and lymph periosteum, choroid, neu, hemato encephalic barrier.

By fusion rotein of the present invention, can make clinical application safer, convenient through non-injecting pathway with people source granulocyte colony-stimulating factor input body.

Embodiment

The extraction of embodiment 1 people's spleen monocyte mRNA

Get the fresh spleen of the excision of breaking after the wound, the preparation tissue suspension, through Ficoll lymphocyte separation medium separating monocytic cell, cultivate 2h and remove non-adherent cell, collecting cell behind the continuation cultivation 2.5h in containing LPS (300ug/ml) nutrient solution, adopt the RNAgentsRTotal RNA Isolation System of Promega company to extract total RNA, use Oligo (dt) affinity chromatography column purification to obtain Poly (A)+mRNA again.

The clone of embodiment 2 hG-CSF cDNA

With reference to hG-CSF cDNA sequences Design primer among the Genebank: the 2nd primer is as the primer of reverse transcription.

Primer 1:5 '-GGAATTCACACCATTAGGCCCTGCCAGCTCCCTG-3 ' (SEQ IDNO:7)

Primer 2: 5 '-GGGATCCTCAGGGCTGGGCAAGGTGGCGTAGAAC-3 ' (SEQ IDNO:8)

The mRNA that obtains with embodiment 1 is as template, and reference reagent box manufacturer's recommended scheme is carried out the RT-PCR amplification, obtains the hG-CSF cDNA of total length, its 5 ' and 3 ' end carry EcoRI, BamH I site respectively.

Embodiment 3 reorganization hG-CSF expression plasmids make up and identify

The RT-PCR product of above-mentioned hG-CSF with the expression vector pBV220 fragment that cuts back to close through same enzyme, connects by 4: 1 mol ratios behind EcoRI and BamHI double digestion, transformed competence colibacillus bacillus coli DH 5 alpha, screening positive recombinant pBV hG-CSF.Serve the order-checking of Hai Shengong company.

The abduction delivering of embodiment 4 pBV hG-CSF in intestinal bacteria

Positive single colony inoculation that screening among the embodiment 3 of incubated overnight is obtained (contains Amp 60mg/L) in the LB liquid nutrient medium, be cultured to OD in 30 ℃ ₆₀₀After=0.45, be warming up to 42 ℃ rapidly, induce about 5h, to OD ₆₀₀＞1.2.In 4 ℃ of centrifugal 10min of following 6000g, collect thalline.The SDS-PAGE electrophoresis is identified the expression level of rhG-CSF, and identifies expression-form.

Renaturation and the purifying of embodiment 5 rhG-CSF

With the thalline ultrasonic disintegration behind the above-mentioned abduction delivering.The centrifugal 20min of 12000g abandons supernatant.Precipitation is through washing, dissolving, renaturation.Be splined on chromatography column with 20mmol/L NaAc-HAC pH4.0 equilibrated CM-Sepharose FF, with this damping fluid linear gradient elution that contains 1.0mol/L NaCl, collect each protein peak, after electrophoresis is identified rhG-CSF target protein peak, with the system buffer liquid wash-out of corresponding salt concn, and macro preparation.

Embodiment 6 biological activity determinations

Adopt mouse leukemia cell strain NFS-60 dependency MTT assay method.NFS-60 is gone down to posterity in containing the perfect medium RPMI-1640 of 10ng/ml G-CSF.Detect the same day, NFS-60 washes (the centrifugal 5min of 1000r/min) 3 times with RPMI-1640, is adjusted into 5 * 10 with the substratum that contains 15% serum ⁴/ ml.Sample is diluted to 10ng/ml, the equal doubling dilution of hG-CSF standard substance and testing sample according to the measuring and calculating protein concentration.Negative control does not add G-CSF.Cell is at 50%CO ₂, 37 ℃ of saturated humidity environment are cultivated 72h down.Add MTT colour developing liquid and lysate dimethyl sulfoxide (DMSO), survey the OD value with the 570nm wavelength filter.

Be calculated as follows rhG-CSF activity unit:

The units of calculating every milligram of rhG-CSF according to protein concentration is specific activity (U/mg).

Sequence table

＜110〉Inst of Toxic Medicinal Materials, P.L.A. Academy of Military Medical Sciences

＜120〉transduced peptide-humanized granular leukocyte colony stimulating factor fusion rotein and pharmaceutical composition thereof

<160>8

<210>1

<211>33

<212>DNA

＜213〉nucleotide sequence of coding PTD

<400>I

TACGGCCGCA?AGAAACGCCG?CCAGCGCCGC?CGC 33

<210>2

<211>11

＜212〉aminoacid sequence

＜213〉aminoacid sequence of PTD

<400>2

YGRKKRRQRR?R 11

<210>3

<211>525

<212>DNA

＜213〉nucleotide sequence of coding people source granulocyte colony-stimulating factor

<400>3

actccactgg?gtccggcaag?cagcctgccg?cagagcttcc?tgctgaagtg?cctggagcaa

gtgcgtaaga?tccagggcga?tggcgcagcg?ctgcaggaga?agctgtgtgc?cacctacaag

ctgtgccacc?cggaggagct?ggtgctgctg?ggtcacagcc?tgggcatccc?gtgggcaccg

ctgagcagct?gcccgagcca?ggccctgcag?ctggcaggct?gcctgagcca?actgcatagc

ggcctgttcc?tgtaccaggg?tctgctgcag?gccctggaag?gcatcagccc?ggagctgggt

ccgaccctgg?acaccctgca?gctggacgtc?gccgactttg?ccaccaccat?ctggcagcag

atggaagaac?tgggtatggc?cccggccctg?cagccgaccc?agggtgccat?gccggccttc

gccagcgcgt?tccagcgccg?tgcaggcggt?gtcctggttg?ccagccatct?gcagagcttc

ctggaggtga?gctaccgcgt?tctgcgccac?ctggcccagc?cgtaa 525

<210>4

<211>174

＜212〉aminoacid sequence

＜213〉aminoacid sequence of people source granulocyte colony-stimulating factor

<400>4

TPLGPASSLP?QSFLLKCLEQ?VRKIQGDGAA?LQEKLCATYK?LCHPEELVLL?GHSLGIPWAP

LSSCPSQALQ?LAGCLSQLHS?GLFLYQGLLQ?ALEGISPELG?PTLDTLQLDV?ADFATTIWQQ

MEELGMAPAL?QPTQGAMPAF?ASAFQRRAGG?VLVASHLQSF?LEVSYRVLRH?LAQP 174

<210>5

<211>567

<212>DNA

＜213〉nucleotide sequence of coding PTD-people source granular leukocyte colony stimulating factor fusion protein

<400>5

tacggccgca?agaaacgccg?ccagcgccgc?cgcggtggta?ccactccact?gggtccggca

agcagcctgc?cgcagagctt?cctgctgaag?tgcctggagc?aagtgcgtaa?gatccagggc

gatggcgcag?cgctgcagga?gaagctgtgt?gccacctaca?agctgtgcca?cccggaggag

ctggtgctgc?tgggtcacag?cctgggcatc?ccgtgggcac?cgctgagcag?ctgcccgagc

caggccctgc?agctggcagg?ctgcctgagc?caactgcata?gcggcctgtt?cctgtaccag

ggtctgctgc?aggccctgga?aggcatcagc?ccggagctgg?gtccgaccct?ggacaccctg

cagctggacg?tcgccgactt?tgccaccacc?atctggcagc?agatggaaga?actgggtatg

gccccggccc?tgcagccgac?ccagggtgcc?atgccggcct?tcgccagcgc?gttccagcgc

cgtgcaggcg?gtgtcctggt?tgccagccat?ctgcagagct?tcctggaggt?gagctaccgc

gttctgcgcc?acctggccca?gccgtaa 567

<210>6

<211>188

＜212〉aminoacid sequence

＜213〉aminoacid sequence of transduced peptide-humanized granular leukocyte colony stimulating factor

<400>6

YGRKKRRQRR?RGGSTPLGPA?SSLPQSFLLK?CLEQVRKIQG?DGAALQEKLC?ATYKLCHPEE

LVLLGHSLGI?PWAPLSSCPS?QALQLAGCLS?QLHSGLFLYQ?GLLQALEGIS?PELGPTLDTL

QLDVADFATT?IWQQMEELGM?APALQPTQGA?MPAFASAFQR?RAGGVLVASH?LQSFLEVSYR

VLRHLAQP 188

<210>7

<211>34

<212>DNA

＜213〉primer

<400>7

GGAATTCACACCATTAGGCCCTGCCAGCTCCCTG 34

<210>8

<211>34

<212>DNA

＜213〉primer

<400>8

GGGATCCTCAGGGCTGGGCAAGGTGGCGTAGAAC 34

Claims (11)

1. fusion rotein, it contains transduction peptide and people source granulocyte colony-stimulating factor.

2. PTD sequence, the fruit bat homology abnormal shape that the fusion rotein of claim 1, wherein said transduction peptide are selected from trans-activator TAT transcribed PTD sequence or its functional analogue or the fragment of factors A NTP and herpes simplex virus I-type VP22 transcription factor.

3. the fusion rotein of claim 2, wherein said transduction peptide has sequence or its functional fragment of SEQ ID NO:2.

4. each fusion rotein among the claim 1-3, wherein said people source granulocyte colony-stimulating factor has the sequence of SEQ ID NO:4.

5. the fusion rotein of claim 1, it has the sequence of SEQ ID NO:6.

6. nucleic acid molecule, each fusion rotein among its coding claim 1-5.

7. the nucleic acid molecule of claim 6, it has the sequence of SEQ ID NO:5.

8. the expression vector that comprises the nucleic acid molecule of claim 7.

9. pharmaceutical composition, it contains among the claim 1-5 each fusion rotein.

10. the pharmaceutical composition of claim 9, its formulation is for can pass through all cytolemma and biomembranous formulations such as skin, mucous membrane, cornea, conjunctiva, serous coat, sarolemma, blood vessel and lymph periosteum, choroid, neu, hemato encephalic barrier.

11. the application of each fusion rotein in the preparation medicine among the claim 1-5, described medicine are used for the treatment of the neutrophil leucocyte minimizing behind the tumor chemoradiotherapy, hematopoiesis recovery, peripheral hematopoietic stem cells mobilization, anti-infective therapy, aplastic anemia, systemic lupus erythematous, the adjusting immunne response after the bone marrow transplantation.