CN116287362A - Primer composition for detecting fruit anthracnose based on LAMP technology and detection method thereof - Google Patents

Abstract

The invention provides a primer composition for fruit anthracnose based on LAMP technology and a detection method. The research starts from the beta-tubulin target gene, and establishes and develops the LAMP detection method for detecting the fruit anthracnose with the characteristics of strong specificity and high sensitivity through combining a plurality of primers with a plurality of specific sites on a target sequence.

Description

Primer composition for detecting fruit anthracnose based on LAMP technology and detection method thereof

Technical Field

The invention relates to the technical field of biology, in particular to a primer composition for fruit anthracnose based on LAMP technology and a detection method.

Background

The fruit anthracnose (Colletotrichum fructicola) belongs to the eighth plant pathogenic fungus in the world, has wide global distribution and wide host range, and is commonly apples, peaches and watermelons. The fruit anthracnose can infect leaves to form lesions, and when serious, the trees are weakened and even die, so that the quality and the yield of the products are greatly lost. When the fruit anthracis infects plants, the symptoms of the diseases are similar, and the early symptoms of the diseases are not clear enough, so that the differential diagnosis of related plant diseases becomes difficult. The conventional morphological identification method has the defects of complicated steps and poor effect, can not quickly, simply and accurately carry out detection and identification, and the existing detection technology has high equipment and reagent price and can not meet the required identification requirement, so that development of a novel detection technology with high efficiency, simplicity, convenience, high sensitivity and strong specificity is needed to be applied to quick detection of microorganisms.

In early research, we detected plant pathogenic bacteria, initially by traditional isolation of pathogenic bacteria such as plant disease symptoms, colony, hypha morphology of pathogenic bacteria, etc. Later researchers build an immunological method, go to a molecular detection technology, and provide technical support for identifying plant diseases caused by plant pathogenic bacteria through continuous reinforcement of theoretical knowledge and continuous progress of the technology. The existing common plant fungal disease molecular detection mainly comprises a fungus body shape detection technology, a conventional PCR detection technology, a loop-mediated isothermal detection technology (LAMP), a colloidal gold detection technology, a high-flux detection technology and the like.

Loop-mediated isothermal amplification (LAMP) is a new type of molecular detection technology developed in recent years, and tDNA polymerase can specifically and efficiently amplify DNA under the condition of constant temperature by two pairs of specially designed primers. The LAMP method can detect a copy number 10 times that of PCR, so that it has high sensitivity and can detect a small number of samples. Since there is more than one pair of LAMP primers and amplification is performed in combination with a plurality of specific sites on the target sequence, LAMP specificity is high. The LAMP technology is different from the traditional PCR technology, adopts a constant temperature condition, and does not have annealing and renaturation processes, so that LAMP detection is quicker and simpler, equipment required by the LAMP technology is simple, the operation is simple and convenient, and pyrophosphatase precipitation generated in a reaction system can be directly judged by naked eyes.

However, the method for detecting anthrax by LAMP technology in the prior art has not been reported yet.

Disclosure of Invention

In view of the shortcomings of the prior art, the invention aims to provide an anthrax detection method based on the LAMP technology, which is used for solving the problems of low detection sensitivity and low specificity of anthrax detection in the prior art.

In the current LAMP technology, the target sequence is mainly an ITS sequence, but the research starts from the beta-tubulin target gene because the ITS sequence has higher specificity among different species. Through combining a plurality of primers with a plurality of specific sites on a target sequence, the LAMP detection method for detecting the fruit anthracnose is created and developed, and has the characteristics of strong specificity and high sensitivity.

In one aspect, the invention provides a primer composition for detecting beta-tubulin gene of fruit-borne anthrax, comprising:

the nucleotide sequence of the forward outer primer F3 is shown as SEQ ID NO. 1; the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2; the nucleotide sequence of the forward inner primer FIP is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse inner primer BIP is shown as SEQ ID NO.4, and the nucleotide sequence of the forward loop primer LF is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse loop primer LB is shown as SEQ ID NO. 6.

In another aspect of the invention, the use of the primer composition described above for detecting anthrax fruit is provided.

In another aspect, the invention provides a kit for detecting beta-tubulin gene of fruit-borne anthrax, which contains the primer composition and a reaction system required by LAMP reaction.

Further, the reaction system contains MgSO ₄ ，MgSO ₄ The concentration of (C) is 6mM-12mM. Preferably 8mM.

Further, the kit also contains buffer solution, dNTPs, KCl, (NH) ₄ ) ₂ SO ₄ At least one of Bst DNApolymerase, hydroxynaphthol blue and sterilized water.

For example, the kit contains 2.5. Mu.L of 10 XThermopol buffer,8mM MgSO4,1.4mM dNTPs,1.6. Mu.M of inner primer FIP and inner primer BIP, 0.2. Mu.M of outer primer F3 and outer primer B3, 0.8. Mu.M of loop primer LB,10mM KCl,10mM (NH 4) 2SO4,8U. Mu.L-1Bst DNApolymerase,180. Mu.M of Hydroxy Naphthol Blue (HNB), and 2. Mu.L of template DNA.

In another aspect, the invention provides the use of the kit for detecting fruit anthracnose.

The invention also provides a method for detecting the beta-tubulin gene of the fruit anthracnose, which comprises the following steps: the LAMP detection technique is used for detecting the sample by combining the primer composition.

Further, the temperature of the LAMP detection technique is 65-67 ℃.

Further, the temperature of the LAMP detection technique is 66 ℃.

The method can refer to the following steps: extracting DNA of a microorganism to be detected, taking 2 mu L of DNA solution as a reaction template, adding 23 mu L of detection solution in an LAMP kit for LAMP, wherein the LAMP reaction procedure is as follows: and (3) carrying out reaction amplification for 60min at 66 ℃, then observing the color change of the amplified product and an agarose gel electrophoresis band, if the color is changed from purple to sky blue or a ladder-shaped electrophoresis band is arranged, indicating that fruit anthrax exists in the object to be detected, and if the color is not changed, still purple or electrophoresis is not arranged, indicating that fruit anthrax does not exist in the object to be detected.

As described above, the LAMP technology-based anthrax detection method of the invention has the following beneficial effects:

the sensitivity of the method for detecting the sample is far higher than that of the traditional PCR detection method, and the method reaches 10 fg. Mu.L-1, and has strong specificity.

Drawings

FIG. 1 shows a sequence diagram of primers for screening a target gene.

FIG. 2 shows the results of the temperature optimization experiment of the LAMP detection method of the fruit anthracis, the LAMP color development result and the 2% agarose gel electrophoresis chart.

FIG. 3 shows the results of an MgSO4 concentration optimization experiment for the LAMP detection method of fruit anthracis.

FIG. 4 shows LAMP reaction specificity experiments in which 1, CFYT2-3 (Colletotrichum fructicola) 2, CFCF 10 (Colleotrichum fructicola) 3, CCF15 (Colletotrichum camelliae) 4, ai3b (Colletotrichum yulongense) 5, YT.Aa4-5 (Alternaria alternate) 6, FOFS3 (Fusarium oxyporum).

FIG. 5 is a graph showing the sensitivity test results of the LAMP reaction, wherein the LAMP color development result is shown; B. agarose gel electrophoresis assay LAMP method; C. agarose gel electrophoresis assay PCR method.

FIG. 6 shows LAMP detection of cherry leaf bacteria at various infection time points.

Detailed Description

Fungi are one of the important plant pathogens that need technical detection for early detection, diagnosis and control of plant diseases. The LAMP method with high speed, high sensitivity and high specificity is researched, the target gene is cut in, and a novel method capable of specifically detecting anthracnose is established by combining a plurality of primers with a plurality of specific sites on a target sequence.

The LAMP detection technology can detect anthrax in early stage, has quick aging and accurate result, can observe the change of reactants by naked eyes, optimizes LAMP reaction conditions to ensure that the optimal temperature of LAMP detection products is 66 ℃ and the optimal concentration of magnesium ions is 8mM, and can be proved to have extremely high specificity and sensitivity by experiments of specificity and sensitivity. In the pathogenesis, even if the pathogenesis is early, the infection of the pathogen can be detected by using the LAMP detection technology, the feasibility of the LAMP detection technology in the practical application of agriculture is proved to embody the actual effect principle, and the result shows the reliability and the practicability of the LAMP detection technology.

Other advantages and effects of the present invention will become apparent to those skilled in the art from the following disclosure, which describes the embodiments of the present invention with reference to specific examples. The invention may be practiced or carried out in other embodiments that depart from the specific details, and the details of the present description may be modified or varied from the spirit and scope of the present invention. It should be understood that the process equipment or devices not specifically identified in the examples below are all conventional in the art. Furthermore, it is to be understood that the reference to one or more method steps in this disclosure does not exclude the presence of other method steps before or after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise indicated; it should also be understood that the combined connection between one or more devices/means mentioned in the present invention does not exclude that other devices/means may also be present before and after the combined device/means or that other devices/means may also be interposed between these two explicitly mentioned devices/means, unless otherwise indicated. Moreover, unless otherwise indicated, the numbering of the method steps is merely a convenient tool for identifying the method steps and is not intended to limit the order of arrangement of the method steps or to limit the scope of the invention in which the invention may be practiced, as such changes or modifications in their relative relationships may be regarded as within the scope of the invention without substantial modification to the technical matter.

Material

1. Test strain

TABLE 1

The test strains were isolated and stored in the medium organism and pathogen control key laboratory from Zhejiang province, the institute of the lake state, and the growth of the strains was cultivated and studied with PDA, at the border of the fresh flora, the hyphae were cut into 1:1, then placed in 20mL of 10% PDA broth and the incubator temperature was set at 25 ℃.

2. Primary chemicals and reagents

dNTP Mix, RNase-free water was purchased from TaKaRa, bst 2.0WarmStart DNA Polymerse,MgSO ₄ Available from BioLabs, DNA Maker from nankingdom corporation, CTAB, SDS, chloroform, absolute ethanol, naAc, RNase, thermoPol buffer. Inner primers FIP and BIP, outer primers F3 and B3, hydroxynaphthol blue (HNB), agarose, ITS1 primer and ITS4 primer synthesized by Shanghai bioengineering company.

3. Main instrument and equipment

The specifications were 10. Mu.L, 20. Mu.L, 100. Mu.L, 200. Mu.L, 1000. Mu.L pipetting gun from RAININ, RON type illumination incubator from Ningbo southeast instruments Co., ltd., medical low temperature incubator, oven from yamato INC821C, microwave oven, junyI Junyi electrophoresis JY-TD331A, gradiometer from Heal Force TRIDENT 960, balance, HWS-24 electrothermal thermostatic waterbath, ice maker Scotsman AF103, high speed refrigerated centrifuge, ultra-micro ultraviolet spectrophotometer, thermostatic centrifuge, biochemical thermostatic incubator, WH-861 vortex meter, purification workbench and vertical sterilizer from SHINVA.

Method

1. Preparation of culture Medium

(1) Preparation of PDA culture medium: 25.0g of PDA medium was weighed by an electronic balance, and 1L of ultrapure water was added thereto, and after sufficient dissolution, the mixture was added. The culture medium is filled into a 500 ml triangular flask respectively, and the culture medium cannot exceed two thirds of culture medium to prevent bacteria from invading the triangular flask, then a foam plug is plugged at the top of the triangular flask, and the triangular flask is sealed by a ventilation filtering sealing film to prevent the cotton plug from being wetted by condensed water in the high-pressure steam sterilization process, so that the type of culture medium, date and the like are marked. When in use, 100 U.m is added ^-1 Ampicillin 150. Mu.L.

(2) Preparing an LB liquid culture medium: 25.0g of LB medium powder was weighed by an electronic balance, and 1L of ultrapure water was added thereto, followed by sufficient dissolution. The method comprises the steps of respectively filling the culture solution into a 500 ml triangular flask, taking the culture solution which cannot exceed two thirds of the culture solution, preventing bacteria from invading into the triangular flask, then plugging a foam plug on the top of the triangular flask, and sealing the triangular flask by a ventilation filtering sealing film to prevent the cotton plug from being wetted by condensed water in the high-pressure steam sterilization process, and marking the type of the culture medium, the date and the like.

2. Sterilization operations

(1) Sterilization of the ultra-clean bench: spraying 75% alcohol on an ultra-clean workbench for preliminary disinfection, placing required equipment in an ultra-clean area, turning on an ultraviolet lamp for irradiation sterilization for 30min, turning off the ultraviolet lamp after sterilization, and turning on an ultra-clean desk lamp and a blower;

(2) Sterilization of the medium and reagents: sterilizing with high pressure steam sterilizing method in high pressure steam sterilizing pot, and sterilizing at 121deg.C under 0.105MPA for 30min.

EXAMPLE 1 preparation of genomic DNA

1. Genomic DNA extraction

(1) Picking out mycelia in the culture flask after 2-3 days of culture, removing agar medium, sucking water with filter paper, packaging with tinfoil, and placing in liquid nitrogen;

(2) Sequentially adding 900 mu L of 2% CTAB and 100 mu L of 10% SDS into a 2mL centrifuge tube with a mark, and placing into a water bath kettle with the temperature of 65 ℃ for preheating;

(3) Taking a small amount of liquid nitrogen from a clean bottle cap, grinding hyphae into powder for many times in a mortar by using a pestle, adding sample powder into a preheating centrifuge tube in the second step, and fully and uniformly mixing on a vortex machine;

(4) Placing the sample in a water bath kettle at 60 ℃ for 0.5-1h, uniformly mixing the sample upside down every 10 minutes, and centrifuging for 10 minutes by using a refrigerated centrifuge at 12000rpm/min after the completion of the mixing;

(5) Extracting 600 μl of supernatant into a new 1.5mL centrifuge tube, adding equal amount of chloroform, mixing well, and centrifuging at 12000rpm/min for 10 min;

(6) Repeating the fourth step;

(7) Pumping 300 mu L of supernatant solution into a 1.5mL centrifuge tube with a mark, adding absolute ethanol with twice the volume of the absorbed supernatant solution and NaAc (pH=5.2) with 3M of the volume of one tenth of the absorbed supernatant solution, putting the mixture into a vortex mixer for fully mixing, precipitating for more than 2 hours at the temperature of minus 20 ℃, taking out, and putting the mixture into a refrigerated centrifuge 12000rpm/min for centrifugation for 8 minutes;

(8) Removing supernatant, cleaning with 1mL of 75% ethanol, suspending the precipitate in ethanol during cleaning, centrifuging at 12000rpm/min for 5min after cleaning, cleaning twice, sucking liquid with a pipetting gun a small amount for a plurality of times, and blowing the precipitate from white to colorless on a super clean bench;

(9) Thereafter 200. Mu.L of ddH was added ₂ O, dissolved at 37℃for 60min.

2. Agarose gel running gel

(1) The basic principle is as follows: the agarose gel electrophoresis technology is adopted to separate, identify and purify the DNA fragment. Since both ends of the double helix backbone structure of DNA contain negatively charged phosphate groups, they move from negative to positive. Gel electrophoresis techniques can be used to isolate DNA of different molecular weights, or DNA molecules of the same molecular weight but of different structures.

(2) Selection of DNAMarker: marker selection must be by DNA labeling or a direct proportion of the known size of DNA to estimate the size of the DNA fragment. The markers should be selected to be denser near the target segment size in order to more accurately estimate the size of the target segment.

(3) The experimental steps are as follows:

(1) installing an electrophoresis tank, and placing a proper middle glue sample comb;

(2) and (3) glue preparation: preparing gel with concentration of 2%, weighing 1.0 g agarose into 50mL 1 xTAE electrophoresis buffer solution, dissolving, heating in a microwave oven until completely melting, clarifying the solution, and shaking;

(3) and (3) glue injection: slowly pouring agarose gel solution below 60 ℃ into a horizontal plate of an electrophoresis tank without generating bubbles;

(4) waiting for 10-20min, after agarose is solidified, pulling out the comb, placing the comb into an electrophoresis tank, and placing one side with a hole on the negative electrode;

(5) sample adding: mu.L of DNA sample was taken and 2. Mu.L of Loading Buffer was added.

(4) Notice that:

(1) boiling the glue completely, and shaking the glue uniformly;

(2) note that boiling is complete, otherwise small particles can affect the run results. If the gel is not shaken uniformly, the same DNA speed is not the same when the gel is run, so that a dispersion strip can appear;

(3) TAE buffers typically require replacement after 2 to 3 uses.

3. Concentration measurement

(1) The mode of operation to be performed is opened in the software, a blank, i.e., deionized water, is added 2 μl to the base using a precision pipette (0-2 μl) and the sample arm is lowered.

(2) Blank is clicked to make a Blank control check.

(3) The blank was again applied to the base, then checked as with the sample, and the measurement was clicked to perform the concentration test, with the result being approximately one level, the sample arm was lifted, and the sample was sequentially applied to the test base by 2. Mu.L.

(4) The sample arm was placed and the absorbance was measured using computer software. Between the two fibers, a sample column is automatically withdrawn for testing.

(5) After the test is completed, the sample arm is lifted and the sample is wiped with clean dust free paper. Wiping the sample in this way prevents residue of the sample on the base.

(6) The base was cleaned 3 times.

4. Results

TABLE 2 genomic concentration

Example 2 reaction System and primer design

1. LAMP reaction system for fruit anthracnose

In the LAMP reaction, each component of the system and the concentration were 2.5. Mu.L of 10X ThermoPol buffer,4mM MgSO ₄ 1.4mM dNTPs, 1.6. Mu.M each of inner primer FIP and inner primer BIP, 0.2. Mu.M each of outer primer F3 and outer primer B3, 0.8. Mu.M of loop primer LB,10mM KCl,10mM (NH) ₄ ) ₂ SO ₄ ，8U·μL ^-1 Bst DNA polymerase, 180. Mu.M hydroxynaphthol blue (HNB), template DNA 2. Mu.L, was diluted to 25. Mu.L with sterile water.

LAMP reaction: the sample is put into a 64 ℃ water bath for amplification for 60 minutes, and the change of the color is observed, if the color is changed from mauve to sky blue, the sample shows that anthrax exists in the sample, and if the color is not changed, the sample still shows purple, and the sample does not show that the anthrax exists in the sample. In addition, the amplified product was initially judged by agarose gel electrophoresis at a concentration of 2%, and if a typical trapezoid band was found, the amplified product was positive, whereas the result was negative.

2. Screening and LAMP specific primers of fruit anthracnose target genes

As shown in FIG. 1, by comparing the target genes, the β -tubulin genes of C.camelliae, C.fructicola and C.gloeosporioides were finally determined as target sequences, and the target gene sequences finally determined by us were as follows (SEQ ID NO. 7):

>cf2-3_TUB

CGCTTGCGACGCGTTTATCCGCCTTGCCCCTGAGCGTACCCCGCCGACATTTTTACCCGACTTCTATGCACAACAAACCCGCGACGCCTGTCAATCATCGACGCCCAACTCTGGATTGTTTTGCTGACTGCTGCTTTTTTTCTCTACAGGTTCACCTCCAGACCGGCCAGTGCGTAAGTCTTCCCAAGCCAAATCCAACCGCCTGATTGCGGGGCTAACCTCCTTGTACAGGGTAACCAGATTGGTGCTGCCTTCTGGTACGTGACGAGACCGCCGACGACCCGGCAATATATACTTGCGAGGACGGCAGATGTTGACGATAGAGTAGGCAAAACATTTCTGGCGAGCACGGCCTCGACAGCAATGGAGTGTATGTCATGCCCCTTATCTGGCCACATTGGTGGTTGACCGCTAAACTCGAACAGCTACAACGGCACCTCTGAGCTCCAGCTCGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTACCTTATAGCCCCCAGAGTGCAAGATAAACATATTGACGAGTACTGACCTTCGCTCCTACCCAGGCTTCCGGCAACAAGTACGTGCCCCGTGCCGTCCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGCAACAACTGGGCCAAGGGTCACTA

the primers for this study were designed using LAMP on-line software Primer Explorer V (http:// primrexPLorer. Jp/index. Html).

TABLE 3 LAMP-specific primer sequences

Example 3 LAMP reaction conditions optimization of Anthrax fruit

In order to optimize the LAMP reaction system, the optimal reaction system is determined, and the experiment is carried out on two important parameters in the reaction system, namely temperature and MgSO ₄ The concentration was adjusted. Setting temperature gradient in Bst DNApolymerase polymerase reaction temperature range and regulating MgSO with different concentration ₄ To determine the optimum temperature and the optimum MgSO in the LAMP reaction system ₄ Concentration and gel electrophoresisThe amplification effect was analyzed to determine the optimal conditions for the LAMP reaction.

1) Optimizing the detection reaction temperature

In order to obtain a clearer and more accurate experimental result, the LAMP detection reaction condition is required to be optimized, on the basis of the experimental result, the temperature which is a key reaction parameter is optimized, the proper temperature span of Bst DNApolymerase polymerase is known to be from 60 ℃ to 65 ℃, and the experimental result is provided with 6 temperature gradients of 58 ℃, 60 ℃, 62 ℃, 64 ℃, 66 ℃ and 68 ℃. Under the condition that other conditions of the LAMP system are kept unchanged, only the temperature is changed.

As a result, as shown in FIG. 2, experiments showed that at 6 set temperatures, amplification products of 64 ℃, 66 ℃ and 68 ℃ could be obtained, whereas at 66 ℃, the band brightness of the amplification product was highest, indicating that the amplification effect was the best at this temperature.

TABLE 4 optimized reaction System for LAMP detection reaction temperature

2) Optimizing magnesium ion reaction concentration

MgSO was used in this experiment ₄ The concentration was set to be five gradients of 2mM, 4mM, 6mM, 8mM, 10mM and 12mM, and only MgSO was changed while keeping other conditions of the LAMP system unchanged ₄ Concentration, under five concentration conditions set.

The results are shown in FIG. 3, and from FIG. B we can see the results, mgSO in the LAMP reaction system ₄ Amplification was not performed at concentrations of 2mM and 4mM, when MgSO was included in the system ₄ The band of the amplified product in the electrophoretogram was found to reach the highest brightness at a concentration of 8mM, which proves MgSO ₄ The amplification effect was optimal at a concentration of 8mM.

As shown by the results of the above study, the optimum temperature in the LAMP reaction system was set to 66℃and MgSO was used ₄ The optimum concentration was set at 8mM for subsequent studies.

Example 4 LAMP-specific detection of fruit-borne anthrax

TABLE 5 LAMP-specific reaction System

Extracting DNA genome from strain, measuring the concentration of relative genome, amplifying by LAMP detection technique, repeating the experiment for 3 times, observing the color change of reactant by naked eyes after the reaction, and identifying the LAMP amplification condition of DNA gene by 2% agarose gel electrophoresis, thus judging the specificity of LAMP detection technique. The results are shown in FIG. 4.

Results: the primer group can detect fruit anthracnose, and amplification results of camellia anthracnose Colletotrichum camelliae, colletotrichum yulongense, alternaria alternata Alternaria alternate and fusarium oxysporum Fusarium oxyporum are negative, which indicates that the primer group has strong specificity and can specifically detect fruit anthracnose.

Example 5LAMP sensitivity detection of Anthrax fruit

(1) Sensitivity detection of LAMP of fruit anthracnose

The genome DNA concentration of the fruit anthracis is known, and after 10-time volume dilution, the DNA concentration gradient is sequentially 100ng & mu L ^-1 、10ng·μL ^-1 、1ng·μL ^-1 、100pg·μL ^-1 、10pg·μL ^-1 、1pg·μL ^-1 、100fg·μL ^-1 、10fg·μL ^-1 Is a genomic DNA of (a) a host cell. The LAMP reaction was performed using 2.0. Mu.L of diluted DNA as a LAMP template, and 3 parallel experiments were performed, after the completion of the reaction, the color of the reaction product was observed visually, and the DNA gene was LAMP-amplified by 2% agarose gel electrophoresis, whereby the sensitivity of the LAMP detection technique could be judged. The diluted DNA genome is used as a template, and the sensitivity difference can be obtained by comparing the diluted DNA genome with a conventional PCR technology.

(2) Sensitivity detection for conventional PCR reactions

The composition and final concentration of the PCR reaction system were 1.2. Mu.L of primer ACT512F, 1.2. Mu.L of primer ACT783R, 2. Mu.L of enzyme Mix 15. Mu. L, DNA template, note that the concentration gradient of the cherry genomic DNA template was 100 ng. Mu.L ^-1 、10ng·μL ^-1 、1ng·μL ^-1 、100pg·μL ^-1 、10pg·μL ^-1 、1pg·μL ^-1 、100fg·μL ^-1 ，10fg·μL ^-1 10.6. Mu.L ddH was added ₂ O made up the system to 25. Mu.L. PCR instrument amplification program setting: 94 ℃ for 3min;98 ℃ for 15s; 15s at 56 ℃; 40s/kb at 72 ℃;30 cycles; and at 72℃for 5min.2% agarose gel electrophoresis identified the LAMP amplification of the DNA gene.

Results: as can be seen from FIG. 5, the concentration was 100 ng/. Mu.L ^-1 、10ng·μL ^-1 、1ng·μL ^-1 The LAMP detection and the conventional PCR detection result are positive, but the LAMP detection result has clearer and clearer bands, and the conventional PCR band is blurred when the concentration is 100 pg. Mu.L-1, so that the DNA genome cannot be detected by the PCR method of 10 pg. Mu.L-1, and the lowest concentration of the DNA genome which can be detected by the conventional PCR method is 100 pg. Mu.L ^-1 The LAMP detection technique dilutes the DNA genome concentration to 10 fg. Mu.L ^-1 Clear bands are still visible.

From this experiment we can see that the LAMP detection technique is 1000 times more sensitive than conventional PCR.

Example 6 artificial inoculation of cherry anthracis and detection of the pathogenic tissue of plants

From the above experiments we have derived the specificity and sensitivity of LAMP detection of cherry tree anthrax, followed by artificial inoculation of cherry tree anthrax and detection of diseased tissue, thus judging the actual operability of LAMP detection technology in practical agricultural applications.

The experiment selects cherry leaves with good growth vigor, no morbidity and no damage on the surfaces and uniform size, artificially inoculates cultured cherry anthracnose mycelia on the back of the cherry leaves, observes the morbidity symptoms on the cherry leaves at six time points of 0h, 12h, 24h, 48h, 72h and 96h after inoculation, removes the morbidity part of the collected mycelia and leaves, extracts DNA genome, measures the concentration and then uses the concentration as a reaction system template of the LAMP detection technology, and amplifies the LAMP detection technology.

From FIG. 6 we can see that the pathology is not obvious after 12 hours of inoculation of fresh cherry leaves with anthrax, and that the cherry leaves appear as obvious lesions at 48 hours. The disease spots of cherry leaves gradually expand and the disease is more serious with the accumulation of the disease spots over time. The leaf tissues at each time point are taken down to extract DNA genome, and LAMP detection is performed.

As can be seen from FIG. 6, the detection of the fruit anthracnose at 12h, 24h, 48h, 72h and 96h proves that the LAMP detection technology can detect the bacterial infection at early stage of infection, which shows that the LAMP detection technology can accurately detect the bacterial infection in the agricultural practical application and provides good technical support for later prevention and control.

The above examples are provided to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, many modifications and variations of the methods and compositions of the invention set forth herein will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the present invention.

Claims (8)

1. A primer composition for detecting a beta-tubulin gene of anthrax fruit, comprising: the nucleotide sequence of the forward outer primer F3 is shown as SEQ ID NO. 1; the nucleotide sequence of the reverse outer primer B3 is shown as SEQ ID NO. 2; the nucleotide sequence of the forward inner primer FIP is shown as SEQ ID NO. 3; the nucleotide sequence of the reverse inner primer BIP is shown as SEQ ID NO.4, and the nucleotide sequence of the forward loop primer LF is shown as SEQ ID NO. 5; the nucleotide sequence of the reverse loop primer LB is shown as SEQ ID NO. 6.

2. The use of the LAMP primer composition of claim 1 in detecting anthrax fruit.

3. The LAMP kit for detecting fruit anthracis is characterized by comprising the primer composition as set forth in claim 1 and a reaction system required by LAMP reaction.

4. The kit according to claim 3, wherein the reaction system contains MgSO ₄ ，MgSO ₄ Is 8mM.

5. The kit according to claim 3, further comprising at least one of buffer solution, dNTPs, KCl, (NH 4) 2SO4, bst DNApolymerase, hydroxynaphthol blue, and sterilized water.

6. The use of the LAMP kit for detecting fruit-borne anthrax as set forth in any one of claims 3 to 5.

7. A LAMP detection method of fruit anthracis, the method comprises the following steps: detection of a sample using LAMP detection technique in combination with the primer composition according to claim 1.

8. The method of claim 7, wherein the LAMP detection technique has a temperature of 65 ℃ to 67 ℃.

Images