KR101546358B1 - Novel method for preparing Taq DNA polymerase - Google Patents

Novel method for preparing Taq DNA polymerase Download PDF

Info

Publication number
KR101546358B1
KR101546358B1 KR1020140160764A KR20140160764A KR101546358B1 KR 101546358 B1 KR101546358 B1 KR 101546358B1 KR 1020140160764 A KR1020140160764 A KR 1020140160764A KR 20140160764 A KR20140160764 A KR 20140160764A KR 101546358 B1 KR101546358 B1 KR 101546358B1
Authority
KR
South Korea
Prior art keywords
dna polymerase
taq dna
pichia pastoris
ptp
ppic9
Prior art date
Application number
KR1020140160764A
Other languages
Korean (ko)
Inventor
박용현
정소아
Original Assignee
주식회사 제넷바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 제넷바이오 filed Critical 주식회사 제넷바이오
Priority to KR1020140160764A priority Critical patent/KR101546358B1/en
Application granted granted Critical
Publication of KR101546358B1 publication Critical patent/KR101546358B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2521/00—Reaction characterised by the enzymatic activity
    • C12Q2521/10—Nucleotidyl transfering
    • C12Q2521/101—DNA polymerase

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to a novel method for preparing a Taq DNA polymerase and a method for detecting microorganisms by using the Taq DNA polymerase prepared thereby. By using the Taq DNA polymerase prepared by the method of the present invention, it becomes possible to prepare a Taq DNA free from contamination of genomic DNA of E. coli that is exposed through a method for preparing a conventional Taq DNA polymerase. Accordingly, it is possible to precisely confirm a contamination source with respect to a particular sample by using the Taq DNA.

Description

Ｔａｑ ＤＮＡ 중합효소의 신규한 제조방법 {Novel method for preparing Taq DNA polymerase}{Novel method for preparing Taq DNA polymerase}

본 발명은 Taq DNA 중합효소의 신규한 제조방법 및 이를 통해 제조된 Taq DNA 중합효소를 이용한 미생물 검출방법에 관한 것이다. The present invention relates to a novel method for producing Taq DNA polymerase and a method for detecting microorganisms using Taq DNA polymerase produced thereby.

현행의 감염 미생물 검사법에서는 일반적으로 배양 보틀(bottle)에서의 배양 및 선택 배지를 이용한 배양을 포함하는 배양법이 이용되기 때문에, 감염여부를 확인하는 결과가 판정되기까지 며칠 이상의 시간이 소요된다. 게다가, 정확한 결과가 판명될 때까지는 경험에 근거하는 치료(empiric therapy)를 시행할 수 밖에 없기 때문에, 항생제의 남용을 유도할 수 있다는 단점이 있다. 또한, 미생물 중에는 항생제 내성 유전자를 가지는 경우도 있기 때문에, 감염균이 확인되기 전까지는 적절한 치료를 수행하지 못하는 경우도 발생한다. 그 결과, 광역 스펙트럼의 항생제 사용에 의한 다제 내성균의 출현이나, 부적절한 항생제 선택에 의해 패혈증 환자나 자궁 내 감염증의 태아를 구명할 수 없는 사태, 혹은 유선염의 젖소를 도태시킬 수 밖에 없는 사태 등이 생기고 있다. 또한, 종속영양 세균을 검출하는 경우는 특수한 배양조건이 필요하기 때문에, 오염균의 배양 실패로 인해 해당 세균의 존재 여부를 제대로 확인하지 못하는 위험성도 발생할 수 있다. Current infecting microbiological methods generally require culturing in a culture bottle and culture using a selective medium. Therefore, it takes several days or more before the result of confirming the infection is judged. In addition, there is the disadvantage of being able to induce abuse of antibiotics, since empiric therapy is inevitable until accurate results are established. In addition, since microorganisms may have an antibiotic resistance gene, appropriate treatment may not be performed until the infection is confirmed. As a result, the appearance of multidrug-resistant bacteria due to the use of antibiotics in the broad spectrum or the inadequate selection of antibiotics led to cases in which the fetus of sepsis patients or intrauterine infectious diseases could not be detected, or mastitis cows were forced to be culled have. In addition, when a heterotrophic bacterium is detected, special culture conditions are required. Therefore, there is a risk that a culture failure of the contaminated bacterium does not properly confirm the presence of the bacterium.

이러한 배경으로부터 중합효소 연쇄 반응(polymerase chain reaction, 이하 PCR로 표기)을 이용한 미동정의 균의 검출에 관하여 검토가 이루어지고 있다[Gabert, J., et al., 2003]. 특정 균이나 박테리아, 바이러스 등의 검출을 목적으로 하는 PCR 분석법은 두 시간 정도의 단시간만의 분석만으로도 그 결과를 알 수 있기 때문에 의료분야나 수의분야, 식품분야 등의 시료 분석에 빠르게 보급되어 이용되고 있다. From this background, detection of microorganisms using a polymerase chain reaction (PCR) has been studied [Gabert, J., et al., 2003]. PCR analysis for the purpose of detecting specific bacteria, bacteria, viruses and the like is rapidly spread and used in analyzing samples in the medical field, veterinary field, food field, etc., because the result can be known only by a short time analysis of about two hours have.

PCR은 생명공학 분야에서 가장 많이 사용되는 실험 기법으로써, PCR 기법은 사람을 포함한 동물들의 질병진단, 쌀 품종 및 한우판별 등의 검정진단, 병원성 미생물에 의한 식중독 원인균 진단, 다양한 유전자 마커의 개발, 특이 유전자의 검출, 재조합 단백질의 제조, 기능성 식물의 개발 등 바이오테크놀러지와 관련된 거의 모든 분야에서 사용이 되고 있는 중요한 기술이다. PCR is the most widely used experimental technique in the field of biotechnology. The PCR technique is used for diagnosis of diseases of animals including humans, assay diagnosis of rice varieties and NW discrimination, diagnosis of foodborne pathogens caused by pathogenic microorganisms, development of various gene markers, It is an important technology that is used in almost every field related to biotechnology such as detection of genes, production of recombinant proteins, and development of functional plants.

PCR 기법을 이용한 유전자의 증폭을 위해서는 내열성 DNA 중합효소(thermostable DNA polymerase), 반응 완충액(reaction buffer), dATP, dCTP, dGTP, dTTP, 프라이머(primer), 주형 DNA가 기본적으로 필요한 요소이며, 이 중 하나의 인자가 없더라도 유전자 증폭 반응이 이루어지지 않는다. In order to amplify a gene using the PCR technique, thermostable DNA polymerase, reaction buffer, dATP, dCTP, dGTP, dTTP, primer, and template DNA are basically necessary elements. Gene amplification does not occur even if there is no single factor.

내열성 DNA 중합효소로는 몇 가지 종류가 개발되어 사용되고 있으나 써머스 아쿠아티커스(Thermus aquaticus)라는 호열성 균으로부터 분리된 분자량 약 94kDa의 Taq DNA 중합효소(Taq DNA Polymerase)가 90% 이상 사용되고 있다[Ishino, Y., et al., 1994].Several kinds of thermostable DNA polymerase have been developed and used, but more than 90% of Taq DNA Polymerase having a molecular weight of about 94 kDa isolated from thermophilic bacteria called Thermus aquaticus has been used [Ishino , Y., et al., 1994].

한편, Taq DNA 중합효소와 같은 내열성 DNA 중합효소를 이용한 PCR 법으로 단시간에 시료 내의 불특정의 균이나 박테리아, 바이러스와 같은 오염원 등을 확인할 수 있기는 하지만, 검출시약, 특히 Taq DNA 중합효소의 배양시에 혼입된 외부 오염원(예:대장균[Escherichia coli , E. coli]의 게놈 유전자)을 이러한 시료 내의 오염원과 분리하여 정확하게 검출하는 기술은 아직까지는 확립되어 있지 않다. On the other hand, although it is possible to identify unspecified bacteria, bacteria, viruses and the like in a short time by a PCR method using a heat-resistant DNA polymerase such as Taq DNA polymerase, detection reagents, especially Taq DNA polymerase (E. G. Escherichia < / RTI > coli , E. coli ] genomic gene) from contamination in these samples has not yet been established.

Taq DNA 중합효소는 일반적으로 재조합 대장균의 발현 시스템을 이용하여 배양 및 정제과정을 거쳐 제품화되고 있는데, Taq DNA 중합효소는 DNA 결합 단백질이기 때문에 이를 정제하는 과정 중에 대장균의 게놈 DNA(genomic DNA)와 결합할 가능성이 아주 높다. 이로 인해 여러 정제 단계를 거쳤긴 하지만, 현재 판매되고 있는 모든 Taq DNA 중합효소가 대장균의 DNA에 오염되어 있는 것으로 알려져 있다. Taq DNA polymerase is usually commercialized through recombinant E. coli expression system. Since Taq DNA polymerase is a DNA-binding protein, it is combined with genomic DNA of Escherichia coli during the purification process. The possibility of doing so is very high. Although it has undergone several purification steps, it is known that all Taq DNA polymerases currently on the market are contaminated with E. coli DNA.

대장균 DNA가 완전히 제거되지 않는 Taq DNA 중합효소를 사용하여 유전자 증폭 반응을 실시할 경우, 분석하려는 감염균 유전자의 증폭 산물 대신, 원하지 않는 부산물로서 대장균의 DNA가 증폭될 수 있으며, 질병진단과 같이 실험결과가 중요한 영향을 미치는 실험의 경우 위양성(false positive) 결과를 도출하는 등의 문제가 발생할 수 있다. 이러한 여러 문제로 인해 대장균 DNA가 제거된 Taq DNA 중합효소를 제조하는 것이 절실히 필요한 실정이다. When the gene amplification reaction is carried out using Taq DNA polymerase which does not completely remove the E. coli DNA, the E. coli DNA can be amplified as an undesired byproduct instead of the amplification product of the gene of the infection gene to be analyzed, In the case of experiments with significant influence, problems such as a false positive result may arise. Due to these various problems, it is inevitable to produce Taq DNA polymerase in which E. coli DNA is removed.

이에 대장균 DNA 제거를 위해 이를 절단할 수 있는 제한효소나 분해효소를 사용하거나, UV를 쬐어 줌으로써 오염된 DNA를 제거하는 등의 다양한 해결 방법이 도출된 바 있지만, 상기 방법들은 비용이 너무 많이 들고 정제과정을 추가로 더 거쳐야 하는데다가, 특히 오염되어 있는 모든 DNA를 100% 제거시킬 수 없다는 단점들이 있다고 지적된 바 있다. In order to remove E. coli DNA, a variety of solutions such as using restriction enzymes or degrading enzymes capable of cleaving it, or removing contaminated DNA by irradiating with UV have been developed. However, It has been pointed out that there are disadvantages that it is necessary to carry out an additional process and that it can not remove 100% of all the DNA which is particularly polluted.

효소 등의 특정 단백질의 배양시에 종래에는 대장균이나 효모인 사카로마이세스 세레비지애(Saccharomyces cerevisiae)를 이용하는 데[Linck, A., et al., 2014], 근래에는 종종 진핵생물인 효모의 일종인 피키아 파스토리스(Pichia pastoris)를 이용한다. 이는 단백질 제조 및 정제에 있어서 피키아 파스토리스를 이용하는 것이 대장균 또는 사카로마이세스 세레비지애만큼 조작하기 쉽고, 피키아 파스토리스가 대장균과는 달리 단백질 프로세싱(protein processing), 단백질 접힘(protein folding) 및 단백질 번역 후 변형(posttranslational modification) 등의 진핵세포 고유의 발현 시스템을 갖고 있기 때문이다. 피키아 파스토리스와 사카로마이세스 세레비지애 모두 효모의 일종으로서 진핵세포의 특징과 박테리아의 특징을 조금씩 가지고 있는데, 피키아 파스토리스에서 발현된 단백질이 사카로마이세스 세레비지애에서 발현된 단백질보다 인간과 동물에 더 가까운 형태를 띈다. 따라서 실제 동물세포에 작용할 단백질들을 생산하는데 있어서는 사카로마이세스 세레비지애보다 피키아 파스토리스가 더 유리한 장점을 가진다. 또한 피키아 파스토리스의 경우 생산되는 가용성 단백질의 양이 사카로마이세스 세레비지애보다 많아(일정한 cell mass 기준) 단백질 제조에 유리하다. 또한, 목적하는 단백질을 배양하는 면에 있어서, 배큘로바이러스(baculovirus) 및 포유류 조직 배양과 같은 다른 진핵 세포 발현 시스템과 비교하여, 피키아 파스토리스는 적은 비용을 들이면서도 보다 많은 양의 단백질을 더 용이하게 발현할 수 있는 것으로 알려져 있다. 게다가, 피키아 파스토리스는 외래유전자를 숙주세포 발현계의 염색체 DNA에 삽입시킬 수 있어 기존의 플라스미드를 이용하는 기술에 비해 단백질 발현에 대한 안정성이 우수하고, 고농도 세포 배양시 발생되었던 단백질 발현율 저하도 막을 수 있다. 피키아 파스토리스는 메탄올 유도성인 알코올 산화효소의 생성이 용이한 메탄올 자화효모이기 때문에, 알코올 산화효소 1 프로모터(alcohol oxidase 1 promoter, AOX1 promoter)에 단백질 분비 신호 서열이 삽입된 외래 단백질의 유전자를 삽입하게 되면, 상기 외래 단백질의 대량생산 또한 용이하게 할 수 있으며, 상기 단백질의 수거 과정에서 세포 용해(cell lysis) 공정을 수행하지 않아도 되기에, 전체 생산 공정의 규모를 줄일 수도 있다. 이처럼 피키아 파스토리스는 여러 독특한 특징으로 인해 재조합 단백질 대량생산을 위한 이상적인 숙주 시스템으로 각광을 받고 있다[Kopera, E., et al., 2014; Kumari, A., et al., 2014]. Recently, Escherichia coli or Saccharomyces cerevisiae , a yeast strain [Linck, A., et al., 2014], has recently been used for the cultivation of specific proteins such as enzymes, It uses a kind of Pichia pastoris . This is because it is easier to manipulate Pichia pastoris than E. coli or Saccharomyces cerevisiae in the production and purification of protein, and the protein processing, protein folding, And posttranslational modification of the protein. Pichia pastoris and sicaromyces cerevisiae are both types of yeast, and have eukaryotic features and bacterial characteristics little by little. The protein expressed in pichia pastoris is a protein expressed in Saccharomyces cerevisiae It is closer to human and animal forms. Therefore, Pichia pastoris is more advantageous than Saccharomyces cerevisiae in producing proteins to act on actual animal cells. In addition, the amount of soluble protein produced in the case of Pichia pastoris is greater than that of Saccharomyces cerevisiae (on a constant cell mass basis), which is advantageous for protein production. In addition, compared to other eukaryotic expression systems, such as baculovirus and mammalian tissue culture, in terms of culturing the desired protein, Pichia pastoris has been shown to increase the amount of protein It is known that it can be easily expressed. In addition, Pichia pastoris can insert the foreign gene into the chromosomal DNA of the host cell expression system, so that it has excellent stability against protein expression as compared with the technology using the existing plasmid and prevents the degradation of protein expression, . Since Pichia pastoris is a methanol-induced yeast that is easily produced by alcohol-oxidizing alcohol oxidase, the gene of the exogenous protein in which the protein secretory signal sequence is inserted into the alcohol oxidase 1 promoter (AOX1 promoter) is inserted The mass production of the exogenous protein can be facilitated, and the cell lysis process is not performed during the collection of the protein, thereby reducing the size of the entire production process. As such, Pichia pastoris is in the spotlight as an ideal host system for mass production of recombinant proteins due to its unique features [Kopera, E., et al., 2014; Kumari, A., et al., 2014].

이에, 본 발명자들은 진핵생물인 피키아 파스토리스를 이용하여, Taq DNA 중합효소가 피키아 파스토리스의 배양액으로 배출되도록 생산함으로써, 시료 외의 대장균 게놈 DNA의 오염을 근본적으로 차단할 수 있으면서도 Taq DNA 중합효소의 대량생산이 용이한 방법을 도출하여 본 발명을 완성할 수 있었다. Thus, the present inventors have succeeded in producing Taq DNA polymerase by using PeKiapastorice, which is a eukaryote, to produce a Taq DNA polymerase to be released into a culture solution of Pichia pastoris, thereby being able to fundamentally block the contamination of Escherichia coli genomic DNA outside the sample, The present invention has been completed.

한국공개특허 제2011-0102467호에 진핵생물인 피키아 파스토리스를 이용하여 Taq DNA 중합효소를 생산할 수 있음이 개시되어 있기는 하지만, 상기 한국공개특허 제2011-0102467호에서는 피키아 파스토리스를 이용하는 구체적인 실시예가 개시된 바 없으며, 본 발명에서처럼 Taq DNA 중합효소가 배양액으로 분비되는 배양 시스템을 이용할 수 있다는 것에 관해서도 전혀 개시된 바가 없다. 한국공개특허 제2014-0110138호 또는 한국공개특허 제2010-0053011호에서처럼 DNA 증폭물의 오염을 억제하기 위해, PCR용 혼합반응물에 ＵＤＧ를 포함시키는 방법이나 질소가스를 이용하여 PCR용 혼합반응물을 제조하는 방법이 나타나 있기는 하지만, 이들 선행문헌에는 Taq DNA 중합효소 제조시에 외부 오염원을 제거할 수 있는 방법은 전혀 개시되어 있지 않다. Although Korean Patent Publication No. 2011-0102467 discloses that Taq DNA polymerase can be produced using pKiapastorice, a eukaryotic organism, Korean Patent Laid-Open Publication No. 2011-0102467 discloses a method for producing Taq DNA polymerase using Pichia pastoris No specific examples have been disclosed, and no disclosure has been made about the use of a culture system in which Taq DNA polymerase is secreted into a culture medium as in the present invention. In order to suppress the contamination of the DNA amplification as disclosed in Korean Patent Laid-Open Publication No. 2014-0110138 or Korean Patent Publication No. 2010-0053011, a method of incorporating UDG into a PCR reaction mixture or a reaction mixture for PCR using nitrogen gas Although methods have been shown, none of these prior art discloses any method to remove external contaminants in the preparation of Taq DNA polymerase.

한국공개특허 제2011-0102467호 (내열성 ＤＮＡ 폴리머라제를 포함하는 효소 조제물 및 그 제조 방법, 및 검출 대상생물의 검출 방법, 2011.09.16. 공개)Korean Patent Publication No. 2011-0102467 (enzyme preparation containing heat-resistant DNA polymerase, preparation method thereof, and detection method of detection target organism, 2011.09.16. Disclosed) 한국공개특허 제2014-0110138호 (교차오염 억제용 ＵＤＧ를 함유한 중합효소연쇄반응액의 동결건조물, 2014.09.17. 공개)Korean Laid-Open Patent Application No. 2014-0110138 (Freeze-dried product of a polymerase chain reaction liquid containing cross-contamination-inhibiting UDG, published on Apr. 17, 2014) 한국공개특허 제2010-0053011호 (질소가스를 이용하여 중합효소연쇄반응 혼합물을 제조하는 방법 및 그러한 방법에 의하여 제조된 중합효소연쇄반응 혼합물, 2010.05.20. 공개)Korean Patent Laid-Open No. 2010-0053011 (a method for producing a polymerase chain reaction mixture using nitrogen gas and a polymerase chain reaction mixture prepared by such a method, disclosed on May 20, 2010) 한국공개특허 제2001-0098068호 (써머스 아쿠아티커스 디엔에이 중합효소 유전자 절편을 대장균에서 발현 및 정제하는 방법, 2001.11.08. 공개)Korean Patent Laid-Open No. 2001-0098068 (method for expressing and purifying a Thermus aquaticus gene polymerase fragment in E. coli, published on November 11, 2001)

Gabert, J., et al., Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program. Leukemia, 2003, 17:2318-2357.Gabert, J., et al., Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - a Europe Against Cancer program. Leukemia, 2003, 17: 2318-2357. Ishino, Y., et al., Overproduction of Thermus aquaticus DNA polymerase and its structural analysis by ion-spray mass spectrometry. J Biochem, 1994, 116(5):1019-1024.Ishino, Y., et al., Overproduction of Thermus aquaticus DNA polymerase and its structural analysis by ion-spray mass spectrometry. J Biochem, 1994, 116 (5): 1019-1024. Kopera, E., et al., Expression, purification and characterization of glycosylated influenza H5N1 hemagglutinin produced in Pichia pastoris. Acta Biochim Pol., 2014, 61(3):597-602.Kopera, E., et al., Expression, purification and characterization of glycosylated influenza H5N1 hemagglutinin produced in Pichia pastoris. Acta Biochim Pol., 2014, 61 (3): 597-602. Kumari, A., et al., Novel strategy of using methyl esters as slow release methanol source during lipase expression by mut+ Pichia pastoris X33., PLoS One. 2014, 29;9(8):e104272.Kumari, A., et al., Novel strategy of using methyl ester as slow release methanol source during lipase expression by mut + Pichia pastoris X33., PLoS One. 2014, 29; 9 (8): E104272. Linck, A., et al., On the role of GAPDH isoenzymes during pentose fermentation in engineered Saccharomyces cerevisiae. FEMS Yeast Res. 2014, 14(3):389-398.Linck, A., et al., On the role of GAPDH isoenzymes during pentose fermentation in engineered Saccharomyces cerevisiae. FEMS Yeast Res. 2014, 14 (3): 389-398.

본 발명의 목적은 Taq DNA 중합효소의 신규한 제조방법 및 이를 통해 제조된 Taq DNA 중합효소를 이용한 미생물 검출방법을 제공하는 데에 있다. It is an object of the present invention to provide a novel method for producing Taq DNA polymerase and a method for detecting microorganisms using the Taq DNA polymerase produced thereby.

본 발명은 서열번호 1의 Taq DNA 중합효소의 염기서열을 포함하는 pPIC9 벡터로 피키아 파스토리스(Pichia pastoris)를 형질전환하여 Taq DNA 중합효소를 제조하는 방법에 관한 것이다. 바람직하게는,The present invention relates to a method for producing a Taq DNA polymerase by transforming Pichia pastoris with a pPIC9 vector containing a base sequence of Taq DNA polymerase of SEQ ID NO: 1. Preferably,

(1공정) 서열번호 1의 Taq DNA 중합효소의 염기서열을 포함하는 pPIC9 벡터를 제조하는 단계;(1) preparing a pPIC9 vector comprising the base sequence of the Taq DNA polymerase of SEQ ID NO: 1;

(2공정) 상기 1공정의 서열번호 1의 Taq DNA 중합효소의 염기서열을 포함하는 pPIC9 벡터를 피키아 파스토리스(Pichia pastoris)에 삽입하여 형질전환된 피키아 파스토리스를 제조하는 단계; (Step 2) A step of preparing a transformed Pichia pastoris by inserting a pPIC9 vector comprising the base sequence of the Taq DNA polymerase of SEQ ID NO: 1 in the above step into Pichia pastoris ;

(3공정) 상기 2공정의 형질전환된 피키아 파스토리스를 메탄올이 함유된 배지에서 배양하여 Taq DNA 중합효소가 분비된 배양액을 얻는 단계; 및,(Step 3) The transformed Pichia pastoris in the above two steps is cultured in a medium containing methanol to obtain a culture medium in which Taq DNA polymerase is secreted; And

(4공정) 상기 3공정의 배양액을 70~90℃로 열처리한 후 정제하여 Taq DNA 중합효소를 수득하는 단계;(Step 4) Heat-treating the culture solution of the above three steps at 70 to 90 占 폚, followed by purification to obtain Taq DNA polymerase;

를 포함할 수 있다. . ≪ / RTI >

또한, 상기 1공정에서, 상기 pPIC9 벡터는 분비 시그널(MFα signal) 및 His4 유전자(histidinol dehydrogenase gene)를 포함하는 것을 특징으로 한다. In addition, in the above step, the pPIC9 vector is characterized by containing a secretory signal (MF? Signal) and a His4 gene (histidinol dehydrogenase gene).

상기 2공정에서, 상기 pPIC9 벡터는 피키아 파스토리스의 게놈 DNA인 알코올 산화효소 1 프로모터(alcohol oxidase 1 promoter, AOX1 promoter)에 삽입될 수 있다. In the above two steps, the pPIC9 vector may be inserted into an alcohol oxidase 1 promoter (AOX1 promoter), which is genomic DNA of Pichia pastoris.

상기 2공정에서, 피키아 파스토리스는 His4 유전자(histidinol dehydrogenase gene)에 대한 영양요구성 돌연변이종(auxotrophic strain)일 수 있이며, 바람직하게는 피키아 파스토리스 GS115일 수 있다. In the above two steps, Pichia pastoris may be an auxotrophic strain for the histinol dehydrogenase gene, preferably Pichia pastoris GS115.

상기 3공정에서 상기 배지의 메탄올 함량은 0.1~0.7%(v/v)인 것을 특징으로 한다. In the above three steps, the methanol content of the medium is 0.1 to 0.7% (v / v).

또한, 상기 4공정에서 열처리된 배양액의 정제는 히스티딘 단백질에 대한 친화성 크로마토그래피를 이용하여 수행할 수 있다. Further, the purification of the culture solution heat-treated in the above 4 steps can be carried out by using an affinity chromatography for the histidine protein.

또 다른 양태에서, 본 발명은 상기 방법으로 제조한 Taq DNA 중합효소를 이용하여 검체 중의 검출 대상 오염원 생물을 검출하는 방법을 제공한다. In still another embodiment, the present invention provides a method for detecting a contaminant to be detected in a sample using Taq DNA polymerase produced by the above method.

이하 본 발명을 상세하게 설명한다. Hereinafter, the present invention will be described in detail.

본 발명은 서열번호 1의 염기서열이 삽입된 pPIC9 벡터를 피키아 파스토리스(Pichia pastoris)에 형질전환하여 Taq DNA 중합효소를 제조하는 방법에 관한 것이다. The present invention relates to a method for producing a Taq DNA polymerase by transforming a pPIC9 vector having a nucleotide sequence of SEQ ID NO: 1 inserted therein into Pichia pastoris .

상기 서열번호 1의 염기서열은 써머스 아쿠아티커스(Thermus aquaticus)의 Taq DNA 중합효소의 염기서열을 코돈(codon) 최적화 프로그램을 사용해서 피키아 파스토리스의 코돈 선호도에 맞추어 코돈을 바꾼 염기서열로서, 염기서열만 피키아 파스토리스의 코돈 선호도에 따라 바뀌었을 뿐, 아미노산 서열은 써머스 아쿠아티커스의 Taq DNA 중합효소 서열과 같다. 한편, 상기 서열번호 1의 염기서열은 그 말단에 히스티딘 단백질을 발현하는 6개의 히스티딘 발현 코돈을 추가한 염기서열인 것을 특징으로 한다. The nucleotide sequence of SEQ ID NO: 1 is a base sequence in which the nucleotide sequence of the Taq DNA polymerase of Thermus aquaticus is changed according to the codon preference of Pichia pastoris using a codon optimization program, Only the nucleotide sequence was changed according to the codon preference of Pichia pastoris. The amino acid sequence is the same as that of Thermus aquaticus Taq DNA polymerase. Meanwhile, the nucleotide sequence of SEQ ID NO: 1 is a nucleotide sequence having six histidine expression codons added at the ends thereof to express a histidine protein.

상기 1공정에서 pPIC9 벡터는 분비 시그널(도 1의 s.s:secretion sequence) 및 His4 유전자를 포함할 수 있다. 상기 분비 시그널은 효모의 MFα(mating factor α)의 N 말단부분으로 진핵세포의 단백질 발현 시스템에서 발현 단백질을 세포 밖으로 분비될 수 있도록 하는 신호 서열이다. In the above step 1, the pPIC9 vector may contain a secretion signal (s.s, secretion sequence in FIG. 1) and a His4 gene. The secretion signal is a signal sequence that allows the expressed protein to be secreted out of the cell in the eukaryotic protein expression system as the N-terminal portion of the yeast MFα (mating factor?).

상기 1공정에서, 상기 서열번호 1의 염기서열은 pPIC9 벡터의 다중 클로닝 자리(MCS, multiple cloning site)의 제한효소 AvrII와 NotI으로 잘려지는 위치에 삽입된다. In the above step 1, the nucleotide sequence of SEQ ID NO: 1 is inserted at a position to be cleaved with restriction enzymes AvrII and NotI of a multiple cloning site (MCS) of the pPIC9 vector.

상기 2공정에서, 상기 피키아 파스토리스는 His4 유전자(histidinol dehydrogenase gene)에 대한 영양요구성 돌연변이종(auxotrophic strain)일 수 있으며, 바람직하게는 피키아 파스토리스 GS115일 수 있다. 즉, 상기 피키아 파스토리스는 히스티딘 단백질 합성을 할 수 없기 때문에, 히스티딘이 결핍된 배지에서는 배양할 수 없으며, 이를 이용해서, 히스티딘 결핍 배지에서 피키아 파스토리스에 히스티딘의 합성을 가능하게 해 주는 pPIC9 벡터의 삽입이 되었음을 확인한다. In the above two steps, the Pichia pastoris may be an auxotrophic strain for the histinol dehydrogenase gene, preferably Pichia pastoris GS115. That is, since Pichia pastoris can not synthesize histidine protein, it can not be cultured in a medium lacking histidine. Using this, pPIC9 which enables the synthesis of histidine in pichia pastoris in a histidine- Check that the vector has been inserted.

상기 서열번호 1의 염기서열이 삽입된 pPIC9 벡터는 피키아 파스토리스의 게놈 DNA에 삽입될 수 있는데, 특히, 알코올 산화효소 1 프로모터(alcohol oxidase 1 promoter, AOX1 promoter)에 삽입될 수 있다. 상기 서열번호 1의 염기서열이 삽입된 pPIC9 벡터는 선형 상태로 피키아 파스토리스의 게놈 DNA에 삽입되며, 선형 상태의 상기 벡터는 크게 AOX1 5', 서열번호 1의 염기서열(PTP), HIS4 유전자, AOX1 3' 영역으로 구성되는데, 이 선형 벡터가 피키아 파스토리스의 게놈 DNA와 만나면, 벡터상의 AOX1 5'영역과 3'영역이 피키아 파스토리스 게놈 상의 AOX1 유전자와 교차되어 피키아 파스토리스의 게놈에 삽입된다. 따라서, Taq DNA 중합효소를 효율적으로 제조하기 위해서는 형질전환된 피키아 파스토리스를 메탄올이 0.1~0.7%(v/v)로 함유된 배지에서 배양하는 것이 바람직하다. 상기 배지의 메탄올 농도는 더 바람직하게는 0.1~0.5%(v/v)인 것이 좋다. The pPIC9 vector into which the nucleotide sequence of SEQ ID NO: 1 is inserted can be inserted into the genomic DNA of Pichia pastoris. In particular, it can be inserted into the alcohol oxidase 1 promoter (AOX1 promoter). The pPIC9 vector inserted with the nucleotide sequence of SEQ ID NO: 1 is inserted into the genomic DNA of Pichia pastoris in a linear state. The vector in the linear state is composed of AOX1 5 ', the base sequence (PTP) of SEQ ID NO: 1, the HIS4 gene , AOX1 3 'region. When this linear vector meets the genomic DNA of Pichia pastoris, the AOX1 5' region and the 3 'region of the vector are crossed with the AOX1 gene on the genome of Pichia pastoris, Inserted into the genome. Therefore, in order to efficiently produce the Taq DNA polymerase, it is preferable to culture the transformed Pichia pastoris in a medium containing methanol in an amount of 0.1 to 0.7% (v / v). The methanol concentration of the culture medium is more preferably 0.1 to 0.5% (v / v).

본 발명에서 제조되는 Taq DNA 중합효소는 피키아 파스토리스의 세포 외로 분비된 것으로서, 세포 외로 분비된 Taq DNA 중합효소는 피키아 파스토리스의 배양액에서 용이하게 수득할 수 있으며, 특히 히스티딘 단백질에 대한 친화성을 이용하여 정제할 수 있다. 따라서, 상기 4공정에서 열처리된 배양액의 정제는 히스티딘 단백질에 대한 친화성 크로마토그래피를 이용하여 수행할 수 있다. The Taq DNA polymerase produced in the present invention is secreted extracellularly from Pichia pastoris. The Taq DNA polymerase secreted out of the cell can be easily obtained in the culture solution of Pichia pastoris, It can be refined using Mars. Therefore, the purification of the culture solution heat-treated in the above 4 steps can be performed using affinity chromatography for histidine protein.

본 발명은 상기 피키아 파스토리스(Pichia pastoris)를 이용하여 제조한 Taq DNA 중합효소를 이용하여 검체 중의 검출 대상 오염원 생물을 검출하는 방법을 제공한다. The present invention provides a method for detecting a target contaminant in a sample using Taq DNA polymerase produced using the Pichia pastoris .

바람직하게는, 검체로부터 조제한 핵산과, 상기 검출 대상 생물에 특이적인 목적 유전자를 증폭하기 위한 프라이머와, 본 발명에서 제조한 Taq DNA 중합효소를 이용하여 핵산 증폭 반응을 실시하는 증폭 공정을 수행한 후, 상기 증폭 공정에 있어서의 증폭 산물 중의 상기 목적 유전자의 증폭 산물을 검출하는 검출 공정으로 이루어진 방법을 제공할 수 있다. Preferably, an amplification step of performing a nucleic acid amplification reaction using the nucleic acid prepared from the sample, a primer for amplifying a target gene specific to the detection subject organism, and the Taq DNA polymerase produced in the present invention is performed And a detection step of detecting an amplification product of the target gene in the amplification product in the amplification step.

본 발명의 Taq DNA 중합효소를 이용하여 확인할 수 있는 검체는 사람이나 동물의 경우, 혈액, 골수액, 양수, 소변일 수 있으며, 상수도수, 급수 탱크, 공조 순환수, 가습기, 온천수, 풀장 물 등, 일상생활에서 흡입(음수)할 가능성이 있는 생활용수, 또는, 식품, 화장품일 수 있다. 또한 검출 대상 오염원 생물은 이들 검체에 포함된 박테리아, 진균, 바이러스 등일 수 있다. 상기 검출 대상 생물에 특이적인 목적 유전자는 예를 들어, 각 박테리아의 16S RNA 유전자, 진균의 ITS(Internal Trascribed Spacer) 영역, 바이러스 핵산의 말단 부위의 UTR(Untranslation Region) 영역 일 수 있다. The sample that can be identified using the Taq DNA polymerase of the present invention can be blood, bone marrow fluid, amniotic fluid, urine in the case of humans or animals, and can be used in water supply, water supply tank, air conditioning circulation water, humidifier, , Drinking water that may be inhaled (negative) in daily life, or food or cosmetics. The target contaminant organism may be bacteria, fungi, viruses, etc. contained in these specimens. The target gene specific to the organism to be detected may be, for example, a 16S RNA gene of each bacterium, an ITS (Internal Trascribed Spacer) region of fungi, and a UTR (Untranslation Region) region of a terminal region of viral nucleic acid.

한편, 상기 서열번호 1의 염기서열을 본 발명에서는 PTP(Pichia Taq DNA polymerase) 염기서열이라 칭한다. In the present invention, the base sequence of SEQ ID NO: 1 is referred to as PTP (Pichia Taq DNA polymerase) base sequence.

본 발명은 Taq DNA 중합효소의 신규한 제조방법 및 이를 통해 제조된 Taq DNA 중합효소를 이용한 미생물 검출방법에 관한 것이다. 본 발명의 방법으로 제조한 Taq DNA 중합효소를 이용함으로써 기존의 Taq DNA 중합효소 제조방법을 통해 노출되던 대장균의 게놈 DNA에 대한 오염이 없는 Taq DNA를 제조할 수 있고, 이러한 Taq DNA를 이용함으로써 특정 시료에 대한 정밀한 오염원 확인이 가능하다. The present invention relates to a novel method for producing Taq DNA polymerase and a method for detecting microorganisms using Taq DNA polymerase produced thereby. By using the Taq DNA polymerase produced by the method of the present invention, it is possible to produce Taq DNA free from contamination with the genomic DNA of Escherichia coli exposed through the existing Taq DNA polymerase production method. By using such Taq DNA, It is possible to confirm the precise source of contamination to the sample.

즉, 이전에는 한국공개특허 제2001-0098068호와 같이 대장균에서 제조하는 방법을 주로 사용하여 Taq DNA 중합효소를 제조하였지만, 이와 같은 방법을 이용하여 제조한 Taq DNA 중합효소를 이용하여 특정 시료의 오염원을 검출할 경우, 대장균(Escherichia coli)의 게놈 DNA가 Taq DNA 중합효소에 결합하여 외부 오염원과 측정하려는 오염원의 구분이 어려워질 수 있기에, 대장균이 아닌 피키아 파스토리스(Pichia pastoris)를 이용하여 Taq DNA 중합효소를 제조하는 방법을 이용한다. 본 발명의 방법으로 Taq DNA 중합효소를 제조할 경우, 예를 들어, 특정 병원균에 감염된 사람이나 동물의 경우, 혈액, 골수액, 양수, 소변 등을 검체로서 분석하고, 감염여부를 초기에 검지 동정하여, 이른 병리단계에서 적절한 항생제 투여를 할 수 있거나, 감염으로부터의 회복 상태를 감염균의 정량치에 의해 모니터 할 수 있다. 또한, 상수도수, 급수 탱크, 공조 순환수, 가습기, 온천수, 풀장 물 등, 일상생활에서 흡입(음수)할 가능성이 있는 생활용수, 또는, 식품, 화장품 등에 포함된 원하지 않는 불특정의 박테리아, 진균, 바이러스 등의 혼입을 신속하게 검출하거나 모니터 할 수 있다. 따라서, 본 발명의 방법을 이용하면 검출 대상물 내의 미생물의 정량 또는 동정을 간편하면서도 신속정확하게 수행할 수 있는 방법을 확립할 수 있다.Namely, Taq DNA polymerase was prepared mainly by the method of producing Escherichia coli as disclosed in Korean Patent Laid-Open No. 2001-0098068. However, by using the Taq DNA polymerase produced by this method, If the detection of Escherichia coli (Escherichia Since the genomic DNA of E. coli binds to the Taq DNA polymerase, it may be difficult to distinguish between the external source and the source to be measured. Therefore, a non-Escherichia coli Pichia using pastoris) utilizes the method for producing a Taq DNA polymerase. When a Taq DNA polymerase is produced by the method of the present invention, for example, in the case of a person or animal infected with a specific pathogen, blood, bone marrow fluid, amniotic fluid, urine, etc. are analyzed as a specimen. So that appropriate antibiotic administration can be carried out in an early pathological stage or the recovery state from the infection can be monitored by quantification of the infecting bacteria. In addition, there is a possibility that unhealthy undesirable bacteria, fungi, bacteria, fungi, etc. contained in domestic water that may be inhaled (negative) in everyday life such as waterworks, water supply tanks, air conditioning circulation water, humidifiers, It is possible to quickly detect or monitor the incorporation of viruses and the like. Therefore, by using the method of the present invention, it is possible to establish a method which can perform the quantification or identification of microorganisms in the object to be detected easily and quickly and accurately.

도 1은 pPIC9 벡터에 서열번호 1의 PTP(Pichia Taq DNA polymerase) 염기서열이 삽입된 pPIC9-PTP 벡터를 나타낸다.
도 2는 pPIC9-PTP 벡터와 프라이머(AOX1 F - PTP R; PTP F AOX1 R)의 결합위치를 나타낸다.
도 3은 pPIC9-PTP 벡터가 삽입된 피키아 파스토리스 GS115의 형질전환 콜로니(colony)를 PCR로 확인한 결과를 나타낸다.
도 4는 pPIC9-PTP 벡터의 삽입 유무에 따라, 피키아 파스토리스 GS115의 배양액 또는 세포 내에서 PTP(Pichia Taq DNA polymerase)를 발현하는지를 SDS-PAGE로 확인한 결과를 나타낸다.
도 5는 피키아 파스토리스 GS115의 배양액에서 PTP(Pichia Taq DNA polymerase)를 정제하는 과정에서 생성되는 정제물 내의 PTP의 정제도를 SDS-PAGE로 확인한 결과를 나타낸다.
도 6은 본 발명의 방법으로 피키아 파스토리스 GS115를 이용하여 제조된 PTP와 대장균을 이용하여 제조된 시판 프라임 Taq의 효소활성을 PCR을 이용하여 비교한 결과를 나타낸다.
도 7은 본 발명의 방법으로 피키아 파스토리스 GS115를 이용하여 제조된 PTP와 대장균을 이용하여 제조된 시판 프라임 Taq 내에 외부 오염 DNA가 존재하는지를 PCR을 이용하여 확인한 결과를 나타낸다.1 shows a pPIC9-PTP vector into which the PTP (Pichia Taq DNA polymerase) base sequence of SEQ ID NO: 1 is inserted into the pPIC9 vector.
Fig. 2 shows the binding positions of the pPIC9-PTP vector and the primer (AOX1 F-PTP R; PTP F AOX1 R).
FIG. 3 shows the results of PCR of a transformed colony of Pichia pastoris GS115 into which a pPIC9-PTP vector was inserted.
FIG. 4 shows the results of SDS-PAGE for the expression of PTP (Pichia Taq DNA polymerase) in the culture solution or cells of Pichia pastoris GS115 according to the presence or absence of insertion of the pPIC9-PTP vector.
FIG. 5 shows the result of SDS-PAGE analysis of the purification of PTP in the purified water produced in the process of purifying PTP (Pichia Taq DNA polymerase) in the culture medium of Pichia pastoris GS115.
FIG. 6 shows the results of PCR comparing the enzymatic activities of commercially available Prime Taqs prepared using Pichia pastoris GS115 and E. coli using the method of the present invention.
FIG. 7 shows the results of PCR detection of the presence of contaminated DNA in commercially available Prime Taqs prepared using Pichia pastoris GS115 and E. coli using the method of the present invention.

이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지고, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Rather, the intention is to provide an exhaustive, complete, and complete disclosure of the principles of the invention to those skilled in the art.

<< 실시예Example 1. 발현 벡터 구축 ( 1. Construction of expression vector ( pPIC9pPIC9 -- PTPPTP )>)>

Taq DNA 중합효소를 제조하는 호스트(host)인 피키아 파스토리스(Pichia pastoris) GS115와 발현 벡터(vector) pPIC9는 Invitrogen의 키트를 선택하여 사용하였다(catalog No. K1710-01 Pichia Expression Kit). 이 pPIC9 벡터에는 분비 시그널(MFα signal, 도 1의 s.s:secretion sequence)이 포함되어 있기 때문에, 피키아 파스토리스가 생산하는 단백질이 피키아 파스토리스의 세포질 내부에 축적되는 것이 아니라, 배양액으로 배출이 된다. 피키아 파스토리스 GS115는 His4 유전자(histidinol dehydrogenase gene)에 대한 영양요구성 돌연변이종(auxotrophic strain)이기에, His4 유전자가 포함된 pPIC9 벡터를 이용하여 Taq DNA 중합효소를 발현하는 형질전환체(transforment)를 선별할 수 있다. Pichia pastoris GS115 and pPIC9, a host for preparing Taq DNA polymerase, were selected from Invitrogen kit (catalog No. K1710-01 Pichia Expression Kit). Since the secretory signal (MF signal (ss: secretion sequence in FIG. 1) is contained in the pPIC9 vector, the protein produced by the picapastorys is not accumulated in the cytoplasm of the picopatholith, do. Since Pichia pastoris GS115 is an auxotrophic strain for the His4 gene (histidinol dehydrogenase gene), a pPIC9 vector containing the His4 gene is used to transform a transforma- tion expressing Taq DNA polymerase Can be selected.

하기 표 1의 서열번호 1의 염기서열은 Taq DNA 중합효소의 염기서열로서, 특히, 피키아 파스토리스에서 발현할 수 있도록 코돈 최적화(codon optimization)를 수행한 Taq DNA 중합효소의 염기서열이다. 또한, 하기 표 1의 서열번호 1의 염기서열은 친화성 정제(affinity purification)를 위해 Taq DNA 중합효소 말단에 6개의 히스티틴 염기서열(6X His tag : CAT CAT CAT CAT CAT CAT)이 포함되도록 합성된 것이다. 하기 표 1의 서열번호 1의 염기서열은 본 발명에서는 PTP(Pichia Taq DNA polymerase)의 염기서열이라 칭한다. The nucleotide sequence of SEQ ID NO: 1 in Table 1 below is a nucleotide sequence of Taq DNA polymerase, in particular, a base sequence of Taq DNA polymerase that has undergone codon optimization so that it can be expressed in Pichia pastoris. The nucleotide sequence of SEQ ID NO: 1 in Table 1 was synthesized so that 6 histidine bases (6X His tag: CAT CAT CAT CAT CAT CAT) were included at the terminal of Taq DNA polymerase for affinity purification. . The nucleotide sequence of SEQ ID NO: 1 in the following Table 1 is referred to as a base sequence of PTP (Pichia Taq DNA polymerase) in the present invention.

한편, 하기 표 1의 서열번호 1의 PTP 염기서열을 pPIC9 벡터에 삽입하여 도 1과 같은 pPIC9-PTP 벡터를 제조하였다. 이 벡터의 제조방법은 하기와 같다. On the other hand, a pPIC9-PTP vector as shown in Fig. 1 was prepared by inserting the PTP base sequence of SEQ ID NO: 1 in Table 1 into the pPIC9 vector. The method for producing this vector is as follows.

서열번호 2의 써머스 아쿠아티커스(Thermus aquaticus)의 Taq DNA 중합효소의 염기서열을 바탕으로 피키아의 코돈 선호도에 맞춰 염기서열을 변경하고, 종결코돈 앞에 6개의 히스티틴 코돈을 삽입하였다. 이렇게 코돈 최적화된 염기서열을 발현 벡터인 pPIC9에 삽입할 수 있게 하기 위하여 염기서열의 5' 말단에 AvrII, 3' 말단에 NotI 제한효소 서열을 첨가하여 최종적으로 서열번호 1의 염기서열을 확정하였고, 이를 ㈜바이오닉스에 의뢰하여 유전자 합성하였다. 합성된 서열번호 1의 염기서열(PTP:Pichia Taq DNA Polymerase)과 pPIC9 벡터에 제한효소 AvrII, NotI 처리를 하여, 결찰(ligation)을 통해 pPIC9 벡터에 있는 분비 시그널 MFα 서열 뒤에 서열번호 1의 염기서열(PTP)가 삽입되게 하여 pPIC9-PTP 벡터를 구축하였다. 구축된 벡터에 제한효소 AvrII과 NotI을 처리하여 전기영동으로 분석하였을 때, 8020bp의 pPIC9 벡터와 2520bp의 서열번호 1의 염기서열(PTP) 밴드를 확인하여 pPIC9에 서열번호 1의 염기서열(PTP)이 삽입됨을 확인하였다. Based on the nucleotide sequence of the Taq DNA polymerase of Thermus aquaticus of SEQ ID NO: 2, the nucleotide sequence was changed according to the codon preference of Pichia, and six histidine codons were inserted in front of the termination codon. In order to insert the codon optimized nucleotide sequence into the expression vector pPIC9, the nucleotide sequence of SEQ ID NO: 1 was finally determined by adding the NotI restriction enzyme sequence to the 5 'end of the nucleotide sequence and the NotI restriction enzyme sequence to the 3' end, This gene was synthesized by Bionix. The synthesized Pichia Taq DNA Polymerase (PTP) and pPIC9 vector were treated with restriction enzymes AvrII and NotI to obtain a secretion signal MFα sequence in the pPIC9 vector through ligation, and the nucleotide sequence of SEQ ID NO: 1 (PTP) was inserted to construct a pPIC9-PTP vector. When the constructed vector was treated with restriction enzymes AvrII and NotI and analyzed by electrophoresis, the pPIC9 vector of 8020 bp and the base sequence (PTP) band of 2520 bp of SEQ ID NO: 1 were confirmed and the base sequence (PTP) Was inserted.

한편, 하기 표 2의 서열번호 2의 염기서열은, 통상의 PCR 실험에서 사용되는 대장균을 이용하여 합성한 써머스 아쿠아티커스(Thermus aquaticus) 유래의 Taq DNA 중합효소의 염기서열(Thermus aquaticus gene for DNA polymerase, complete CDs, Accession number : D32013)을 나타낸 것이다. On the other hand, the nucleotide sequence of SEQ ID NO: 2 shown in Table 2 below can be obtained by using a Thermus shows D32013): aquaticus) DNA sequence (Thermus aquaticus DNA polymerase gene for, complete CDs, Accession number of the Taq DNA polymerase derived.

본 발명에서는 하기 표 2의 서열번호 2의 염기서열을 갖는 Taq DNA 중합효소인 프라임 Taq(prime Taq, GeNetBio Catalog No. G-1000)을 피키아 파스토리스를 이용하여 제조한 Taq DNA 중합효소인 PTP에 대한 비교군으로 사용하였다. In the present invention, a primer Taq (prime Taq, GeNetBio Catalog No. G-1000), which is a Taq DNA polymerase having the nucleotide sequence of SEQ ID NO: 2 shown in the following Table 2, was amplified by PCR using a Taq DNA polymerase PTP Were used as a comparison group.

서열번호 1 : Pichia Taq DNA polymerase sequence (인공서열)
TTCCTTATGAGGAAGCCCAGGCCTTCATCGAACGTTATTTCCAGAGTTTCCCTAAGGTCAGAGCCTGGATTGAGAAGACACTAGAAGAAGGACGTAGGAGAGGTTACGTCGAAACACTATTCGGTAGACGAAGGTACGTTCCAGACTTGGAAGCTAGAGTAAAGTCTGTTAGAGAAGCTGCCGAAAGAATGGCCTTCAACATGCCTGTTCAAGGTACAGCTGCTGACCTGATGAAATTGGCTATGGTTAAGTTGTTCCCTAGACTTGAGGAAATGGGAGCAAGGATGTTATTGCAGGTGCATGACGAATTGGTATTGGAAGCTCCTAAAGAAAGAGCCGAGGCCGTTGCTAGACTGGCTAAAGAGGTAATGGAGGGGGTATATCCTCTGGCTGTACCATTGGAAGTAGAAGTTGGTATAGGAGAAGACTGGTTGTCAGCTAAAGAA CATCATCATC ATCATCAT TAA SEQ ID NO: 1: Pichia Taq DNA polymerase sequence (artificial sequence)
TTCCTTATGAGGAAGCCCAGGCCTTCATCGAACGTTATTTCCAGAGTTTCCCTAAGGTCAGAGCCTGGATTGAGAAGACACTAGAAGAAGGACGTAGGAGAGGTTACGTCGAAACACTATTCGGTAGACGAAGGTACGTTCCAGACTTGGAAGCTAGAGTAAAGTCTGTTAGAGAAGCTGCCGAAAGAATGGCCTTCAACATGCCTGTTCAAGGTACAGCTGCTGACCTGATGAAATTGGCTATGGTTAAGTTGTTCCCTAGACTTGAGGAAATGGGAGCAAGGATGTTATTGCAGGTGCATGACGAATTGGTATTGGAAGCTCCTAAAGAAAGAGCCGAGGCCGTTGCTAGACTGGCTAAAGAGGTAATGGAGGGGGTATATCCTCTGGCTGTACCATTGGAAGTAGAAGTTGGTATAGGAGAAGACTGGTTGTCAGCTAAAGAA CATCATCATC ATCATCAT TAA

서열번호 2 : Thermus aquaticus gene for DNA polymerase, complete CDs, Accession number : D32013
TCCCTTACGAGGAGGCCCAGGCCTTCATTGAGCGCTACTTTCAGAGCTTCCCCAAGGTGCGGGCCTGGATTGAGAAGACCCTGGAGGAGGGCAGGAGGCGGGGGTACGTGGAGACCCTCTTCGGCCGCCGCCGCTACGTGCCAGACCTAGAGGCCCGGGTGAAGAGCGTGCGGGAGGCGGCCGAGCGCATGGCCTTCAACATGCCCGTCCAGGGCACCGCCGCCGACCTCATGAAGCTGGCTATGGTGAAGCTCTTCCCCAGGCTGGAGGAAATGGGGGCCAGGATGCTCCTTCAGGTCCACGACGAGCTGGTCCTCGAGGCCCCAAAAGAGAGGGCGGAGGCCGTGGCCCGGCTGGCCAAGGAGGTCATGGAGGGGGTGTATCCCCTGGCCGTGCCCCTGGAGGTGGAGGTGGGGATAGGGGAGGACTGGCTCTCCGCCAAGGAGTGA SEQ ID NO: 2: Thermus aquaticus gene for DNA polymerase, complete CDs, Accession number: D32013
TCCCTTACGAGGAGGCCCAGGCCTTCATTGAGCGCTACTTTCAGAGCTTCCCCAAGGTGCGGGCCTGGATTGAGAAGACCCTGGAGGAGGGCAGGAGGCGGGGGTACGTGGAGACCCTCTTCGGCCGCCGCCGCTACGTGCCAGACCTAGAGGCCCGGGTGAAGAGCGTGCGGGAGGCGGCCGAGCGCATGGCCTTCAACATGCCCGTCCAGGGCACCGCCGCCGACCTCATGAAGCTGGCTATGGTGAAGCTCTTCCCCAGGCTGGAGGAAATGGGGGCCAGGATGCTCCTTCAGGTCCACGACGAGCTGGTCCTCGAGGCCCCAAAAGAGAGGGCGGAGGCCGTGGCCCGGCTGGCCAAGGAGGTCATGGAGGGGGTGTATCCCCTGGCCGTGCCCCTGGAGGTGGAGGTGGGGATAGGGGAGGACTGGCTCTCCGCCAAGGAGTGA

<< 실시예Example 2. 전기천공법을 이용한 형질전환> 2. Transformation using electroporation>

YPD 배지(1%[w/v] yeast extract, 2%[w/v] polypeptone, 2%[w/v] D-glucose/1ℓ H2O)에 피키아 파스토리스를 접종하여 30℃에서 피키아 파스토리스의 농도가 최대 7×107세포/㎖이 될 때까지 배양하고, 4℃에서 원심 분리하여 상등액을 제거한 후, 제거된 상등액(배양액)의 1/5이 되는 부피에 해당되는 YPD/HEPES를 가하여 피키아 파스토리스를 현탁하였다(YPD/HEPES : YPD 배지와 HEPES 버퍼가 혼합된 것으로, 200mM HEPES[4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid]에 1X YPD와 25mM DTT[Dithiothreitol]가 혼합됨). 다시 이 현탁액을 4℃에서 원심분리하여 상등액을 제거하고, 1 M 솔비톨 용액으로 피키아 파스토리스를 세척한 후, 이 세척 과정을 한 번 더 반복하였다. 다음으로는 피키아 파스토리스 세포 수를 1×1010세포/㎖ 농도 미만이 되도록 재현탁하여 감응세포(competent cell)가 되도록 하였다. 이 현탁액 상태의 피키아 파스토리스 감응세포 40㎕에, DraIII를 처리하여 선형 상태(linear form)가 된 pPIC9-PTP을 혼합하고, 전체 내용물을 0.2cm 큐벳(cuvette)에 옮겨 얼음 속에서 10분간 반응시켰다. 일반적으로 대장균 내에서 재조합 단백질을 생산할 경우, 환형의 플라스미드를 바로 주입해서 형질전환을 하지만, pPIC9-PTP 벡터는 피키아 파스토리스의 게놈 DNA에 포함되어야 하기 때문에 선형상태로 주입한다. Pichia pastoris was inoculated into YPD medium (1% [w / v] yeast extract, 2% [w / v] polypeptone, 2% [w / v] D-glucose / 1 L H 2 O) The culture was continued until the concentration of kiapastorice reached a maximum of 7 x 10 7 cells / ml, and the supernatant was removed by centrifugation at 4 ° C. Then, the YPD / (YPD / HEPES: a mixture of YPD medium and HEPES buffer containing 1X YPD and 25 mM DTT [Dithiothreitol] in 200 mM HEPES [4- (2-hydroxyethyl) -1-piperazineethanesulfonic acid] Is mixed). Again, the suspension was centrifuged at 4 ° C to remove the supernatant, and the Pichia pastoris was washed with 1 M sorbitol solution, and the washing procedure was repeated one more time. Next, the re-suspended to be below Pichia pastoris can be a 1 × 10 10 cells / ㎖ concentration of cells was adjusted to sensitive cells (competent cell). To 40 μl of the Pichia pastoris sensitive cells in the suspension state, pPIC9-PTP having a linear form was treated with DraIII, and the whole contents were transferred to a 0.2 cm cuvette and reacted in ice for 10 minutes . Generally, when producing a recombinant protein in E. coli, a circular plasmid is directly injected and transformed. However, since the pPIC9-PTP vector must be included in the genomic DNA of Pichia pastoris, it is injected in a linear state.

이 후, [C = 25uF, PC = 200 Ω, V = 2.0 kV] 조건에서 큐벳 안의 피키아 파스토리스 감응세포가 포함된 내용물에 전기충격을 가한 후, 즉시 차가운 1 M 솔비톨 용액 1㎖을 첨가하였다. 이 상태로 내용물을 30℃에서 1시간 동안 배양한 후 최소배지MM(1.34%[w/v] Yeast Nitrogen Base w/o amino acid, 4×10-5%[w/v] Biotin, 0.5%[v/v] Methanol/1ℓ H2O)에 상기 내용물(전기충격을 수행한 파스토리아 감응세포 포함됨)을 도말하여 30℃에서 72~96시간 배양한 후 콜로니(colony) 상태의 피키아 파스토리스 GS115를 얻었다. Thereafter, electric shock was applied to the contents containing the Pichia pastoris sensitive cells in the cuvette under the conditions of [C = 25 uF, PC = 200 OMEGA, V = 2.0 kV], and immediately 1 ml of a cold 1 M sorbitol solution was added . In this state, the contents were incubated at 30 ° C for 1 hour and then cultured in a minimal medium MM (1.34% [w / v] Yeast Nitrogen Base w / o amino acid, 4 × 10 -5 % [w / v] Biotin, 0.5% v / v] methanol / 1 L H 2 O) was cultured at 30 ° C. for 72 to 96 hours and cultured in a colony state of Pichia pastoris GS115 .

<< 실시예Example 3. 형질전환체의 선택>  3. Selection of transformants>

실시예 2의 최소배지에서 자란 피키아 파스토리스 GS115의 콜로니(colony)들을 무작위로 100개를 선별하여 각각 히스티딘 결핍 배지와 메탄올이 첨가된 고체상태의 최소배지(1.34%[w/v] Yeast Nitrogen Base w/o amino acid, 0.07%[w/v] Histidin drop out Amino acid, 0.5%[v/v] Methanol, 1.5%[w/v] Agar/1ℓ H2O)에 옮겨 30℃에서 48~72시간 배양하였다(Histidin drop out Amino acid는 히스티딘만 빠진 아미노산 혼합물). 피키아 파스토리스 GS115는 His4 유전자에 대한 영양요구성 돌연변이종(histidinol dehydrogenae gene(his4) auxotrophic strain)이기에, 히스티딘 결핍배지에서는 생장하지 못하고, pPIC9-PTP(서열번호 1의 염기서열[PTP 유전자]과 His4 유전자를 포함하는 pPIC9)가 삽입된 형질전환체만이 콜로니를 형성한다. 따라서, 이렇게 히스티딘 결핍배지에서 자란 콜로니만을 선별하여 PTP의 발현이 잘 일어나고 있는지 확인하였다. 100 randomly selected colonies of Pichia pastoris GS115 grown in the minimal medium of Example 2 were cultured in a minimal medium (1.34% [w / v] Yeast Nitrogen The cells were transferred to a base w / o amino acid, 0.07% [w / v] Histidin drop out Amino acid, 0.5% [v / v] Methanol, 1.5% [w / v] Agar / l H 2 O, (Histidin drop out Amino acid is an amino acid mixture of histidine only). Pichia pastoris GS115 is a histidinol dehydrogenae (his4) auxotrophic strain for the His4 gene and can not grow in the histidine-deficient medium, but is resistant to pPIC9-PTP (the base sequence [PTP gene] Only pPIC9) inserted transformants containing the His4 gene form colonies. Thus, only the colonies grown in the histidine-deficient medium were selected to confirm whether the expression of PTP was occurring well.

PTP 유전자의 삽입을 확인하기 위해, pPIC9-PTP 염기서열을 인식하는 프라이머(primer)로서, AOX1 프로모터 부분에서 PTP 유전자의 앞부분을 증폭할 수 있는 프라이머 ‘AOX1 F - PTP R’ 및 PTP 유전자의 말단부분에서 AOX1 종결자(terminator) 부분을 증폭할 수 있는 프라이머 ‘PTP F - AOX1 R’(표 3 참조)을 각각 제작한 뒤(이 프라이머들이 pPIC9-PTP 벡터와 결합하는 위치는 도 2에 개시됨), 히스티딘 결핍배지에서 선별된 10개의 피키아 파스토리스 GS115 콜로니의 게놈 DNA를 추출하여 상기 프라이머들을 이용하여 표 4의 조건으로 PCR을 수행했다. In order to confirm the insertion of the PTP gene, a primer recognizing the pPIC9-PTP nucleotide sequence was constructed by using primers' AOX1 F-PTP R 'capable of amplifying the front portion of the PTP gene in the AOX1 promoter region and a primer' PTP F-AOX1 R '(see Table 3) capable of amplifying the AOX1 terminator portion of the primer (the positions at which these primers bind to the pPIC9-PTP vector are shown in FIG. 2) , Genomic DNA of 10 Pichia pastoris GS115 colonies selected from histidine-deficient medium was extracted and PCR was carried out using the above primers under the conditions of Table 4.

한편, 상기 피키아 파스토리스 GS115의 게놈 DNA 추출 방법은 하기와 같다. PTP 유전자를 포함하는 피키아 파스토리스 GS115 형질전환체를 히스티딘 결핍 액체배지(1.34%[w/v] Yeast Nitrogen Base w/o amino acid, 0.07%[w/v] Histidin drop out Amino acid, 0.5%[w/v] Methanol/1ℓ H2O) 3㎖에 접종하여 30℃, 200rpm에서 24시간 진탕배양 하였고, 원심분리하여 상등액을 제거한 후 얻은 세포를 게놈 DNA 추출에 사용하였다. 상등액이 제거된 세포를 지몰라아제용 버퍼(1M Sorbitol, 10mM EDTA, 14mM β-Mercaptoethanol) 500㎕에 현탁하고, 10 유닛(unit)의 지몰라아제(zymolyase)를 첨가하고 37℃에서 1시간 동안 처리하여 피키아 파스토리스 GS115의 세포벽을 제거하였다. 세포벽을 제거한 피키아 파스토리스를 PrimePrepTM Genomic DNA Isolation Kit(GeNetBio CatNo. K-3000)를 이용하여 제공된 매뉴얼을 따라 게놈 DNA를 추출하였다. On the other hand, the genomic DNA extraction method of Pichia pastoris GS115 is as follows. The Pichia pastoris GS115 transformant containing the PTP gene was transformed into histidine deficient liquid medium (1.34% [w / v] Yeast Nitrogen Base w / o amino acid, 0.07% [w / v] Histidin drop out Amino acid, 0.5% [w / v] Methanol / 1 L H 2 O) and incubated at 30 ° C with shaking at 200 rpm for 24 hours. The supernatant was removed by centrifugation and the obtained cells were used for genomic DNA extraction. The supernatant-removed cells were suspended in 500 μl of an agase buffer (1 M sorbitol, 10 mM EDTA, 14 mM β-mercaptoethanol), 10 units of zymolyase was added, and the mixture was incubated at 37 ° C. for 1 hour To remove the cell wall of Pichia pastoris GS115. The genomic DNA was extracted from the Pichia pastoris with the cell wall removed using the PrimePrep ™ Genomic DNA Isolation Kit (GeNetBio Cat No. K-3000) according to the manual provided.

PrimerPrimer Sequence(5'-3')Sequence (5'-3 ') AOX1 FAOX1 F GAC TGG TTC CAA TTG ACA AGCGAC TGG TTC CAA TTG ACA AGC PTP RPTP R AAG GAG CCT TAG CGT CAA AAAG GAG CCT TAG CGT CAAE PTP FPTP F ATG TTA TTG CAG GTG CAT GAATG TTA TTG CAG GTG CAT GA AOX1 RAOX1 R GCA AAT GGC ATT CTG ACA TCGCA AAT GGC ATT CTG ACA TC

TemperatureTemperature TimeTime CycleCycle 95℃95 ℃ 5 min5 min 1One 95℃95 ℃ 30 sec30 sec
30
30 57℃57 ℃ 30 sec30 sec 72℃72 ℃ 1 min1 min 72℃72 ℃ 7 min7 min 1One 12℃12 ° C ∞∞ 1One

pPIC9-PTP 벡터가 피키아 파스토리스 GS115의 게노믹 DNA에 잘 삽입된 콜로니를 선별하였을 경우, 프라이머 ‘AOX1 F - PTP R’ 및 ‘PTP F - AOX1 R’을 사용한 PCR 산물로 각각 567bp와 301bp의 밴드가 확인된다(*bp:base pairs). When the pPIC9-PTP vector was inserted into the genomic DNA of Pichia pastoris GS115, PCR products using the primers 'AOX1 F-PTP R' and 'PTP F-AOX1 R' were amplified with 567 bp and 301 bp The bands are identified (* bp: base pairs).

상기 PCR 결과는 도 3에 나타내었는데, 도 3을 참고하면, 히스티딘 결핍배지에서 자란 피키아 파스토리스 GS115 콜로니 10개를 선택하여 확인한 바, 7개의 콜로니(Colony No. 1, 3, 4, 5, 7, 8, 10)에서 567bp와 301bp의 PCR 산물이 확인되어 PTP 유전자의 삽입이 성공적으로 잘 수행되었음을 알 수 있다. The results of the PCR were shown in FIG. 3. Referring to FIG. 3, ten P. xanthoptera GS115 colonies grown on a histidine-deficient medium were selected and identified. Seven colonies (Colony No. 1, 3, 4, 5, 7, 8, and 10), PCR products of 567 bp and 301 bp were confirmed, indicating that the insertion of the PTP gene was successfully performed.

한편, 히스티딘 결핍배지에서 자라기는 했지만, PTP 유전자의 삽입이 되지 않은 것들은, 히스티딘 결핍배지에서도 자랄 수 있도록 피키아 파스토리스 GS115의 돌연변이가 일어났거나, 인접한 콜로니에서 생산한 히스티딘을 이용했거나, 배양액 중의 피키아 파스토리스가 사멸하면서 내어 놓는 히스티딘을 이용했을 것이라고 판단되었다. On the other hand, although the PTP gene was not inserted in the histidine-deficient medium, the mutation of Pichia pastoris GS115 occurred, histidine produced in the adjacent colony was used so that it could grow even in the histidine-deficient medium, It was judged that Pichia pastoris would have used histidine released from the dead.

<< 실시예Example 4. 형질전환체의 배양 및  4. Culturing of transformants and TaqTaq DNADNA 중합효소의 분비 확인> Confirmation of secretion of polymerase>

실시예 3에서 pPIC9-PTP 벡터가 피키아 파스토리스 GS115의 게노믹 DNA에 잘 삽입된 것으로 확인된 콜로니(피키아 파스토리스 GS115/pPIC9-PTP)를 BMGY 액체 배지(1% Yeast extract[w/v], 2% Peptone[w/v], 100mM Potassium Phosphate, pH 6.0, 1.34%[w/v] Yeast Nitrogen Base w/o amino acid, 4×10-5%[w/v] Biotin, 1%[v/v] Glycerol/1ℓ H2O)에 접종하여 30℃, 200rpm 조건에서 12~24시간 동안 배양하였으며, 대조군으로서, pPIC9-PTP 벡터가 삽입되지 않은 일반 피키아 파스토리스 GS115도 배양하였다(BMGY는 다른 배지와 비교하여 글리세롤을 포함하고 있어 세포 증식을 많이 할 수 있고, 그만큼 단백질의 생성도 많아짐)(각 세포는 O.D.(optical density)가 600nm에서 2~6이 될 때까지 배양함). (Pichia pastoris GS115 / pPIC9-PTP) confirmed to be well inserted into genomic DNA of Pichia pastoris GS115 in BMGY liquid medium (1% Yeast extract [w / v ], 2% Peptone [w / v], 100mM Potassium Phosphate, pH 6.0, 1.34% [w / v] Yeast Nitrogen Base w / o amino acid, 4 × 10 -5% [w / v] Biotin, 1% [ v / v] Glycerol / 1 L H 2 O) and cultured at 30 ° C and 200 rpm for 12 to 24 hours. As a control group, a general Pichia pastoris GS115 without the pPIC9-PTP vector was also cultured (BMGY (Which contains glycerol as compared with the other medium, can increase cell proliferation and increases protein production) (each cell is cultured until OD (optical density) reaches 2 to 6 at 600 nm).

이 후, BMGY 배양액을 원심분리하여 상등액을 제거하고 남은 펠렛(pellet)(Cell)만 메탄올이 0.5%(v/v) 함유된 BMMY 액체 배지(1%[w/v] Yeast extract, 2%[w/v] Peptone, 100mM Potassium Phosphate, pH 6.0, 1.34%[w/v] Yeast Nitrogen Base w/o amino acid, 4×10-5%[w/v] Biotin, 0.5% Methanol[v/v]/1ℓ H2O)에 옮겨 30℃, 200rpm 조건에서 48~96시간 배양하였다. 또한 피키아 파스토리스 GS115의 성장에 따라 메탄올이 소모되기 때문에, 24시간마다 메탄올 농도가 0.5%(v/v)가 되도록 메탄올을 첨가하여 AOX1(alcohol oxidase) 유전자의 발현을 통해 PTP 유전자의 발현이 활성화되도록 하였다. Thereafter, the supernatant was removed by centrifugation of the BMGY culture, and only the remaining pellet (Cell) was transferred to a BMMY liquid medium (1% [w / v] Yeast extract, 2% [v / v] v / v] Peptone, 100 mM Potassium Phosphate, pH 6.0, 1.34% [w / v] Yeast Nitrogen Base w / o amino acid, 4 x 10 -5 % [w / v] Biotin, / 1 L H 2 O) and cultured at 30 ° C and 200 rpm for 48 to 96 hours. In addition, since methanol is consumed due to the growth of Pichia pastoris GS115, methanol is added so that the methanol concentration becomes 0.5% (v / v) every 24 hours, and expression of the PTP gene through expression of the AOX1 (alcohol oxidase) Respectively.

한편, 상기 배양과정 중 48시간째의 배양액에서의 PTP 발현 유무를 SDS-PAGE(Sodiumdodecylsulfate-polyacrylamide gel electrophoresis)로 확인하였다. 상기 48시간째의 배양액을 원심분리하여 얻은 상등액을 세포 외 분획(extracellural fraction)이라 하고, 원심분리하여 얻은 세포 펠렛(pellet)을 지몰라아제용 버퍼(1M Sorbitol, 10mM EDTA, 14mM β-Mercaptoethanol)에 현탁한 후, 지몰리아제(zymolyase)를 처리하여 용해하여 얻은 상등액을 세포 내 분획(intracellur fraction)이라 하였다. 또한, 세포 외 분획(extracellural fraction)을 80℃에서 30분간 열처리한 것을 세포 외 분획의 열처리물(extra heat shock fraction)이라 하였다. Meanwhile, the presence or absence of PTP expression in the culture solution at 48 hours in the culture was confirmed by SDS-PAGE (sodium dodecylsulfate-polyacrylamide gel electrophoresis). The supernatant obtained by centrifuging the culture solution for 48 hours was called an extracellular fraction and the cell pellet obtained by centrifugation was suspended in a buffer (1 M sorbitol, 10 mM EDTA, 14 mM β-mercaptoethanol) , And treated with zymolyase to dissolve the supernatant. The supernatant was called intracellur fraction. In addition, the extracellular fraction was heat-treated at 80 ° C for 30 minutes, which was called an extra heat shock fraction of the extracellular fraction.

SDS-PAGE를 위해서는, FastCast Acrylamid Kit(BIO-RAD, Cat. No. RP161-0185TA)를 이용하여 12%(w/v) 아크릴아마이드 겔을 제조하였다. 분석할 단백질을 포함하는 각 세포 분획들을 각각 10㎕와 SDS-PAGE 로딩 버퍼 5㎕를 혼합한 뒤 100℃에서 5분간 열처리를 하여 SDS-PAGE 분석할 단백질 샘플을 준비하였다. 제조한 아크릴아마이드 겔에 단백질 샘플을 로딩하고, 150~200V에서 40분 동안 전기영동하였다. 전기영동이 완료된 겔을 UV에 5분 노출시켜서 전개된 단백질 밴드를 확인하였다. For SDS-PAGE, a 12% (w / v) acrylamide gel was prepared using FastCast Acrylamide Kit (BIO-RAD, Cat. No. RP161-0185TA). 10 μl of each cell fraction containing the protein to be analyzed and 5 μl of SDS-PAGE loading buffer were mixed and heat-treated at 100 ° C. for 5 minutes to prepare a protein sample for SDS-PAGE analysis. Protein samples were loaded onto the prepared acrylamide gels and electrophoresed at 150-200V for 40 minutes. The electrophoresed gel was exposed to UV for 5 minutes to identify the developed protein bands.

상기 SDS-PAGE 결과는 도 4에 나타내었다. The SDS-PAGE results are shown in FIG.

도 4를 참고하면, pPIC9-PTP 벡터가 삽입되지 않은 피키아 파스토리스 GS115의 세포 내 분획(Pichia pastoris GS115 intracellur fraction) 및 세포 외 분획(Pichia pastoris GS115 Extracellular fraction), pPIC9-PTP 벡터가 삽입된 피키아 파스토리스 GS115의 세포 내 분획(Pichia pastoris GS115/pPIC9-PTP intracellur fraction)에서는 본 발명의 PTP 발현(95kDa의 밴드)이 확인되지 않는다(각각 Lane 1, 2, 3). 4, the Pichia pastoris GS115 intracellular fraction and the Pichia pastoris GS115 extracellular fraction of pKI9-PTP vector-free pichia pastoris GS115 and the pPIC9-PTP vector The PTP expression (95 kDa band) of the present invention was not confirmed in the intracellular fraction (Pichia pastoris GS115 / pPIC9-PTP intracellur fraction) of Kiapastoris GS115 (Lane 1, 2, 3, respectively).

이에 반해, pPIC9-PTP 벡터가 삽입된 피키아 파스토리스 GS115의 세포 외 분획(Pichia pastoris GS115/pPIC9-PTP Extracellular fraction)에서는 95kDa의 PTP 밴드가 확인된다(Lane 4). In contrast, the extracellular fraction of Pichia pastoris GS115 (Pichia pastoris GS115 / pPIC9-PTP extracellular fraction) in which the pPIC9-PTP vector is inserted has a 95 kDa PTP band (Lane 4).

또한, 80℃에서 열처리한 pPIC9-PTP 벡터가 삽입된 피키아 파스토리스 GS115의 세포 외 분획의 열처리물(Pichia pastoris GS115/pPIC9-PTP Extra heat shock fraction)에서는 PTP 발현(95kDa의 밴드)만이 확인되는 것을 알 수 있다(Lane 5)(고온 반응에 따라 내열성 단백질인 PTP를 제외하고, 다른 단백질은 열반응으로 분해되었음).In addition, only the PTP expression (95 kDa band) was confirmed in the heat-treated Pichia pastoris GS115 / pPIC9-PTP extra heat shock fraction of the extracellular fraction of Pichia pastoris GS115 into which the pPIC9-PTP vector heat-treated at 80 ° C was inserted (Lane 5) (except for PTP, which is a heat-resistant protein, and other proteins were decomposed by heat reaction at high temperature).

<< 실시예Example 5.  5. TaqTaq DNADNA 중합효소의 정제 및 효소활성 확인> Purification of polymerase and identification of enzyme activity>

실시예 4의 방법으로 메탄올이 함유된 BMMY 액체 배지에서 배양한 배양물(피키아 파스토리스 GS115/pPIC9-PTP의 배양액)을 원심분리한 후 펠렛(pellet)(Cell)을 제거한 배양액을 70%(w/v) 황산 암모늄(ammonium sulfate)으로 염석(Salting out)하였다. 염석한 배양액을 다시 원심분리하여 상등액을 버리고 평형 버퍼(equilibration buffer : 50mM Tris-HCl, 0.5M NaCl, 10mM Imidazole. pH 8.0)에 펠렛을 녹였다. 투석막(SIGMA-ALDRICH Cat No. D9652-100FT)을 이용하여 염을 제거하고 80℃에서 30분간 열처리하여 변성된 단백질을 제거함으로써 PTP 조효소액을 만들었다. The culture (Pichia pastoris GS115 / pPIC9-PTP culture) cultured in the BMMY liquid medium containing methanol by the method of Example 4 was centrifuged, and the pellet (Cell) w / v) ammonium sulfate. The supernatant was discarded and the pellet was dissolved in equilibration buffer (50 mM Tris-HCl, 0.5 M NaCl, 10 mM Imidazole, pH 8.0). The salt was removed using a dialysis membrane (SIGMA-ALDRICH Cat No. D9652-100FT), and the denatured protein was removed by heat treatment at 80 ° C for 30 minutes to prepare a PTP enzyme solution.

다음으로는 히스티틴(6X His tag)을 이용한 친화성 크로마토그래피(affinity chromatography)를 수행하기 위해 Ni 아가로오스 레진(Ni-agarose resin)을 컬럼에 충진하였다. 컬럼에 평형 버퍼(50mM Tris-HCl, 0.5M NaCl, 10mM Imidazole. pH 8.0)를 주입하여 평형화한 후, PTP 조효소액을 흘려주었다. 이 후, 컬럼 부피의 5배가 되는 세척용 버퍼(washing buffer : 50mM Tris-HCl, 0.5M NaCl, 20mM Imidazole. pH 8.0)를 흘려주어 레진에 결합되지 않은 단백질을 제거해냈다. 250mM 이미다졸(imidazole)을 포함한 용출 버퍼(elution buffer : 50mM Tris-HCl, 0.5M NaCl, 250mM Imidazole. pH 8.0)를 주입하여 컬럼에서 PTP를 용출하였고, 용출된 PTP 용액에서 투석(투석막 : SIGMA-ALDRICH Cat No. D9652-100FT)을 통해 이미다졸을 제거한 뒤, 다시 투석(투석막 : SIGMA-ALDRICH Cat No. D9652-100FT)을 통해 PTP가 저장 버퍼(storage buffer : 20mM Tris-HCl, pH 8.0, 100mM KCl, 0.5mM EDTA, 0.5%[v/v] Tween20, 0.5%[w/v] NP40, 50%[v/v] Glycerol)에 용해되도록 하였다. Next, Ni-agarose resin was filled in the column to perform affinity chromatography using histidine (6X His tag). The column was equilibrated with equilibrium buffer (50 mM Tris-HCl, 0.5 M NaCl, 10 mM Imidazole, pH 8.0), and then the PTP enzyme solution was flowed. Thereafter, washing buffer (50 mM Tris-HCl, 0.5 M NaCl, 20 mM Imidazole, pH 8.0), which was 5 times the column volume, was poured to remove unbound protein from the resin. The elution buffer (elution buffer: 50 mM Tris-HCl, 0.5 M NaCl, 250 mM Imidazole, pH 8.0) containing 250 mM imidazole was injected to elute PTP from the column, and dialysis (dialysis membrane: SIGMA- (Buffer: 20 mM Tris-HCl, pH 8.0, 100 mM) to remove the imidazole via dialysis (dialysis membrane: SIGMA-ALDRICH Cat No. D9652-100FT) 0.5% v / v Tween 20, 0.5% [w / v] NP40, 50% [v / v] Glycerol.

이 때, 각 정제단계에서의 PTP 용액을 동일부피로 취해, 이들을 실시예 4에서처럼 SDS-PAGE를 통해 분석하여 정제 효율을 확인하였으며(겔 확인은 통상의 단백질 염색법인 코마시블루 염색법[Coomasie blue staining]을 이용하여 확인함), 이 결과는 도 5에 나타내었다. At this time, the PTP solutions in the respective purification steps were taken in the same volume, and analyzed by SDS-PAGE as in Example 4 to confirm the purification efficiency (gel identification was performed using a conventional protein staining method [Coomasie blue staining ], And the results are shown in Fig.

도 5를 참고하면, pPIC9-PTP 벡터가 삽입된 피키아 파스토리스 GS115의 세포 외 분획(Pichia pastoris GS115/pPIC9-PTP Extracellular fraction)(Lane 1), 이의 열처리물(Pichia pastoris GS115/pPIC9-PTP Extra heat shock fraction)(Lane 2)과 비교하여, 이 열처리물에 친화성 정제를 수행하여 얻은 분획(Lane 3)이나 이를 저장 버퍼에 농축한 분획(Lane4)에서 PTP의 농축 및 정제과정이 잘 진행되었음을 알 수 있다. 또한, 이들 분획물 또는 정제된 단백질이 대장균(E.coli)에서 정제한 Taq DNA 중합효소인 프라임 Taq(prime Taq)(GeNetBio Catalog No. G-1000)(Lane 5)과 같은 크기인 것을 확인할 수 있어, 피키아 파스토리스 GS115를 이용하여 Taq DNA 중합효소의 제조가 잘 되었음을 알 수 있다. 5, an extracellular fraction (Pichia pastoris GS115 / pPIC9-PTP Extracellular fraction) (Lane 1) of Pichia pastoris GS115 into which a pPIC9-PTP vector was inserted, a heat treatment thereof (Pichia pastoris GS115 / pPIC9-PTP Extra (Lane 3) obtained by performing affinity purification on this heat-treated product (Lane 3) or a fraction (Lane 4) concentrated in the storage buffer as compared with the heat shock fraction (Lane 2) Able to know. It is also confirmed that these fractions or purified proteins have the same size as that of Prime Taq (GeNetBio Catalog No. G-1000) (Lane 5), which is a Taq DNA polymerase purified from E. coli , And Pichia pastoris GS115 was used for the preparation of Taq DNA polymerase.

이렇게 정제된 PTP를 대장균에서 정제한 Taq DNA 중합효소인 프라임 Taq과 비교하여 PCR 활성을 확인하였다(각 효소는 1유닛[unit]씩 사용함). 이를 위해 바실러스 균주의 게놈 DNA(Bacillus genomic DNA)를 증폭하려는 DNA의 주형(template)으로 사용하였고, 박테리아의 16s RNA 유전자를 증폭할 수 있는 프라이머 B1F-B1R, B2F-B2R(표 5 참조) 및 표 6의 조건으로 PCR을 수행하였으며(각 프라이머 세트는 약 1.4kb의 단편을 증폭한다), 이 결과는 도 6에 나타내었다. The purified PTP was compared with Prime Taq, a Taq DNA polymerase purified in E. coli, and PCR activity was confirmed (each enzyme was used in units of 1 unit). For this purpose, genomic DNA of Bacillus strain (Bacillus genomic DNA) was used as a template for amplification, primers B1F-B1R, B2F-B2R (see Table 5) and primers B1F-B1R 6 (each primer set amplifies a fragment of about 1.4 kb), and the result is shown in FIG.

PrimerPrimer Sequence(5'-3')Sequence (5'-3 ') B1FB1F AGA GTT TGA TCM TGG CTC AGAGT GTT TGA TCM TGG CTC AG B1RB1R CGG TTA CCT TGT TAC GAC TTCGG TTA CCT TGT TAC GAC TT B2FB2F AGA GTT TGA TCC TGG CTC AGAGT GTT TGA TCC TGG CTC AG B2RB2R CGG TTA CCT TGT TAC GAC TTCGG TTA CCT TGT TAC GAC TT

TemperatureTemperature TimeTime CycleCycle 95℃95 ℃ 5 min5 min 1One 95℃95 ℃ 30 sec30 sec
30
30 57℃57 ℃ 30 sec30 sec 72℃72 ℃ 1 min1 min 72℃72 ℃ 7 min7 min 1One 12℃12 ° C ∞∞ 1One

도 6을 참고하면, 레인(Lane) 1, 3, 5, 7, 9, 11, 13, 15는 프라이머 B1F-B1R을 사용하였고, 레인 2, 4, 6, 8, 10, 12, 14, 16은 프라이머 B2F-B2R을 사용한 것으로, 증폭된 밴드를 각각 비교하였을 때, 대장균(E.coli)에서 생산된 Taq DNA 중합효소인 프라임 Taq과 효모(피키아 파스토리스)에서 생산된 Taq DNA 중합효소인 본 발명의 PTP의 활성은 별다른 차이점이 없는 것으로 확인된다. 6, lanes 1, 3, 5, 7, 9, 11, 13 and 15 used primers B1F-B1R and lanes 2, 4, 6, 8, 10, 12, 14 and 16 The primers B2F-B2R were used. When the amplified bands were compared, the primers Taq DNA polymerase produced from E. coli and Taq DNA polymerase produced from yeast (picapastitor) The activity of the PTP of the present invention is confirmed to have no significant difference.

<< 실시예Example 6. 비특이적 핵산 혼입의 검사> 6. Testing for nonspecific nucleic acid contamination>

통상적으로 PCR 반응시 20~35사이클을 수행하게 되지만, 미량의 DNA 오염 여부를 확인하기 위하여 PCR 반응을 30~50 사이클씩 수행하였다. 이를 위해 실시예 5에서 정제된 PTP를 기존의 대장균에서 발현되어 정제된 Taq DNA 중합효소인 프라임 Taq(Prime Taq), 박테리아(bacteria)의 16s RNA 유전자를 증폭시킬 수 있는 프라이머 B1F-B1R, Bac1F-Bac1R(표 7 참조)를 이용하여 표 8의 조건으로 PCR을 수행하였으며, 이에 대한 결과는 도 7에 나타내었다. Generally, 20-35 cycles are performed during the PCR reaction. However, in order to confirm whether a trace amount of DNA is contaminated, the PCR reaction is performed for 30-50 cycles. For this, primer B1F-B1R, Bac1F-B1R which can amplify primer Taq (Prime Taq), purified 16s RNA gene of Taq DNA polymerase expressed and purified in existing E. coli, PCR was performed under the conditions shown in Table 8 using Bac1R (see Table 7). The results are shown in FIG.

PrimerPrimer Sequence(5'-3')Sequence (5'-3 ') B1FB1F AGA GTT TGA TCM TGG CTC AGAGT GTT TGA TCM TGG CTC AG B1RB1R CGG TTA CCT TGT TAC GAC TTCGG TTA CCT TGT TAC GAC TT Bac1FBac1F TTA AGT CCC GCA ACG AGC GCA ATTA AGT CCC GCA ACG AGC GCAA Bac1FBac1F CCA TTG TAG CAC GTG TGT AGC CCCCA TTG TAG CAC GTG TGT AGC CC

TemperatureTemperature TimeTime CycleCycle 95℃95 ℃ 5 min5 min 1One 95℃95 ℃ 30 sec30 sec
30
30 57℃57 ℃ 30 sec30 sec 72℃72 ℃ 1 min1 min 72℃72 ℃ 7 min7 min 1One 12℃12 ° C ∞∞ 1One

도 7을 참고하면, 프라임 Taq(Prime Taq)을 사용한 PCR 반응물에서는 30 사이클부터 16s RNA 유전자가 증폭됨으로써, 박테리아 유래의 DNA(E. coli의 DNA)의 혼입이 있음을 확인할 수 있는데, PTP를 사용한 PCR 반응물에서는 16s RNA 유전자가 전혀 증폭되지 않음을 알 수 있다. 따라서, 본 발명의 방법으로 제조된 PTP에는 프라임 Taq과 달리 박테리아 유래의 DNA의 혼입이 없는 것으로 확인된다. 한편, 도 7의 레인(Lane) 1, 3, 5, 7, 9, 11는 프라이머 B1F-B1R을 사용하였고, 레인 2, 4, 6, 8, 10, 12은 프라이머 Bac1F-Bac1R을 사용하였으며, 프라이머 B1F-B1R 사용시, 1.4kb의 밴드가 확인되며, 프라이머 Bac1F-Bac1R 사용시 180bp의 밴드가 확인된다.
Referring to FIG. 7, PCR reaction using Prime Taq (Prime Taq) amplifies the RNA gene from 30 cycles to 16s, thereby confirming the incorporation of bacteria-derived DNA ( E. coli DNA) In the PCR reaction, the 16s RNA gene was not amplified at all. Therefore, it is confirmed that the PTP prepared by the method of the present invention does not contain the DNA of bacterial origin unlike the prime Taq. 7, lanes 1, 3, 5, 7, 9 and 11 used primers B1F-B1R and lanes 2, 4, 6, 8, 10 and 12 used primers Bac1F-Bac1R, When using primer B1F-B1R, a band of 1.4 kb is confirmed, and when using primer Bac1F-Bac1R, a band of 180 bp is confirmed.

<110> Genet Bio Co. <120> Novel method for preparing Taq DNA polymerase <130> 01-01 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 2517 <212> DNA <213> Artificial Sequence <220> <223> Pichia Taq DNA polymerase sequence <400> 1 atgaggggta tgttaccact gtttgaacct aagggtaggg ttcttctagt agatggacat 60 catttggctt atagaacctt tcatgctctg aaggggttaa caactagtag aggtgagcca 120 gttcaggccg tatatggttt tgctaaatct ttacttaaag ctttgaagga ggacggcgat 180 gccgtaatag tagtctttga cgctaaggct ccttccttca gacatgaagc atatggtggc 240 tataaagctg gaagagcccc tacccctgag gacttccctc gtcaattggc cctgatcaaa 300 gaactagtcg acttattggg gcttgctaga ctagaagtgc caggctatga ggccgatgat 360 gtattggcat ccttggctaa aaaggctgag aaagaaggct atgaggtaag gattctaacc 420 gctgataaag atttatatca actgttgtcc gatcgaattc acgctcttca cccagaggga 480 tacctaataa cccctgcttg gctgtgggaa aagtatggct tgaggcctga tcagtgggcc 540 gattatcgag ctctgaccgg tgacgaatct gataatttgc ctggagttaa gggtattggg 600 gaaaagacag ctagaaaact gcttgaagaa tggggttctt tagaagctct gctaaagaac 660 ttagacagat tgaaaccagc aatacgtgaa aaaattctgg cacacatgga cgatctgaaa 720 ctttcttggg atttagcaaa agttagaaca gacttgccat tagaagtaga ttttgccaag 780 agaagagaac cagatcgaga acgtctgaga gctttcttgg aaagattgga atttggtagt 840 cttttacacg aattcggttt gttggaatcc ccaaaggcat tggaggaagc cccatggcca 900 ccaccagagg gcgcattcgt tggttttgtt ctttcacgta aggaacctat gtgggcagac 960 cttctggcct tggctgccgc cagaggtggg agggtacaca gagctcctga accatacaaa 1020 gctttaaggg atttgaaaga agctagggga ttgttagcta aagacctgtc agttctggcc 1080 ctaagagaag gtctaggtct accaccaggc gatgatccta tgcttttagc ctacttactt 1140 gatccttcta acacaactcc agagggagtt gccagacgat acggaggtga atggactgag 1200 gaggctggtg aacgagccgc tttgtcagaa cgactatttg ctaatttatg gggtcgattg 1260 gaaggagagg aaagattatt atggctatat cgtgaggtcg aaagaccatt atccgctgtt 1320 ttggcccata tggaggccac cggagtacgt ttggacgtag cttatcttag agcactttct 1380 ctggaagttg ctgaggaaat tgctagattg gaggccgagg tgttccgttt agctggtcac 1440 ccatttaatt taaattctag agatcaattg gagagggtat tgttcgacga gcttggacta 1500 ccagcaatcg gtaagacaga aaagacagga aagagatcta ccagtgctgc tgtgctagaa 1560 gccttgagag aggctcatcc tattgttgaa aagattttgc agtatcgtga gctaaccaaa 1620 ctgaaatcta cctacatcga tccattgcct gacttgattc atccaagaac cgggagactt 1680 cacaccagat ttaaccaaac tgctactgct acagggagat tgtccagttc agaccctaat 1740 cttcagaaca tccctgttcg tactccactg ggtcaaagga tcagaagagc tttcatcgcc 1800 gaagagggat ggcttttggt ggccttagat tattctcaaa ttgaattgcg tgttttggct 1860 catttaagtg gggatgaaaa cctaattaga gtttttcaag aaggcaggga cattcacact 1920 gaaacagctt cttggatgtt cggtgtccct agagaagctg ttgaccctct aatgcgtaga 1980 gctgccaaaa ccattaattt tggagtactg tacggcatgt ctgctcatcg attatctcaa 2040 gaattggcta ttccttatga ggaagcccag gccttcatcg aacgttattt ccagagtttc 2100 cctaaggtca gagcctggat tgagaagaca ctagaagaag gacgtaggag aggttacgtc 2160 gaaacactat tcggtagacg aaggtacgtt ccagacttgg aagctagagt aaagtctgtt 2220 agagaagctg ccgaaagaat ggccttcaac atgcctgttc aaggtacagc tgctgacctg 2280 atgaaattgg ctatggttaa gttgttccct agacttgagg aaatgggagc aaggatgtta 2340 ttgcaggtgc atgacgaatt ggtattggaa gctcctaaag aaagagccga ggccgttgct 2400 agactggcta aagaggtaat ggagggggta tatcctctgg ctgtaccatt ggaagtagaa 2460 gttggtatag gagaagactg gttgtcagct aaagaacatc atcatcatca tcattaa 2517 <210> 2 <211> 2499 <212> DNA <213> Thermus aquaticus gene for DNA polymerase <400> 2 atgaggggga tgctgcccct ctttgagccc aagggccggg tcctcctggt ggacggccac 60 cacctggcct accgcacctt ccacgccctg aagggcctca ccaccagccg gggggagccg 120 gtgcaggcgg tctacggctt cgccaagagc ctcctcaagg ccctcaagga ggacggggac 180 gcggtgatcg tggtctttga cgccaaggcc ccctccttcc gccacgaggc ctacgggggg 240 tacaaggcgg gccgggcccc cacgccggag gactttcccc ggcaactcgc cctcatcaag 300 gagctggtgg acctcctggg gctggcgcgc ctcgaggtcc cgggctacga ggcggacgac 360 gtcctggcca gcctggccaa gaaggcggaa aaggagggct acgaggtccg catcctcacc 420 gccgacaaag acctttacca gctcctttcc gaccgcatcc acgccctcca ccccgagggg 480 tacctcatca ccccggcctg gctttgggaa aagtacggcc tgaggcccga ccagtgggcc 540 gactaccggg ccctgaccgg ggacgagtcc gacaaccttc ccggggtcaa gggcatcggg 600 gagaagacgg cgaggaagct tctggaggag tgggggagcc tggaagccct cctcaagaac 660 ctggaccggc tgaagcccgc catccgggag aagatcctgg cccacatgga cgatctgaag 720 ctctcctggg acctggccaa ggtgcgcacc gacctgcccc tggaggtgga cttcgccaaa 780 aggcgggagc ccgaccggga gaggcttagg gcctttctgg agaggcttga gtttggcagc 840 ctcctccacg agttcggcct tctggaaagc cccaaggccc tggaggaggc cccctggccc 900 ccgccggaag gggccttcgt gggctttgtg ctttcccgca aggagcccat gtgggccgat 960 cttctggccc tggccgccgc cagggggggc cgggtccacc gggcccccga gccttataaa 1020 gccctcaggg acctgaagga ggcgcggggg cttctcgcca aagacctgag cgttctggcc 1080 ctgagggaag gccttggcct cccgcccggc gacgacccca tgctcctcgc ctacctcctg 1140 gacccttcca acaccacccc cgagggggtg gcccggcgct acggcgggga gtggacggag 1200 gaggcggggg agcgggccgc cctttccgag aggctcttcg ccaacctgtg ggggaggctt 1260 gagggggagg agaggctcct ttggctttac cgggaggtgg agaggcccct ttccgctgtc 1320 ctggcccaca tggaggccac gggggtgcgc ctggacgtgg cctatctcag ggccttgtcc 1380 ctggaggtgg ccgaggagat cgcccgcctc gaggccgagg tcttccgcct ggccggccac 1440 cccttcaacc tcaactcccg ggaccagctg gaaagggtcc tctttgacga gctagggctt 1500 cccgccatcg gcaagacgga gaagaccggc aagcgctcca ccagcgccgc cgtcctggag 1560 gccctccgcg aggcccaccc catcgtggag aagatcctgc agtaccggga gctcaccaag 1620 ctgaagagca cctacattga ccccttgccg gacctcatcc accccaggac gggccgcctc 1680 cacacccgct tcaaccagac ggccacggcc acgggcaggc taagtagctc cgatcccaac 1740 ctccagaaca tccccgtccg caccccgctt gggcagagga tccgccgggc cttcatcgcc 1800 gaggaggggt ggctattggt ggccctggac tatagccaga tagagctcag ggtgctggcc 1860 cacctctccg gcgacgagaa cctgatccgg gtcttccagg aggggcggga catccacacg 1920 gagaccgcca gctggatgtt cggcgtcccc cgggaggccg tggaccccct gatgcgccgg 1980 gcggccaaga ccatcaactt cggggtcctc tacggcatgt cggcccaccg cctctcccag 2040 gagctagcca tcccttacga ggaggcccag gccttcattg agcgctactt tcagagcttc 2100 cccaaggtgc gggcctggat tgagaagacc ctggaggagg gcaggaggcg ggggtacgtg 2160 gagaccctct tcggccgccg ccgctacgtg ccagacctag aggcccgggt gaagagcgtg 2220 cgggaggcgg ccgagcgcat ggccttcaac atgcccgtcc agggcaccgc cgccgacctc 2280 atgaagctgg ctatggtgaa gctcttcccc aggctggagg aaatgggggc caggatgctc 2340 cttcaggtcc acgacgagct ggtcctcgag gccccaaaag agagggcgga ggccgtggcc 2400 cggctggcca aggaggtcat ggagggggtg tatcccctgg ccgtgcccct ggaggtggag 2460 gtggggatag gggaggactg gctctccgcc aaggagtga 2499 <110> Genet Bio Co. <120> Novel method for preparing Taq DNA polymerase <130> 01-01 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 2517 <212> DNA <213> Artificial Sequence <220> <223> Pichia Taq DNA polymerase sequence <400> 1 atgaggggta tgttaccact gtttgaacct aagggtaggg ttcttctagt agatggacat 60 catttggctt atagaacctt tcatgctctg aaggggttaa caactagtag aggtgagcca 120 gttcaggccg tatatggttt tgctaaatct ttacttaaag ctttgaagga ggacggcgat 180 gccgtaatag tagtctttga cgctaaggct ccttccttca gacatgaagc atatggtggc 240 tataaagctg gaagagcccc tacccctgag gacttccctc gtcaattggc cctgatcaaa 300 gaactagtcg acttattggg gcttgctaga ctagaagtgc caggctatga ggccgatgat 360 gtattggcat ccttggctaa aaaggctgag aaagaaggct atgaggtaag gattctaacc 420 gctgataaag atttatatca actgttgtcc gatcgaattc acgctcttca cccagaggga 480 tacctaataa cccctgcttg gctgtgggaa aagtatggct tgaggcctga tcagtgggcc 540 gattatcgag ctctgaccgg tgacgaatct gataatttgc ctggagttaa gggtattggg 600 gaaaagacag ctagaaaact gcttgaagaa tggggttctt tagaagctct gctaaagaac 660 ttagacagat tgaaaccagc aatacgtgaa aaaattctgg cacacatgga cgatctgaaa 720 ctttcttggg atttagcaaa agttagaaca gacttgccat tagaagtaga ttttgccaag 780 agaagagaac cagatcgaga acgtctgaga gctttcttgg aaagattgga atttggtagt 840 cttttacacg aattcggttt gttggaatcc ccaaaggcat tggaggaagc cccatggcca 900 ccaccagagg gcgcattcgt tggttttgtt ctttcacgta aggaacctat gtgggcagac 960 cttctggcct tggctgccgc cagaggtggg agggtacaca gagctcctga accatacaaa 1020 gctttaaggg atttgaaaga agctagggga ttgttagcta aagacctgtc agttctggcc 1080 ctaagagaag gtctaggtct accaccaggc gatgatccta tgcttttagc ctacttactt 1140 gatccttcta acacaactcc agagggagtt gccagacgat acggaggtga atggactgag 1200 gaggctggtg aacgagccgc tttgtcagaa cgactatttg ctaatttatg gggtcgattg 1260 gaaggagagg aaagattatt atggctatat cgtgaggtcg aaagaccatt atccgctgtt 1320 ttggcccata tggaggccac cggagtacgt ttggacgtag cttatcttag agcactttct 1380 ctggaagttg ctgaggaaat tgctagattg gaggccgagg tgttccgttt agctggtcac 1440 ccatttaatt taaattctag agatcaattg gagagggtat tgttcgacga gcttggacta 1500 ccagcaatcg gtaagacaga aaagacagga aagagatcta ccagtgctgc tgtgctagaa 1560 gccttgagag aggctcatcc tattgttgaa aagattttgc agtatcgtga gctaaccaaa 1620 ctgaaatcta cctacatcga tccattgcct gacttgattc atccaagaac cgggagactt 1680 cacaccagat ttaaccaaac tgctactgct acagggagat tgtccagttc agaccctaat 1740 cttcagaaca tccctgttcg tactccactg ggtcaaagga tcagaagagc tttcatcgcc 1800 gaagagggat ggcttttggt ggccttagat tattctcaaa ttgaattgcg tgttttggct 1860 catttaagtg gggatgaaaa cctaattaga gtttttcaag aaggcaggga cattcacact 1920 gaaacagctt cttggatgtt cggtgtccct agagaagctg ttgaccctct aatgcgtaga 1980 gctgccaaaa ccattaattt tggagtactg tacggcatgt ctgctcatcg attatctcaa 2040 gaattggcta ttccttatga ggaagcccag gccttcatcg aacgttattt ccagagtttc 2100 cctaaggtca gagcctggat tgagaagaca ctagaagaag gacgtaggag aggttacgtc 2160 gaaacactat tcggtagacg aaggtacgtt ccagacttgg aagctagagt aaagtctgtt 2220 agagaagctg ccgaaagaat ggccttcaac atgcctgttc aaggtacagc tgctgacctg 2280 atgaaattgg ctatggttaa gttgttccct agacttgagg aaatgggagc aaggatgtta 2340 ttgcaggtgc atgacgaatt ggtattggaa gctcctaaag aaagagccga ggccgttgct 2400 agactggcta aagaggtaat ggagggggta tatcctctgg ctgtaccatt ggaagtagaa 2460 gttggtatag gagaagactg gttgtcagct aaagaacatc atcatcatca tcattaa 2517 <210> 2 <211> 2499 <212> DNA <213> Thermus aquaticus gene for DNA polymerase <400> 2 atgaggggga tgctgcccct ctttgagccc aagggccggg tcctcctggt ggacggccac 60 cacctggcct accgcacctt ccacgccctg aagggcctca ccaccagccg gggggagccg 120 gtgcaggcgg tctacggctt cgccaagagc ctcctcaagg ccctcaagga ggacggggac 180 gcggtgatcg tggtctttga cgccaaggcc ccctccttcc gccacgaggc ctacgggggg 240 tacaaggcgg gccgggcccc cacgccggag gactttcccc ggcaactcgc cctcatcaag 300 gagctggtgg acctcctggg gctggcgcgc ctcgaggtcc cgggctacga ggcggacgac 360 gtcctggcca gcctggccaa gaaggcggaa aaggagggct acgaggtccg catcctcacc 420 gccgacaaag acctttacca gctcctttcc gaccgcatcc acgccctcca ccccgagggg 480 tacctcatca ccccggcctg gctttgggaa aagtacggcc tgaggcccga ccagtgggcc 540 gactaccggg ccctgaccgg ggacgagtcc gacaaccttc ccggggtcaa gggcatcggg 600 gagaagacgg cgaggaagct tctggaggag tgggggagcc tggaagccct cctcaagaac 660 ctggaccggc tgaagcccgc catccgggag aagatcctgg cccacatgga cgatctgaag 720 ctctcctggg acctggccaa ggtgcgcacc gacctgcccc tggaggtgga cttcgccaaa 780 aggcgggagc ccgaccggga gaggcttagg gcctttctgg agaggcttga gtttggcagc 840 ctcctccacg agttcggcct tctggaaagc cccaaggccc tggaggaggc cccctggccc 900 ccgccggaag gggccttcgt gggctttgtg ctttcccgca aggagcccat gtgggccgat 960 cttctggccc tggccgccgc cagggggggc cgggtccacc gggcccccga gccttataaa 1020 gccctcaggg acctgaagga ggcgcggggg cttctcgcca aagacctgag cgttctggcc 1080 ctgagggaag gccttggcct cccgcccggc gacgacccca tgctcctcgc ctacctcctg 1140 gacccttcca acaccacccc cgagggggtg gcccggcgct acggcgggga gtggacggag 1200 gaggcggggg agcgggccgc cctttccgag aggctcttcg ccaacctgtg ggggaggctt 1260 gagggggagg agaggctcct ttggctttac cgggaggtgg agaggcccct ttccgctgtc 1320 ctggcccaca tggaggccac gggggtgcgc ctggacgtgg cctatctcag ggccttgtcc 1380 ctggaggtgg ccgaggagat cgcccgcctc gaggccgagg tcttccgcct ggccggccac 1440 cccttcaacc tcaactcccg ggaccagctg gaaagggtcc tctttgacga gctagggctt 1500 cccgccatcg gcaagacgga gaagaccggc aagcgctcca ccagcgccgc cgtcctggag 1560 gccctccgcg aggcccaccc catcgtggag aagatcctgc agtaccggga gctcaccaag 1620 ctgaagagca cctacattga ccccttgccg gacctcatcc accccaggac gggccgcctc 1680 cacacccgct tcaaccagac ggccacggcc acgggcaggc taagtagctc cgatcccaac 1740 ctccagaaca tccccgtccg caccccgctt gggcagagga tccgccgggc cttcatcgcc 1800 gaggaggggt ggctattggt ggccctggac tatagccaga tagagctcag ggtgctggcc 1860 cacctctccg gcgacgagaa cctgatccgg gtcttccagg aggggcggga catccacacg 1920 gagaccgcca gctggatgtt cggcgtcccc cgggaggccg tggaccccct gatgcgccgg 1980 gcggccaaga ccatcaactt cggggtcctc tacggcatgt cggcccaccg cctctcccag 2040 gagctagcca tcccttacga ggaggcccag gccttcattg agcgctactt tcagagcttc 2100 cccaaggtgc gggcctggat tgagaagacc ctggaggagg gcaggaggcg ggggtacgtg 2160 gagaccctct tcggccgccg ccgctacgtg ccagacctag aggcccgggt gaagagcgtg 2220 cgggaggcgg ccgagcgcat ggccttcaac atgcccgtcc agggcaccgc cgccgacctc 2280 atgaagctgg ctatggtgaa gctcttcccc aggctggagg aaatgggggc caggatgctc 2340 cttcaggtcc acgacgagct ggtcctcgag gccccaaaag agagggcgga ggccgtggcc 2400 cggctggcca aggaggtcat ggagggggtg tatcccctgg ccgtgcccct ggaggtggag 2460 gtggggatag gggaggactg gctctccgcc aaggagtga 2499

Claims (7)

(1공정) 서열번호 1의 Taq DNA 중합효소의 염기서열을 포함하는 pPIC9 벡터를 제조하는 단계;
(2공정) 상기 1공정의 서열번호 1의 Taq DNA 중합효소의 염기서열을 포함하는 pPIC9 벡터를 피키아 파스토리스(Pichia pastoris)의 게놈 DNA인 알코올 산화효소 1 프로모터(alcohol oxidase 1 promoter, AOX1 promoter)에 삽입하여 형질전환된 피키아 파스토리스를 제조하는 단계;
(3공정) 상기 2공정의 형질전환된 피키아 파스토리스를 메탄올이 함유된 배지에서 배양하여 Taq DNA 중합효소가 분비된 배양액을 얻는 단계; 및,
(4공정) 상기 3공정의 배양액을 70~90℃로 열처리한 후 정제하여 Taq DNA 중합효소를 수득하는 단계;
를 포함하는 것을 특징으로 하는 Taq DNA 중합효소의 제조 방법.(1) preparing a pPIC9 vector comprising the base sequence of the Taq DNA polymerase of SEQ ID NO: 1;
(Step 2) The pPIC9 vector containing the nucleotide sequence of the Taq DNA polymerase of SEQ ID NO: 1 in the above step was amplified by the alcohol oxidase 1 promoter (AOX1 promoter), which is the genomic DNA of Pichia pastoris ) To prepare a transformed Pichia pastoris;
(Step 3) The transformed Pichia pastoris in the above two steps is cultured in a medium containing methanol to obtain a culture medium in which Taq DNA polymerase is secreted; And
(Step 4) Heat-treating the culture solution of the above three steps at 70 to 90 占 폚, followed by purification to obtain Taq DNA polymerase;
&Lt; / RTI &gt; wherein the Taq DNA polymerase is a DNA polymerase. 제1항에 있어서,
상기 1공정에서, 상기 pPIC9 벡터는 분비 시그널(MFα signal) 및 His4 유전자(histidinol dehydrogenase gene)를 포함하는 것을 특징으로 하는 Taq DNA 중합효소의 제조 방법.The method according to claim 1,
Wherein the pPIC9 vector comprises a secretory signal (MFa signal) and a His4 gene (histidinol dehydrogenase gene). 삭제delete 제1항에 있어서,
상기 2공정의 피키아 파스토리스는 His4 유전자(histidinol dehydrogenase gene)에 대한 영양요구성 돌연변이종(auxotrophic strain)인 것을 특징으로 하는 Taq DNA 중합효소의 제조 방법. The method according to claim 1,
Wherein the Pichia pastoris in the two steps is an auxotrophic strain for the histinol dehydrogenase gene. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt; 제4항에 있어서,
상기 피키아 파스토리스는 피키아 파스토리스 GS115인 것을 특징으로 하는 Taq DNA 중합효소의 제조 방법. 5. The method of claim 4,
Wherein the Pichia pastoris is Pichia pastoris GS115. 제1항에 있어서,
상기 4공정에서 열처리된 배양액의 정제는 히스티딘 단백질에 대한 친화성 크로마토그래피를 이용하여 수행하는 것을 특징으로 하는 Taq DNA 중합효소의 제조 방법. The method according to claim 1,
Wherein the purification of the culture solution heat-treated in the above step 4 is carried out using an affinity chromatography for a histidine protein. 제1항, 제2항, 제4항 내지 제6항 중의 어느 한 항에 따른 방법으로 제조한 Taq DNA 중합효소를 이용하여 검체 중의 검출 대상 오염원 생물을 검출하는 방법.
A method for detecting a contaminant organism to be detected in a sample using a Taq DNA polymerase produced by the method according to any one of claims 1, 2, and 4 to 6.
KR1020140160764A 2014-11-18 2014-11-18 Novel method for preparing Taq DNA polymerase KR101546358B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020140160764A KR101546358B1 (en) 2014-11-18 2014-11-18 Novel method for preparing Taq DNA polymerase

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140160764A KR101546358B1 (en) 2014-11-18 2014-11-18 Novel method for preparing Taq DNA polymerase

Publications (1)

Publication Number Publication Date
KR101546358B1 true KR101546358B1 (en) 2015-08-24

Family

ID=54061655

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140160764A KR101546358B1 (en) 2014-11-18 2014-11-18 Novel method for preparing Taq DNA polymerase

Country Status (1)

Country Link
KR (1) KR101546358B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024101755A1 (en) * 2022-11-10 2024-05-16 Seegene, Inc. Method for preparing taq dna polymerase in pichia pastoris

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024101755A1 (en) * 2022-11-10 2024-05-16 Seegene, Inc. Method for preparing taq dna polymerase in pichia pastoris

Similar Documents

Publication Publication Date Title
KR102339365B1 (en) Chimeric genome engineering molecules and methods
KR102647766B1 (en) Class II, type V CRISPR systems
CN110592089B (en) Composition for cleaving target DNA and use thereof
EP2388322B1 (en) Enzymatic preparation containing thermostable dna polymerase, process for producing same, and method for detecting analyte organism
CN106687594A (en) Compositions and methods for producing plants resistant to glyphosate herbicide
CN108070577B (en) Antiserum interference TaqDNA polymerase and preparation and application thereof
CN113831395B (en) Recombinant antibacterial peptide Trsub, preparation method and application thereof
CN104245928A (en) Endonucleases
CN110923217B (en) Ribonuclease R capable of recognizing 2&#39; -O-methylation modified RNA and application thereof
CN115896064A (en) High-temperature-resistant Bst DNA polymerase, and preparation method and application thereof
CN105087759B (en) Identify copy number of target genes and the method for screening low-copy plant in genetically modified plants
KR101546358B1 (en) Novel method for preparing Taq DNA polymerase
CN110818784B (en) Application of rice gene OsATL15 in regulation of absorption and transportation of pesticides
CN104312992B (en) Method for simply and quickly extracting and purifying Taq-DNA polymerase
WO2011055737A1 (en) Thermostable strand displacement dna polymerase and method for producing the dna polymerase
CN114774399B (en) Method for artificially modifying single-base resolution positioning analysis of 5-hydroxymethylcytosine modification in deaminase-assisted DNA
CN116064462A (en) Taq DNA polymerase mutant and preparation method thereof
CN113355334B (en) Corn salt-tolerant gene and application thereof
CN116507728A (en) Leghemoglobin in soybeans
NZ530780A (en) Nucleic acid free ghost preparations
CN111154799A (en) Application of TaDSK2a protein in regulation and control of stripe rust resistance of wheat
CN115261351B (en) Reverse transcription-polymerization bifunctional enzyme and preparation method and application thereof
JP2013165669A (en) Variant reverse transcriptase
CN115261353B (en) DNA polymerase with adjustable pyrophosphorylase activity and preparation method thereof
CN115896048B (en) Recombinant human Cu, zn-SOD with high enzyme activity and good stability, and preparation method and application thereof

Legal Events

Date Code Title Description
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180814

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20190527

Year of fee payment: 5