CN111057788B

CN111057788B - LAMP primer group for detecting pseudo-ginseng rust rot and detection method

Info

Publication number: CN111057788B
Application number: CN202010106050.3A
Authority: CN
Inventors: 兰成忠; 林雄; 代玉立; 姚凤銮
Original assignee: Institute of Plant Protection of FAAS
Current assignee: Institute of Plant Protection of FAAS
Priority date: 2020-02-21
Filing date: 2020-02-21
Publication date: 2022-10-14
Anticipated expiration: 2040-02-21
Also published as: CN111057788A

Abstract

The invention provides LAMP detection primers and detection method for pseudo-ginseng rust rot fungi, which are used for detecting pseudo-ginseng rust rot fungiβ‑tubulinThe gene is a detection target, 4 LAMP specific primers are designed, and the method comprises the following steps: f3, B3, FIP and BIP; the sequence is shown in SEQ ID NO. 1-4. The invention solves the defects of long detection period, low sensitivity, low specificity, complex operation, high requirements on instruments and equipment and the like in the prior art, provides the LAMP rapid and accurate detection technology with strong specificity, high sensitivity, simple and convenient operation, low requirements on environmental equipment and low cost, is particularly suitable for rapidly detecting field samples of the rust rot of panax notoginseng, and provides a method for diagnosing and controlling the rust rot of panax notoginseng.

Description

LAMP primer group for detecting panax notoginseng rust rot and detection method

Technical Field

The invention belongs to the technical field of crop disease detection, identification and prevention, and particularly relates to an LAMP primer group for detecting panax notoginseng rust rot and a detection method, which can be used for rapid, sensitive and specific molecular detection of panax notoginseng rust rot, and can be used for early diagnosis of panax notoginseng rust rot and monitoring and identification of pathogenic bacteria.

Background

Notoginseng [Panax notoginseng(Burk.) F H Chen is also called pseudo-ginseng, radix Stephaniae Sinicae, reputed to the name of "south China Shencao", is a famous and precious Chinese medicinal material of perennial roots of Panax of Araliaceae, and has the effects of promoting blood circulation, removing blood stasis, relieving swelling and pain, resisting inflammation, resisting oxidation, resisting aging and the like. Pseudo-ginseng is cultivated in large area in provinces (regions) such as Yunnan province and Guangxi province after hundreds of years of artificial domestication and planting. Due to long-term large-scale single and continuous planting, the panax notoginseng prefers to be in a warm winter and cool summer, semi-yin and humid ecological environment and is not resistant to severe cold and vinegar heat, and various diseases of the panax notoginseng are often caused and popularized due to the particularity of the growing environment of the panax notoginseng. The research shows that the main diseases of the underground part and the stem base part of the pseudo-ginseng include damping off, epidemic disease, root rot and the like. WhereinFrom the species of Bacillus cereus (Cylindrocarpon destructans) The rust rot caused by the pseudo-ginseng is one of the root rot with the largest morbidity and harm, the annual morbidity is between 20 and 30 percent, and the annual morbidity is up to 70 percent in serious cases. Diseases of underground parts of pseudo-ginseng can be found by people in advance and are difficult to control, and can be found only when leaves are found to be discolored, so that the diseases of the underground parts of pseudo-ginseng become the most serious diseases of the current pseudo-ginseng and are also important problems influencing the healthy and sustainable development of the industrialization of the pseudo-ginseng. Therefore, the development of prevention and control of rust rot of panax notoginseng is of great significance for panax notoginseng production.

The accurate identification and detection of pathogenic bacteria are the early basis for effective prevention and control of diseases, the traditional identification and detection of pathogenic bacteria mainly depend on the conventional morphology and are combined with the traditional method for identifying hosts, and the flow is usually as follows: separating or directly obtaining pathogenic bacteria from pathogenic tissues, primarily identifying the pathogenic bacteria by morphological characteristics, inoculating the obtained pathogenic bacteria to the original host plant, separating the pathogenic bacteria from the host pathogenic tissues again after the host is diseased, and determining the pathogenic bacteria if the pathogenic bacteria is consistent with the original pathogenic bacteria. The identification by using the morphological method is time-consuming and labor-consuming, and needs to have professional taxonomy knowledge and rich experience, so that the requirements of rapid and accurate identification and diagnosis of diseases cannot be met. With the development of molecular biology technology, conventional PCR, nested PCR, real-time fluorescence quantitative PCR and other DNA in vitro PCR amplification technologies are successfully applied to accurate identification and rapid detection of plant pathogenic bacteria. Although the accuracy of pathogen identification and the rapidity of detection are improved by the PCR technology, the problems that expensive instruments and equipment such as a precise PCR instrument and a gel imaging system are required, the operation is complicated, and certain molecular biology technology is required by operators exist, so that the application and popularization of the technology in underdeveloped areas and basic agricultural departments are greatly limited. Therefore, it is necessary to establish a new detection technology to realize the rapid and simple detection of the rust rot fungi of panax notoginseng.

Loop-mediated Isothermal Amplification (LAMP) technology is developed by Nippon Rongyan Co., ltdA cheap efficient nucleic acid amplification technology which can utilize high-activity strand displacement DNA polymerase (DNA polymerase) at a constant temperature of 60-65 DEG CBstDNA polymerase) to specifically amplify the target DNA fragment, and the result can be observed within 1 hour. The LAMP technology has the advantages of strong specificity, low equipment requirement, simple operation, high sensitivity, short reaction time and the like, and is widely applied to detection of various pathogenic bacteria. Until now, no related technical report that the LAMP technology is used for detecting the rust rot bacteria of the panax notoginseng exists.

Disclosure of Invention

The invention aims to solve the problems that in the prior art, the detection and identification of panax notoginseng rust rot fungi are mainly based on morphological characteristics, long time consumption, complicated procedures, strong experience, low accuracy, difficulty in timely monitoring disease occurrence and controlling the spread and prevalence of pathogenic bacteria, the existing PCR molecular detection needs expensive instruments such as an amplification instrument and the like, the detection time is long and the like, and provides a group of LAMP primers for detecting panax notoginseng rust rot fungi and an LAMP detection method with strong specificity, high sensitivity, easy operation and reliable result.

In order to realize the purpose of the invention, the following technical scheme is adopted, and the method comprises the following steps:

1. designing LAMP detection specific primers of panax notoginseng rust rot fungi: by determining the rust rot fungus of panax notoginseng and destroying the cylindrosporium (Cylindrocarpon destructans) And other pathogenic bacteriabeta-tubulin (β-tubulin) Gene sequence, interspecies species of fungus of genus Podosporaβ-tubulinThe gene sequences are compared and analyzed, an online LAMP Primer design software Primer software Explorer V5 (https:// Primer explorer.jp/lampv5/index. Html; eiken Chemical Co., japan) is used for designing a specific LAMP Primer group of the pseudo-ginseng rust rot fungi, which consists of F3, B3, FIP and BIP, and the Primer sequences are as follows:

F3：5’- AAAGCTCGGGACTTCAACC -3’，

B3：5’- TGCTCGCTAGAGATGGTCTG -3’，

FIP：5’- CTTACGCACTGGCCGGT CTG-TTTTGGGACAAGATGGCTGA -3’，

BIP：5’- CCTCTTCAACGATCCGA CGTGC-GCACCGATTTGGTTACCCTA -3’。

2. the establishment of the LAMP detection method for the pseudo-ginseng rust rot fungi comprises the following steps:

(1) And extracting the genome DNA of the sample to be detected.

When the method is used for detecting pure cultures of pathogenic bacteria, the CTAB method is adopted to extract genome DNA, and the specific method is as follows: taking a small amount of hyphal powder into a 1.5mL centrifuge tube (hyphal powder just covers the semicircular bottom), adding 900 μ L of 2% CTAB (cetyltrimethylammonium bromide) extract (2% CTAB;100 mmol/L Tris-HCl, pH8.0, 20 mmol/L EDTA, pH8.0;1.4 mol/L NaCl) and 90 μ L SDS (sodium dodecyl benzene sulfonate) [ note: CTAB, SDS requiring preheating at 60 deg.C, shaking and mixing well with oscillator, water bath at 60 deg.C for 1h (DNA released into buffer), 12000 r.min ^-1 Centrifuging for 15 min; taking 700 mu L of supernatant, adding equal volume of phenol, chloroform and isoamylol (25 ^-1 Centrifuging for 9 min; taking 500 mu L of supernatant, adding equal volume of chloroform for re-extraction once, 12000 r-min ^-1 Centrifuging for 5 min; taking 350 mu L of supernatant, adding 1/10 volume of 3 mol. L ^-1 NaAc and 2 times volume of absolute ethyl alcohol, precipitating for 30 min at-20 ℃,12000 r.min ^-1 Centrifuging for 5 min; discarding the supernatant, adding 700 mu L of ice and 70% ethanol for washing (slight centrifugation; pouring off the supernatant), airing on an ultra-clean bench without alcohol smell, adding 30 to 60 mu L of TE (10 mmol/L Tris-HCl,0.1 mmol/L EDTA, pH 8.0) solution for dissolving to obtain a DNA solution, and detecting the DNA concentration by using an ultraviolet spectrophotometer and diluting to 100 ng/mu L for later use.

When the method is used for detecting the existence of the pseudo-ginseng rust rot germs in the root tissues of plants, the DNA is extracted by adopting a NaOH rapid cracking method, and the specific process is as follows: adding 10 muL of 0.5 mol/L NaOH into each milligram of plant tissue, fully grinding the tissue into paste in a mortar, transferring the paste into a 1.5mL centrifuge tube, centrifuging at 12,000 rpm for 6 min, taking 5 muL of supernatant, adding 495 muL of 0.1 mol/L Tris-HCl (pH = 8.0), uniformly mixing, and taking 1.0 muL as a PCR template for amplification.

(2) Establishment of LAMP reaction system: taking the DNA extracted in the step (1) as a template, and utilizing an outer primer F3/B3 and an inner primerLAMP amplification is carried out on the substance FIP/BIP, the LAMP detection reaction system is 25 mu L, and comprises 5 mu M primers F3 and B3 which are respectively 1.0 mu L,40 mu M primers FIP and BIP which are respectively 1.0 mu L, and LAMP reaction mixed liquid (40 mM Tris-HCl,20 mM (NH) ₄ ) ₂ SO ₄ ，20 mM KCl，16 mM MgSO ₄ 1.6 mol/L Betaine (Betaine), 2.0 mM dNTPs,0.2wt.% Trion X-100) 12.5. Mu.L, 8UBstPolymerase 1.0 μ L, DNA template 1.0 μ L, make up to 25 μ L with sterilized ultrapure water;

(3) LAMP reaction conditions: 63. incubating at deg.C for 40 min;

(4) Determination of reaction results: by adopting a fluorescent dye visual observation method, after the LAMP reaction is finished, adding 1.0 mu L of color-developing agent SYBR green I into an amplification product of the LAMP reaction, observing green fluorescence in a color development result under normal illumination, judging the amplification product to be positive in a white turbid precipitation state under the irradiation of ultraviolet light with the wavelength of 365nm, namely, the amplification product has panax notoginseng rust rot germs, observing orange or orange in a color development result under normal illumination, and judging the amplification product to be negative in a colorless transparent state under the irradiation of the ultraviolet light with the wavelength of 365nm, namely, the amplification product does not have panax notoginseng rust rot germs.

The invention has the beneficial effects that: the invention establishes the LAMP detection technology system with the advantages of rapidness, convenience, strong specificity and high sensitivity for the panax notoginseng rust rot, can be used for detecting the panax notoginseng rust rot, or can be used for detecting the panax notoginseng rust rot at the early stage and the initial stage of the disease, and has very important significance for determining the optimal period of disease control.

Compared with the prior art, the invention has the following technical advantages and positive effects:

1. the specificity is strong: 4 specific primers can recognize 6 different regions of the sequence together, and any region in the 6 regions can not be subjected to nucleic acid amplification when being not matched with the primers, so that the specificity is extremely high;

2. the sensitivity is high: the detection sensitivity of the invention to the pseudo-ginseng rust rot pathogen can reach 10 fg/mu L on the DNA level, and the sensitivity is very high;

3. and (3) fast: the detection method can obtain the detection result within 1-1.5 h, while the previous PCR or nested PCR detection needs 4-6 h, thus greatly shortening the operation time and being convenient and quick;

4. the applicability is good: the LMAP amplification reaction is amplified at one temperature, an expensive PCR amplification instrument is not needed, only a simple water bath kettle or heating equipment is needed, and the popularization and the use of the basic level are facilitated;

5. the detection result is visual, can judge by naked eyes, and the degree of accuracy is high: the amplification product can be dyed by adding a color developing agent, is green under normal illumination, is judged to be positive when being in a white turbid precipitation state under 365nm ultraviolet light irradiation, namely, the sample to be detected contains panax notoginseng rust rot bacteria, is orange or orange under normal illumination, is judged to be negative when being colorless and transparent under 365nm ultraviolet light irradiation, and shows that the sample to be detected does not contain panax notoginseng rust rot bacteria, the detection result can be judged by naked eyes without electrophoresis detection and gel imaging, and the detection under two illumination conditions improves the accuracy of the detection result.

Drawings

FIG. 1 shows LAMP specific primers of rust rot of Panax notoginsengbeta-tubulin (β-tubulin) A site in the gene sequence.

FIG. 2 shows LAMP specificity detection of Panax notoginseng Burk-F.H.Chen. a is a detection result under normal (natural) illumination, and 1-2 is green; b is a detection result under the irradiation of ultraviolet light with the wavelength of 365nm, and 1-2 is in a white turbid precipitate state. In the figure, 1-2 is pseudo-ginseng rust rot bacteria: (Cylindrocarpon destructans) 3-7 are respectively DolomycetesC. didymium) Blunt pillar sporeC.obtusisporum）、Yulianzhua (Yulianzhua)C. victoriae）、Columbia (B) in ColumbiaC. vaginae）、Notoginseng radix Pityrosporum ovale (A. Merr.) (B. Merr.) (Alternaria panax) And 8 is a negative control.

FIG. 3 shows LAMP detection sensitivity of rust rot of Panax notoginseng. a is a detection result under normal (natural) illumination, and 1-5 are green; b is a detection result under the irradiation of ultraviolet light with the wavelength of 365nm, and 1-5 are in a white turbid precipitate state. In the figure, the concentrations of 1-7 template DNAs were 100pg, 10 pg, 1 pg, 100 fg, 10fg, 1 fg, and 100ag, respectively, and 8 was used as a negative control.

FIG. 4 is a diagram of the detection of the pseudo-ginseng rust rot in the diseased root pieces by the detection method of the present invention. a is a detection result under normal (natural) illumination, and 1, 4-5 and 7-8 are green; b is a detection result under the irradiation of ultraviolet light with the wavelength of 365nm, and 1, 4-5 and 7-8 are white turbid precipitates. In the figure, 1 is a positive control, 2 is a negative control, 3 and 6 are healthy pseudo-ginseng root blocks, and 4 to 5 and 7 to 8 are pseudo-ginseng rust rot disease-causing root blocks.

Detailed Description

The present invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The following examples are carried out according to the usual experimental conditions, or according to the protocols described in the published relevant literature, or according to the experimental conditions recommended by the manufacturer.

Example 1: design of specific primers for detecting panax notoginseng rust rot fungi by loop-mediated isothermal amplification (LAMP) and primer specificity verification

1. Extraction of genomic DNA of test strains

The CTAB method is adopted to extract the genome DNA of the test strain (table 1), and the specific method is as follows: a small amount of hyphal powder was taken into a 1.5mL centrifuge tube (hyphal powder covered just over the semi-circular bottom), 900 μ L2% CTAB (cetyltrimethylammonium bromide) extract (2% CTAB;100 mmol/L Tris-HCl, pH8.0, 20 mmol/L EDTA, pH8.0;1.4 mol/L NaCl) and 90 μ L SDS (sodium dodecyl benzene sulfonate) [ note: CTAB, SDS requiring preheating at 60 deg.C, shaking and mixing well with oscillator, water bath at 60 deg.C for 1h (DNA released into buffer), 12000 r.min ^-1 Centrifuging for 15 min; taking 700 mu L of supernatant, adding equal volume of phenol, chloroform and isoamylol (25 ^-1 Centrifuging for 9 min; taking 500 mu L of supernatant, adding chloroform with the same volume and extracting once again, wherein the temperature is 12000 r.min ^-1 Centrifuging for 5 min; taking 350 mu L of supernatant, adding 1/10 volume of 3 mol. L ^-1 NaAc and 2 times volume of absolute ethyl alcohol are precipitated for 30 min at the temperature of minus 20 ℃ ^-1 Centrifuging for 5 min; discarding the supernatant, adding 700 muL of ice 70% ethanol for washing (slight centrifugation; pouring off the supernatant), airing on an ultra-clean workbench without alcohol smell, and adding 30 to 60 muL of TE (10 mmol/L Tris)Dissolving HCl,0.1 mmol/L EDTA, pH 8.0) solution to obtain DNA solution, and detecting the DNA concentration by using an ultraviolet spectrophotometer and diluting to 100 ng/mu L for later use.

TABLE 1 test strains

2. Design of loop-mediated isothermal amplification (LAMP) specific primers for panax notoginseng rust rot fungi

By determining the rust rot fungus of panax notoginseng and destroying the cylindrosporium (Cylindrocarpon destructans) And other pathogenic bacteriabeta-tubulin (β-tubulin) Gene sequence, interspecies species of fungus of genus Podosporaβ-tubulinThe gene sequences were compared and analyzed, and a specific LAMP Primer set for P.notoginseng rust disease was designed using online LAMP Primer design software Primer software Explorer V5 (https:// Primer Explorer. Jp/lampv5/index. Html; eiken Chemical Co., japan). The primer is inβ-tubulinThe sites and sequences in the gene sequence are shown in FIG. 1 and Table 2. The FIP primer consists of F1c and F2, and the BIP primer consists of B1c and B2.

TABLE 2 used forCylindrocarpon destructansLAMP detection primer

1. Establishment of LAMP detection method for panax notoginseng rust rot fungi and primer specificity verification

Using DNA of test strains in Table 1 as template, LAMP amplification was performed using F3, B3, FIP and BIP in an LAMP detection system of 25. Mu.L including 5. Mu.M primers F3 and B3 each of 1.0mu.L, 1.0. Mu.L of each of 40. Mu.M primers FIP and BIP, LAMP reaction mixture [ 40 mM Tris-HCl,20 mM (NH) ₄ ) ₂ SO ₄ ，20 mM KCl，16 mM MgSO ₄ 1.6 mol/L Betaine (Betaine), 2.0 mM dNTPs,0.2% Trion X-100 12.5. Mu.L, 8UBstPolymerase 1.0 μ L, DNA template 1.0 μ L, make up to 25 μ L with sterilized ultrapure water; LAMP reaction conditions: incubating at 63 ℃ for 40 min; determination of reaction results: the measurement was carried out by a fluorescent dye visual observation method. After the LAMP reaction is finished, 1.0 mu L of color-developing agent SYBR green I is added into an amplification product of the LAMP reaction, green fluorescence is observed in a color development result under normal illumination, the color development result is judged to be positive in a white turbid precipitation state under the illumination of the ultraviolet light with the wavelength of 365nm, namely, panax notoginseng rust rot germs exist, orange or orange is observed in the color development result under the normal illumination, and the color development result is judged to be negative in a colorless transparent state under the illumination of the ultraviolet light with the wavelength of 365nm, namely, the panax notoginseng rust rot germs do not exist.

4. Verification result of primer specificity

The LAMP amplification result shows that only the color development results of the panax notoginseng rust rot fungi in the tested strains can observe green fluorescence and white turbid precipitates, and the color development results of the other tested strains are orange and transparent (part of the strain detection results are shown in figure 2), so that the designed panax notoginseng rust rot fungi primer F3/B3 and primer FIP/BIP can distinguish the panax notoginseng rust rot fungi from other pathogenic bacteria, have species specificity and can be used for quickly and reliably detecting and identifying the panax notoginseng rust rot fungi.

Example 2: detection sensitivity determination of loop-mediated isothermal amplification (LAMP) of panax notoginseng rust rot bacteria

1. Preparation of genomic DNA at various concentrations

Diluting the genome DNA of the panax notoginseng rust rot disease with sterile ultrapure water to prepare a 10-fold-magnitude series of concentrations for later use;

2. LAMP detection method sensitivity determination and result observation

Using genome DNA of pseudo-ginseng rust rot fungi with different concentrations as templates, and performing LAMP amplification by using a primer F3/B3 and a primer FIP/BIP, wherein the LAMP detection reaction system is 25 mu L and comprises 5 mu M of primers F3 and B31.0 mu.L, 1.0. Mu.L of each of 40. Mu.M primers FIP and BIP, LAMP reaction mixture [ 40 mM Tris-HCl,20 mM (NH) ₄ ) ₂ SO ₄ ，20 mM KCl，16 mM MgSO ₄ 1.6 mol/L Betaine (Betaine), 2.0 mM dNTPs,0.2% Trion X-100 12.5. Mu.L, 8UBst1.0 mu L of polymerase and 1.0 mu L of DNA template with different concentrations, and filling up to 25 mu L with sterilized ultrapure water; LAMP reaction conditions: incubating at 63 ℃ for 40 min; determination of reaction results: and (2) measuring by adopting a fluorescent dye visual observation method, adding 1.0 mu L of a color developing agent SYBR green I into an amplification product of LAMP reaction after the LAMP reaction is finished, observing green fluorescence in a color development result under normal illumination, judging the amplification product to be positive in a white turbid precipitate state under the irradiation of the ultraviolet light with the wavelength of 365nm, and judging the amplification product to be negative in a colorless transparent state under the irradiation of the ultraviolet light with the wavelength of 365nm, wherein orange or orange is observed in the color development result under the normal illumination.

3. LAMP amplification sensitivity detection result

The LAMP amplification sensitivity detection result shows that green fluorescence and white turbid precipitates can be observed in the genomic DNA color development results of the panax notoginseng rust rot fungi with the concentrations of 100pg, 10 pg, 1 pg, 100 fg and 10 fg/muL, and the color development results of the rest concentrations and negative control are orange and colorless transparent, which indicates that the detection sensitivity of the designed panax notoginseng rust rot fungi primers F3, B3, FIP and BIP on the panax notoginseng rust rot fungi can reach 10 fg/muL (figure 3) through LAMP amplification.

Example 3: LAMP detection of pseudoginseng rust rot in diseased leaves

Collecting samples: collecting root pieces and healthy root pieces typical of the disease symptoms of rust rot of panax notoginseng from Fujian Xiapu, fuding and Cudrania tricuspidata, and bringing the root pieces back to a laboratory for later use;

extraction of plant tissue DNA: the method for extracting DNA by adopting NaOH rapid cracking comprises the following specific steps: adding 10 muL of 0.5 mol/L NaOH into each milligram of plant tissue, fully grinding the tissue into paste in a mortar, transferring the paste into a 1.5mL centrifuge tube, centrifuging at 12,000 rpm for 6 min, taking 5 muL of supernatant, adding 495 muL of 0.1 mol/L Tris-HCl (pH = 8.0), uniformly mixing, and taking 1.0 muL as a PCR template for amplification.

Amplification detection and visualizationAnd (3) inspection: using the extracted DNA as a template, LAMP amplification was performed using primers F3, B3, FIP and BIP, and the LAMP detection reaction system was 25. Mu.L, including 1.0. Mu.L each of 5. Mu.M primers F3 and B3, 1.0. Mu.L each of 40. Mu.M primers FIP and BIP, LAMP reaction mixture [ 40 mM Tris-HCl,20 mM (NH) ("40 mM Tris-HCl ]) ₄ ) ₂ SO ₄ ，20 mM KCl，16 mM MgSO ₄ 1.6 mol/L Betaine (Betaine), 2.0 mM dNTPs,0.2% Trion X-100. Mu.L, 8UBstPolymerase 1.0 μ L, DNA template 1.0 μ L, make up to 25 μ L with sterilized ultrapure water; LAMP reaction conditions: incubating at 63 deg.C for 40 min; determination of reaction results: and (2) measuring by adopting a fluorescent dye visual observation method, adding 1.0 mu L of color-developing agent SYBR green I into an amplification product of LAMP reaction after the LAMP reaction is finished, observing green fluorescence in a color development result under normal illumination, judging that the amplification product is positive in a white turbid precipitate state under the irradiation of ultraviolet light with the wavelength of 365nm, namely pseudo-ginseng rust rot germs exist, observing orange or orange in a color development result under normal illumination, judging that the amplification product is negative in a colorless transparent state under the irradiation of the ultraviolet light with the wavelength of 365nm, namely pseudo-ginseng rust rot germs do not exist.

And (3) detection results: the detection result (figure 4) shows that the root block with the panax notoginseng rust rot disease is amplified by LAMP, green fluorescence and white turbid sediment can be observed in the color development result, which indicates that panax notoginseng rust rot bacteria exist, while the color development results of the healthy root block and the negative control are orange and colorless transparent, which indicates that panax notoginseng rust rot bacteria do not exist, and the technology can be used for rapid molecular detection of panax notoginseng rust rot bacteria in plant tissues.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

110. Institute of plant protection of agricultural academy of sciences of Fujian province

120. LAMP primer group for detecting panax notoginseng rust rot and detection method

130 4

160 4

170 PatentIn version 3.3

210 1

211 19

212 DNA

213. Artificial sequences

400 1

AAAGCTCGGGACTTCAACC

19

210 2

211 20

212 DNA

213. Artificial sequences

400 2

TGCTCGCTAGAGATGGTCTG

20

210 3

211 40

212 DNA

213. Artificial sequences

400 3

CTTACGCACTGGCCGGTCTGTTTTGGGACAAGATGGCTGA

40

210 4

211 42

212 DNA

213. Artificial sequences

400 4

CCTCTTCAACGATCCGACGTGCGCACCGATTTGGTTACCCTA

42

Claims

1. An LAMP primer group for detecting pseudo-ginseng rust rot is characterized by comprising the following components:

F3：5’-AAAGCTCGGGACTTCAACC-3’；

B3：5’-TGCTCGCTAGAGATGGTCTG-3’；

FIP：5’-CTTACGCACTGGCCGGTCTG-TTTTGGGACAAGATGGCTGA-3’；

BIP：5’-CCTCTTCAACGATCCGACGTGC-GCACCGATTTGGTTACCCTA-3’。

2. the application of the LAMP primer group of claim 1 in detection of Panax notoginseng Burk.

3. An LAMP detection method for detecting Panax notoginseng Burk-rot using the primer set of claim 1, characterized by comprising the steps of:

(1) Extracting DNA of a sample to be detected: extracting the genome DNA of a sample to be detected according to a CTAB method or by adopting a commercial kit;

(2) LAMP amplification reaction: taking the DNA of a sample to be detected extracted in the step (1) as a template, and carrying out LAMP reaction by using the primer group according to claim 1, wherein the LAMP detection reaction system is 25 mu L and comprises 1.0 mu L of each of 5 mu M primers F3 and B3, 1.0 mu L of each of 40 mu M primers FIP and BIP, 12.5 mu L of LAMP reaction mixed solution, 1.0 mu L of 8U Bst polymerase and 1.0 mu L of DNA template, and the 25 mu L of LAMP reaction mixed solution is supplemented with sterilized ultrapure water; LAMP reaction conditions: incubating at 63 ℃ for 40 min; the LAMP reaction mixture contains 40 mM Tris-HCl,20 mM (NH 4) ₂ SO ₄ ，20 mM KCl，16 mM MgSO ₄ 1.6 mol/L betaine, 2.0 mM dNTPs,0.2wt.% Trion X-100;

(3) Determination of reaction results: and (2) measuring by adopting a fluorescent dye visual observation method, adding 1.0 mu L of color-developing agent SYBR green I into an amplification product of LAMP reaction after the LAMP reaction is finished, observing green fluorescence in a color development result under normal illumination, judging that the amplification product is positive in a white turbid precipitate state under the irradiation of ultraviolet light with the wavelength of 365nm, namely pseudo-ginseng rust rot germs exist, observing orange or orange in a color development result under normal illumination, judging that the amplification product is negative in a colorless transparent state under the irradiation of the ultraviolet light with the wavelength of 365nm, namely pseudo-ginseng rust rot germs do not exist.