CN116286949A - Construction method of miRNA166o in plant photo-transcription process - Google Patents
Construction method of miRNA166o in plant photo-transcription process Download PDFInfo
- Publication number
- CN116286949A CN116286949A CN202310150683.8A CN202310150683A CN116286949A CN 116286949 A CN116286949 A CN 116286949A CN 202310150683 A CN202310150683 A CN 202310150683A CN 116286949 A CN116286949 A CN 116286949A
- Authority
- CN
- China
- Prior art keywords
- mir166o
- poplar
- plant
- precursor sequence
- super
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000034 method Methods 0.000 title claims abstract description 30
- 238000010276 construction Methods 0.000 title claims abstract description 19
- 230000008569 process Effects 0.000 title claims abstract description 17
- 238000013518 transcription Methods 0.000 title claims abstract description 13
- 108091043485 miR166o stem-loop Proteins 0.000 claims abstract description 53
- 239000002243 precursor Substances 0.000 claims abstract description 40
- 241000196324 Embryophyta Species 0.000 claims abstract description 34
- 241000219000 Populus Species 0.000 claims abstract description 27
- 108091033409 CRISPR Proteins 0.000 claims abstract description 22
- 238000010362 genome editing Methods 0.000 claims abstract description 22
- 108091070501 miRNA Proteins 0.000 claims abstract description 20
- 239000002679 microRNA Substances 0.000 claims abstract description 19
- 238000012408 PCR amplification Methods 0.000 claims abstract description 12
- 238000010354 CRISPR gene editing Methods 0.000 claims abstract description 11
- 108020004414 DNA Proteins 0.000 claims abstract description 8
- 238000012163 sequencing technique Methods 0.000 claims abstract description 8
- 239000013598 vector Substances 0.000 claims description 27
- 239000013612 plasmid Substances 0.000 claims description 21
- 230000002018 overexpression Effects 0.000 claims description 15
- 230000014509 gene expression Effects 0.000 claims description 14
- 108091027544 Subgenomic mRNA Proteins 0.000 claims description 13
- 108090000623 proteins and genes Proteins 0.000 claims description 10
- 241000589158 Agrobacterium Species 0.000 claims description 8
- 102000004190 Enzymes Human genes 0.000 claims description 8
- 108090000790 Enzymes Proteins 0.000 claims description 8
- 239000013604 expression vector Substances 0.000 claims description 7
- 241000620209 Escherichia coli DH5[alpha] Species 0.000 claims description 6
- 238000001962 electrophoresis Methods 0.000 claims description 6
- 102000003960 Ligases Human genes 0.000 claims description 4
- 108090000364 Ligases Proteins 0.000 claims description 4
- 238000006243 chemical reaction Methods 0.000 claims description 4
- 238000001976 enzyme digestion Methods 0.000 claims description 4
- 239000003292 glue Substances 0.000 claims description 4
- 230000001404 mediated effect Effects 0.000 claims description 4
- 230000006798 recombination Effects 0.000 claims description 4
- 238000005215 recombination Methods 0.000 claims description 4
- 108091008146 restriction endonucleases Proteins 0.000 claims description 4
- 230000035897 transcription Effects 0.000 claims description 4
- 238000011144 upstream manufacturing Methods 0.000 claims description 4
- 238000012795 verification Methods 0.000 claims description 4
- 230000002401 inhibitory effect Effects 0.000 claims description 3
- 238000013461 design Methods 0.000 claims description 2
- 230000000694 effects Effects 0.000 abstract description 2
- 108700019146 Transgenes Proteins 0.000 abstract 4
- 230000008635 plant growth Effects 0.000 abstract 2
- 238000004161 plant tissue culture Methods 0.000 abstract 1
- 238000012772 sequence design Methods 0.000 abstract 1
- 230000009261 transgenic effect Effects 0.000 description 14
- 241000249899 Populus tomentosa Species 0.000 description 6
- 230000012010 growth Effects 0.000 description 5
- 230000033228 biological regulation Effects 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 238000010586 diagram Methods 0.000 description 3
- 230000004044 response Effects 0.000 description 3
- 206010020649 Hyperkeratosis Diseases 0.000 description 2
- 108091023040 Transcription factor Proteins 0.000 description 2
- 102000040945 Transcription factor Human genes 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 230000008859 change Effects 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 238000007857 nested PCR Methods 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 230000022532 regulation of transcription, DNA-dependent Effects 0.000 description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 1
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- 238000012179 MicroRNA sequencing Methods 0.000 description 1
- 108700011259 MicroRNAs Proteins 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 230000001939 inductive effect Effects 0.000 description 1
- 230000004298 light response Effects 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 230000009456 molecular mechanism Effects 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 238000001243 protein synthesis Methods 0.000 description 1
- 238000011084 recovery Methods 0.000 description 1
- 150000003384 small molecules Chemical class 0.000 description 1
- 230000014616 translation Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a construction method of miRNA166o in a plant photo-transcription process, which comprises the following steps: according to miR166o precursor sequence design primer in the poplar database, take 84K poplar genome DNA as template to carry out PCR amplification of miRNA precursor, obtain miR166o precursor sequence in 84K poplar after sequencing, connect miRNA precursor sequence with super-expression pEGOEP35S-H carrier, construct miR166o super-expression carrier, the invention is scientific and reasonable in structure, it is safe and convenient to use, observe CRISPR/Cas9 gene editing transgene plant and phenotype of super-expression transgene plant tissue culture seedling, miR166o gene editing transgene plant and super-expression transgene plant have apparent difference with wild 84K poplar, plant growth is positive promotion effect after knocking out mi166o, and plant growth is negatively affected after super-expression miR166o.
Description
Technical Field
The invention relates to the technical field of construction of miRNA166o in a plant photo-transcription process, in particular to a construction method of miRNA166o in a plant photo-transcription process.
Background
The growth and development of the forest and the physiological change of the forest are not separated from the light, the light is not only used for photosynthesis to generate energy, but also used as an environmental factor to activate a light receptor signal, mediates the related gene expression, protein synthesis and regulation of a light signal network, plays a very important role in plant physiological metabolism activity and molecular mechanism, however, the research on the forest response light transcription regulation process at present mainly screens transcription factors subjected to light induction change through transcriptome technology, and develops a light response key transcription factor system analysis, function prediction and regulation network, so that reports of researching the forest response light transcription regulation process from the aspect of non-coding protein genes are less seen;
microRNAs are non-coding small molecule single-stranded RNAs with the length of about 22 nucleotides, researches show that miRNAs play an important role in the transcriptional regulation of plants, and the research on genes, especially miRNAs, in the forest response to the transcriptional regulation process is still to be enhanced,
disclosure of Invention
The invention provides a construction method of miRNA166o in the plant photo-transcription process, which can effectively solve the problem that the research of miRNA in the background technology needs to be enhanced.
In order to achieve the above purpose, the present invention provides the following technical solutions: the construction method of miRNA166o in the plant photo-transcription process comprises the following steps: designing a primer according to a miR166o precursor sequence in a populus tomentosa database, performing PCR amplification of a miRNA precursor by taking 84K populus tomentosa genome DNA as a template, sequencing to obtain a miR166o precursor sequence in 84K populus tomentosa, connecting the miRNA precursor sequence with an over-expressed pEGOEP35S-H carrier to construct a miR166o over-expression carrier, and designing a miR166o target point through an online website http:// skl.scau.edu.cn to construct a CRISPR/Cas9 gene editing carrier pEGCas9Pubi-H-ptc-miR166o.
According to the technical scheme, the construction and application of the miR166o overexpression vector comprise the following steps: PCR amplification of miR166o precursor sequence is carried out by taking genomic DNA of 84K Yang Younen leaves as a template, a 316bp miR166o precursor (pre-miR 166 o) is clearly seen in an electrophoresis chart, after sequencing, the miR166o precursor sequence in 84K poplar is confirmed, the precursor sequence is introduced into EcoRI/HindIII enzyme cutting sites, after the PCR product is recovered by cutting glue, the precursor sequence is connected with pEGOEP35S vector, escherichia coli DH5 alpha is transformed, recombinant plasmid is extracted, the recombinant plasmid is correctly verified by EcoRI/HindIII double enzyme cutting, namely, the pEGOEP35S-H-ptc-miR166o super-expression vector is successfully constructed, 84K poplar is infected by an agrobacterium-mediated method, and 84K Yang Zhizhu of the super-expressed miR166o gene is obtained.
According to the technical scheme, the construction and application of the pEGCas9Pubi-H-ptc-miR166o gene editing vector comprise the following steps:
firstly, selecting target sites of target miRNA, searching for NGG in a target region, taking 20 bases at the upstream of the NGG as a knocking-out target sequence, amplifying an sgRNA expression cassette, carrying out enzyme digestion on plasmids, miRNA precursors and the sgRNA expression cassette by using saI-HF restriction endonuclease, simultaneously carrying out recombination construction reaction system on products and vectors by using T4 ligase, converting escherichia coli DH5 alpha, extracting recombinant plasmids, and successfully constructing pEGCas9Pubi-H-ptc-miR166o gene editing vectors by the recombinant plasmids after verification, and infecting 84K poplar by using an agrobacterium mediation method to obtain 84K Yang Zhizhu for inhibiting expression of miR166o genes.
Compared with the prior art, the invention has the beneficial effects that: the invention has scientific and reasonable structure, safe and convenient use, and can observe the phenotype of the tissue culture seedlings of the CRISPR/Cas9 gene editing transgenic plant and the over-expression transgenic plant, wherein the miR166o gene editing transgenic plant and the over-expression transgenic plant have obvious differences with the wild 84K poplar, and compared with the contrast 84K poplar, the CRISPR/Cas9 gene editing miR166o has the advantages of high plant height, thin and long stem, smaller leaf and slender and undeveloped root system; transgenic plants after miR166o overexpression are short, small in leaf, light in color, thin and short in stem, thin and short in root system and underdeveloped, so that the growth of the plants is positively promoted after Mi166o is knocked out, and the growth of the plants is negatively influenced after miR166o is overexpressed.
Drawings
The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate the invention and together with the embodiments of the invention, serve to explain the invention.
In the drawings:
FIG. 1 is a schematic diagram of miR166o precursor sequences in 84K poplar of the invention;
FIG. 2 is a schematic diagram of the structure of a gene editing vector of the present invention;
FIG. 3 is a schematic representation of the structure of the overexpression vector and CRISPR/Cas9 gene editing vector of the invention;
FIG. 4 is a schematic diagram of the structure of both miR166o gene editing transgenic plants and over-expression transgenic plants of the invention compared with wild 84K poplar.
Detailed Description
The preferred embodiments of the present invention will be described below with reference to the accompanying drawings, it being understood that the preferred embodiments described herein are for illustration and explanation of the present invention only, and are not intended to limit the present invention.
Examples: the invention provides a technical scheme, a construction method of miRNA166o in a plant photo-transcription process, which comprises the following steps: designing a primer according to a miR166o precursor sequence in a populus tomentosa database, performing PCR amplification of a miRNA precursor by taking 84K populus tomentosa genome DNA as a template, sequencing to obtain a miR166o precursor sequence in 84K populus tomentosa, connecting the miRNA precursor sequence with an over-expressed pEGOEP35S-H carrier to construct a miR166o over-expression carrier, and designing a miR166o target point through an online website http:// skl.scau.edu.cn to construct a CRISPR/Cas9 gene editing carrier pEGCas9Pubi-H-ptc-miR166o.
According to the technical scheme, the construction and application of the miR166o overexpression vector comprise the following steps: PCR amplification of miR166o precursor sequence is carried out by taking genomic DNA of 84K Yang Younen leaves as a template, a 316bp miR166o precursor (pre-miR 166 o) is clearly seen in an electrophoresis chart, after sequencing, the miR166o precursor sequence in 84K poplar is confirmed, the precursor sequence is introduced into EcoRI/HindIII enzyme cutting sites, after the PCR product is recovered by cutting glue, the precursor sequence is connected with pEGOEP35S vector, escherichia coli DH5 alpha is transformed, recombinant plasmid is extracted, the recombinant plasmid is correctly verified by EcoRI/HindIII double enzyme cutting, namely, the pEGOEP35S-H-ptc-miR166o super-expression vector is successfully constructed, 84K poplar is infected by an agrobacterium-mediated method, and 84K Yang Zhizhu of the super-expressed miR166o gene is obtained.
According to the technical scheme, the construction and application of the pEGCas9Pubi-H-ptc-miR166o gene editing vector comprise the following steps:
firstly, selecting target sites of target miRNA, searching for NGG in a target region, taking 20 bases at the upstream of the NGG as a knocking-out target sequence, amplifying an sgRNA expression cassette, carrying out enzyme digestion on plasmids, miRNA precursors and the sgRNA expression cassette by using saI-HF restriction endonuclease, simultaneously carrying out recombination construction reaction system on products and vectors by using T4 ligase, converting escherichia coli DH5 alpha, extracting recombinant plasmids, and successfully constructing pEGCas9Pubi-H-ptc-miR166o gene editing vectors by the recombinant plasmids after verification, and infecting 84K poplar by using an agrobacterium mediation method to obtain 84K Yang Zhizhu for inhibiting expression of miR166o genes.
As shown in fig. 1, the study screened out one of the measured miRNA-seq data (unpublished) of 741 poplar leaf after LED blue light and white light treatment for miRNA (miR 166 o) significantly differentially expressed therein;
designing primer according to miR166o precursor sequence in the poplar database, carrying out PCR amplification of miR166o precursor sequence by taking genomic DNA of 84K Yang Younen leaf as template, clearly seeing 316bp miR166o precursor (pre-miR 166 o) electrophoresis strip in an electrophoresis chart,
miR166oF：ATGAGGTCTCGCACCAAGGGGTGTTTGGAATGAAGTT
miR166oR：ATGAGGTCTCTACCGTTCGGTGTAAGGAATGAAGCCT
after sequencing (completed by Huada gene Co., ltd.), confirming that the sequence is a miR166o precursor sequence in 84K poplar, introducing EcoRI/HindIII enzyme cutting site into the precursor sequence, cutting and recovering PCR product, connecting with pEGOEP35S vector, converting colibacillus DH5 alpha, extracting recombinant plasmid, and carrying out double enzyme cutting verification on the recombinant plasmid by EcoRI/HindIII to obtain the recombinant plasmid, namely successfully constructing pEGOEP35S-H-ptc-miR166o overexpression vector,
as shown in FIG. 2, through a gene editing vector developed by a Liu Yaoguang institution laboratory and a system website http:// skl.scau.edu.cn/gene target design, firstly, selecting a target site of a target miR166o, searching for NGG in a target area, taking 20 base upstream of the NGG as a knockout target sequence, generally designing and knocking out two targets T1 and T2 in the experimental process, introducing AtU-1 promoter in the front section of the T1 target by adopting a PCR method, introducing AtU6-29 promoter in the front of the T2 target, and introducing gRNAscaffold after TI and T2 targets respectively;
the construction of the sgRNA expression cassette adopts an overlapping PCR and nested PCR amplification method, the first round of PCR amplification is carried out to obtain a U6 promoter and sgRNA, the first round of PCR amplification is carried out to obtain a template containing AtU-1, atU-29 and the sgRNA vector pYLsgRNA-AtU-6-1 and the sgRNA-AtU-29, the second round of PCR amplification is carried out to obtain a sgRNA expression cassette, the first round of PCR amplification is carried out to obtain a pU6 product and the sgRNA product which are amplified as templates, the nested PCR amplification is carried out to obtain an electrophoresis fragment of the amplified sgRNA expression cassette, the glue recovery kit is used to recover a target fragment, the BsaI-HF restriction endonuclease of TaKaRa company is used to carry out enzyme digestion to obtain a plasmid, a miRNA precursor and the sgRNA expression cassette, and a T4 ligase is used to carry out a recombination construction reaction system to obtain a recombinant plasmid, and the recombinant plasmid is successfully constructed to obtain a pEGCas-H-ptc-166 o gene vector;
as shown in fig. 3, the constructed over-expression vector and CRISPR/Cas9 gene editing vector are transferred into agrobacterium, the constructed expression vector is transferred into 84K poplar leaf callus by using an agrobacterium-mediated method, the transgenic process comprises the processes of inducing callus, pre-differentiating, differentiating to generate resistant buds, rooting culture, obtaining the final aseptic seedlings and the like, and the over-expression vector pEGOEP35S-H-ptc-miR166o and the CRISPR/Cas9 expression vector pEGCas9Pubi-H-ptc-miR166o are transferred into 84K poplar to obtain resistant plants;
as shown in fig. 4, the phenotype of the CRISPR/Cas9 gene editing transgenic plant and the tissue culture seedling of the overexpressing transgenic plant is observed, the miR166o gene editing transgenic plant and the overexpressing transgenic plant are obviously different from the wild 84K poplar, and compared with the control 84K poplar, the CRISPR/Cas9 gene editing miR166o has the advantages that the transgenic poplar tissue culture seedling plant is high, thin and long in stem, small in leaf and slender and undeveloped in root system; transgenic plants after miR166o overexpression are short, small in leaf, light in color, thin and short in stem, thin and short in root system and underdeveloped, so that the growth of the plants is positively promoted after Mi166o is knocked out, and the growth of the plants is negatively influenced after miR166o is overexpressed.
Finally, it should be noted that: the foregoing is merely a preferred example of the present invention, and the present invention is not limited thereto, but it is to be understood that modifications and equivalents of some of the technical features described in the foregoing embodiments may be made by those skilled in the art, although the present invention has been described in detail with reference to the foregoing embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims (3)
- A method for constructing mirnas 166o in a plant light transcription process, characterized in that: the method comprises the following steps: designing a primer according to a miR166o precursor sequence in a database, performing PCR amplification of a miRNA precursor by taking 84K poplar genome DNA as a template, sequencing to obtain a miR166o precursor sequence in 84K poplar, connecting the miRNA precursor sequence with an overexpressed pEGOEP35S-H vector to construct a miR166o overexpression vector, and constructing a CRISPR/Cas9 gene editing vector pEGCas9Pubi-H-ptc-miR166o through target design.
- 2. The method for constructing the miRNA166o in the plant photo-transcription process according to claim 1, wherein the construction of the miR166o overexpression vector comprises the following steps: PCR amplification of miR166o precursor sequence is carried out by taking genomic DNA of 84K Yang Younen leaves as a template, a 316bp miR166o precursor is clearly seen in an electrophoresis pattern, after sequencing, the miR166o precursor sequence in 84K poplar is confirmed, the precursor sequence is introduced into EcoRI/HindIII enzyme cutting sites, PCR product is recovered after cutting glue, the PCR product is connected with a pEGOEP35S vector to transform escherichia coli DH5 alpha, recombinant plasmid is extracted, the recombinant plasmid is correctly verified by EcoRI/HindIII double enzyme cutting, namely, the pEGOEP35S-H-ptc-miR166o super-expression vector is successfully constructed, 84K poplar is infected by an agrobacterium-mediated method, and 84K Yang Zhizhu of the super-expressed miR166o gene is obtained.
- 3. The method for constructing the miRNA166o in the plant light transcription process according to claim 2, wherein the construction of the pEGCas9Pubi-H-ptc-miR166o gene editing vector comprises the following steps:firstly, selecting target sites of target miRNA, searching for NGG in a target region, taking 20 bases at the upstream of the NGG as a knocking-out target sequence, amplifying an sgRNA expression cassette, carrying out enzyme digestion on plasmids, miRNA precursors and the sgRNA expression cassette by using saI-HF restriction endonuclease, simultaneously carrying out recombination construction reaction system on products and vectors by using T4 ligase, converting escherichia coli DH5 alpha, extracting recombinant plasmids, and successfully constructing pEGCas9Pubi-H-ptc-miR166o gene editing vectors by the recombinant plasmids after verification, and infecting 84K poplar by using an agrobacterium mediation method to obtain 84K Yang Zhizhu for inhibiting expression of miR166o genes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310150683.8A CN116286949A (en) | 2023-02-22 | 2023-02-22 | Construction method of miRNA166o in plant photo-transcription process |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310150683.8A CN116286949A (en) | 2023-02-22 | 2023-02-22 | Construction method of miRNA166o in plant photo-transcription process |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116286949A true CN116286949A (en) | 2023-06-23 |
Family
ID=86784460
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310150683.8A Pending CN116286949A (en) | 2023-02-22 | 2023-02-22 | Construction method of miRNA166o in plant photo-transcription process |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116286949A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117683103A (en) * | 2023-11-24 | 2024-03-12 | 南京林业大学 | Small peptide miPEP166i and application thereof in plant tissue culture |
-
2023
- 2023-02-22 CN CN202310150683.8A patent/CN116286949A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117683103A (en) * | 2023-11-24 | 2024-03-12 | 南京林业大学 | Small peptide miPEP166i and application thereof in plant tissue culture |
| CN117683103B (en) * | 2023-11-24 | 2024-05-14 | 南京林业大学 | Small peptide miPEP i and application thereof in plant tissue culture |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11702667B2 (en) | Methods and compositions for multiplex RNA guided genome editing and other RNA technologies | |
| Nakajima et al. | CRISPR/Cas9-mediated targeted mutagenesis in grape | |
| Arora et al. | Gene editing and crop improvement using CRISPR-Cas9 system | |
| Xu et al. | Exploring miRNAs for developing climate-resilient crops: a perspective review | |
| Mushtaq et al. | CRISPR-based genome editing tools: Insights into technological breakthroughs and future challenges | |
| Cuperus et al. | Evolution and functional diversification of MIRNA genes | |
| Biswal et al. | CRISPR mediated genome engineering to develop climate smart rice: Challenges and opportunities | |
| Liang et al. | A new strategy for construction of artificial miRNA vectors in Arabidopsis | |
| Zhao et al. | An efficient Potato virus X-based microRNA silencing in Nicotiana benthamiana | |
| Jian et al. | Virus-based microRNA silencing and overexpressing in common wheat (Triticum aestivum L.) | |
| CN116286949A (en) | Construction method of miRNA166o in plant photo-transcription process | |
| Tan et al. | Recent progress in the regeneration and genetic transformation system of cucumber | |
| CN110938617A (en) | Lilium regale LrPAL-1 gene and application thereof | |
| CN117802148A (en) | Method for regulating rice plant type | |
| CN111621504B (en) | Stress-resistant gene BjuIBS of tumorous stem mustard and application thereof | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN103602705A (en) | Method for obtaining safely and optionally killed transgenic rice by using artificial micro ribonucleic acids (amiRNAs) | |
| CN112226457B (en) | Application of rice osa-miR5504 gene in rice dwarf breeding | |
| CN112226458B (en) | Method for improving rice yield by using rice osa-miR5511 gene | |
| Zhao et al. | Rolling circle amplification (RCA)-mediated genome-wide ihpRNAi mutant library construction in Brassica napus | |
| CN107236740A (en) | Pears PbrmiR397a and its application | |
| CN110684797B (en) | VIGS vector based on TCV with simultaneous silencing of 2 endogenous genes | |
| CN113493786A (en) | Method for improving rice grain traits by blocking or weakening expression of OsMIR3979 in rice | |
| CN106434692A (en) | Applications of rice OsPCF7 gene in culturing high-tillering rice varieties | |
| Park et al. | MicroRNA396 negatively regulates shoot regeneration in tomato |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |